RESUMEN
BACKGROUND: Human papillomavirus (HPV) is associated with cervical cancer and cervical dysplasia worldwide. Data on HPV prevalence in a region is important because it serves as a predictor of the likelihood of the population in that particular region acquiring cervical cancer. Moreover, with the availability of effective vaccines, the public health system must be aware of the preponderance of HPV to implement the vaccine. The present study was designed to understand the prevalence of HPV and associated factors among the women of South Andaman Island. METHODS: A cross-sectional study was conducted among married women of reproductive age (18-59 years) from South Andaman District from 2018 to 2022. Cervical scrapes were collected from participants after obtaining informed written consent for HPV molecular testing (HPV DNA) such as PCR assay. Demographic data was collected using a standard questionnaire and statistical analyses were performed to determine the associated factors. RESULTS: The study showed prevalence of HPV as 5.9%(95% CI: 3.9-7.9) and prevalence of HR-HPV16 was 4.1% (95% CI 2.6 - 5.5) and HR-HPV18 prevalence was 1.8(95% CI: 0.6-3). The independent factors associated the HPV positivity were age above 55 years, menopause, post-menopausal bleeding, blood-stained vaginal discharge and loss of weight. Age was associated with all HPV infections among the South Andaman women. CONCLUSIONS: HPV 16 was reported as the predominant high risk HPV type circulating among women of South Andaman. Cervical cancer and precancerous lesions were significantly associated with HPV positivity and High risk HPV 16. Based on the knowledge of the risk factors associated with HPV, implementation of stronger public health awareness and prophylactic HPV vaccination is crucial among the women of this remote island.
Asunto(s)
Infecciones por Papillomavirus , Vacunas contra Papillomavirus , Neoplasias del Cuello Uterino , Humanos , Femenino , Adolescente , Adulto Joven , Adulto , Persona de Mediana Edad , Infecciones por Papillomavirus/prevención & control , Neoplasias del Cuello Uterino/prevención & control , Estudios Transversales , Papillomavirus Humano 16/genética , Factores de Riesgo , India/epidemiología , Papillomaviridae/genética , Prevalencia , Vacunas contra Papillomavirus/uso terapéuticoRESUMEN
Unsafe abortion refers to induced abortions performed without trained medical assistance. While previous studies have investigated predictors of unsafe abortion in India, none have addressed these factors with accounting sample selection bias. This study aims to evaluate the contributors to unsafe abortion in India by using the latest National Family Health Survey data conducted during 2019-2021, incorporating the adjustment of sample selection bias. The study included women aged 15 to 49 who had terminated their most recent pregnancy within five years prior to the survey (total weighted sample (N) = 4,810). Descriptive and bivariate statistics and the Heckman Probit model were employed. The prevalence of unsafe abortion in India was 31%. Key predictors of unsafe abortion included women's age, the gender composition of their living children, gestation stage, family planning status, and geographical region. Unsafe abortions were typically performed in the early stages of gestation, often involving self-administered medication. The primary reasons cited were unintended pregnancies and health complications. This study underscores the urgent need for targeted interventions that take into account regional, demographic, and social dynamics influencing abortion practices in India.
Asunto(s)
Aborto Inducido , Embarazo , Niño , Femenino , Humanos , Embarazo no Planeado , Encuestas y Cuestionarios , India/epidemiologíaRESUMEN
During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.
RESUMEN
Citrus yellow vein clearing virus is a previously reported citrus virus from Asia with widespread distribution in China. In 2022, the California Department of Food and Agriculture conducted a multipest citrus survey targeting multiple citrus pathogens including citrus yellow vein clearing virus (CYVCV). In March 2022, a lemon tree with symptoms of vein clearing, chlorosis, and mottling in a private garden in the city of Tulare, California, tested positive for CYVCV, which triggered an intensive survey in the surrounding areas. A total of 3,019 plant samples, including citrus and noncitrus species, were collected and tested for CYVCV using conventional reverse transcription polymerase chain reaction, reverse transcription quantitative polymerase chain reaction, and Sanger sequencing. Five hundred eighty-six citrus trees tested positive for CYVCV, including eight citrus species not previously recorded infected under field conditions. Comparative genomic studies were conducted using 17 complete viral genomes. Sequence analysis revealed two major phylogenetic groups. Known Asian isolates and five California isolates from this study made up the first group, whereas all other CYVCV isolates from California formed a second group, distinct from all worldwide isolates. Overall, the CYVCV population shows rapid expansion and high differentiation indicating a population bottleneck typical of a recent introduction into a new geographic area.
Asunto(s)
Citrus , Flexiviridae , Enfermedades de las Plantas , Flexiviridae/genética , Flexiviridae/aislamiento & purificación , China , California , Citrus/virología , Enfermedades de las Plantas/virología , Transcripción Reversa , Reacción en Cadena de la PolimerasaRESUMEN
In India, an expanding ageing population will become a public health alarm, putting additional pressure on the healthcare system. Therefore, the current study aimed to examine the factors associated with outpatient healthcare choices among older Indian adults. We used data from the first wave of the Longitudinal Ageing Study in India (LASI, 2017-2018). A total of 34,588 individuals (age 45 years and over) who accessed outpatient healthcare services in the last 12 months during the survey were included in this research. A bivariate chi-square test was used to present the percentage distribution of types of outpatient healthcare utilisation by background characteristics. Multinomial logistic regression and Wagstaff's decomposition analyses were employed to explore the interplay of outpatient healthcare utilisation and allied predisposing, enabling, and need factors and examine these factors' contributions to the wealth-based inequalities in public, private, and other healthcare utilisation. Outpatient healthcare utilisation varied significantly according to socioeconomic and demographic factors. The findings suggest that consumption quintiles, place of residence, education, and health insurance were significant determinants of private and public healthcare utilisation and contributed to wealth-based inequalities in healthcare choices. The current study emphasises the need to strengthen and promote public healthcare services.
Asunto(s)
Atención Ambulatoria , Aceptación de la Atención de Salud , Sector Privado , Humanos , India , Femenino , Masculino , Persona de Mediana Edad , Atención Ambulatoria/estadística & datos numéricos , Aceptación de la Atención de Salud/estadística & datos numéricos , Anciano , Estudios Longitudinales , Sector Público , Factores Socioeconómicos , Anciano de 80 o más AñosRESUMEN
Organosilanes have attracted the attention of researchers for more than 150 years due to their unique properties, and they have become indispensable industrial assets. However, many synthesized oligosilanes with multiple Si-Si bonds are relatively simple, i.e., they often only contain a single repeating unit. More laborious customized synthetic routes can lead to more complex oligosilanes, but compared to carbon-based molecules, their structural diversity remains limited. The development of effective and practical synthetic routes to complex oligosilanes that contain mixed substituents constitutes a long-standing challenge. Here, we describe an iterative synthesis of oligosilanes using methoxyphenyl- or hydrogen-substituted silylboronates, which were obtained via transition-metal-catalyzed Si-H borylation reactions. The first key reaction is a cross-Si-Si bond-forming reaction between chloro(oligo)silanes and silylboronates activated by MeLi. The second key reaction is the selective chlorination of the methoxyphenyl group or the hydrogen atom at the terminal of the oligosilanes. Iteration of these two key reactions enables the synthesis of various oligosilanes that are otherwise difficult to access. As a demonstration of the synthetic utility of this iterative synthetic approach, oligosilanes with different sequences were prepared by simply changing the order of the reaction of four different silicon units. Furthermore, a bespoke tree-shaped oligosilane is easily obtained via the present iterative synthesis. The solid-state structures of several of these oligosilanes were unequivocally determined using single-crystal X-ray diffraction analysis.
RESUMEN
Hibiscus is native to southeast Asia but well suited to Colombia's arid soil and dry climates from the coast to the mountains of Bogotá. Viruses infecting hibiscus in Colombia are largely unexplored, with four viruses previously known: hibiscus chlorotic ringspot virus (HCRSV), hibiscus latent Fort Pierce virus (HLFPV), hibiscus latent Singapore virus (HLSV), and citrus leprosis virus C2 (CiLV-C2) (Padmanabhan et al., 2023). Mixed infections between these viruses were frequently detected. A recent virome analysis of a single hibiscus plant from Colombia revealed multiple viruses in mixed infection; : HCRSV, HLFPV, passion fruit green spot virus (PFGSV), a strain of physalis vein necrosis nepovirus, four novel carlavirus, one new potexvirus and a mitovirus. In addition, few smaller contigs of blunervirus and soymovirus were also identified in the high throughput sequencing (HTS) data, but their presence in the mixed infection could not be validated (A. Roy et al. 2023unpublish data). During Brevipalpus-transmitted virus (BTV) surveys, two asymptomatic and 15 hibiscus foliar samples showing green ringspots with central chlorotic spots in senescing areas, mosaic, and black or chlorotic spots were collected from six departments (states) in three geographical regions of Colombia: Tolima (n=4) and Cauca Valley (n=2) (Andean region), Meta (n=6) and Casanare (n=1) (Orinoquia region), and Quindío (n=1) and Risaralda (n=1) (coffee growing region). About 100 mg of 17 hibiscus leaf samples were separately processed for RNA isolation without DNase I treatment and tested for known BTVs, and for newly discovered hibiscus soymovirus (HSV; genus Soymovirus family Caulimoviridae) using PCR assays (Padmanabhan et al. 2023, Wang et al. 2023). To identify potential HSV infection in the samples, published SVF1/SVR1 and newly designed primer pairs (HSV-REP-F/-R and HSV-CPG-F/-R) were used to amplify the 430 nt transactivation (ORF-VI), 631 nt replicase (REP) and 401 nt coat protein gene (CPG), respectively (Supplementary 1). Of 17 samples tested, three from Tolima and one each from Meta and Quindío yielded all three expected size amplicons. Bi-directional sequencing followed by BLASTn analysis revealed 95-98% nt identity with the CPG, REP, and ORF-VI genes of HSV (OP757659). Ribo-depleted libraries were prepared using the RNA extracts of five HSV PCR positive samples. HTS yielded 11.6 to 50.3 million raw reads per sample library. Adapters were trimmed and filtered from the raw reads with Trimmomatic v0.39 and then assembled using SPAdes v3.15.5 (Padmanabhan et al., 2023). Contigs were blasted against the Arabidopsis proteome and a RefSeq-based viral protein database. Potential viral sequences were then blasted against the complete NCBI nr database. Assembled soymo contigs covered 99-100% of the HSV genome, with per-nucleotide read depths of 23.8 to 393. Contigs from the Tolima (Accessions; OR621030- OR621032 and Quindío samples (OR621033) covered 99-100% of the HSV genome and had >96-98% nt identity to Hawaiian isolate (OP757659) whereas the Meta sample contigs covered 78% of the genome with 9495% nt identity. HTS contigs shared >98-99% nt identities with their PCR amplicons. Along with HSV, other virus sequences (HCRSV, HLFPV, PFGSV, CiLV-C2, and mycoviruses) were variously detected from all five libraries. Due to mixed infection no symptom similarity was noticed among these 5 samples. The findings in hibiscus in Tolima, Meta and Quindío represent the first confirmed report of HSV infection in hibiscus in Colombia. The widespread distribution suggests the possibility of HSV dispersion via movement of planting material, and potential further spread to another hibiscus growing region.
RESUMEN
BACKGROUND: Acute respiratory infections (ARIs) and severe acute respiratory illness (SARI) are public health burdens globally. The percentage of non-SARS CoV-2 respiratory viruses among patients having ARI and SARI who visit Car Nicobar's hospital settings is undocumented. Changes in the epidemiology of other respiratory viruses during COVID19 pandemic is being reported worldwide. METHODS: Inpatient and outpatient settings at BJR hospital, Car Nicobar Island, India, were used to conduct prospective monitoring for ARI and SARI among Nicobarese tribal members. The patients with ARI and SARI were enlisted in BJR hospital from June 2019 to May 2021. At the ICMR-NIV in Pune, duplex RT-PCR assays were used to test the presence of respiratory viruses. The prevalence of non- SARS CoV-2 respiratory viruses was measured by comparing here between pandemic and pre-pandemic periods. RESULTS: During the COVID19 pandemic, Influenza A (H3N2) and rhinovirus were predominantly reported non-SARS CoV-2 respiratory viruses while Human metapneumovirusand influenza A (H1N1)pdm09were most commonly reported in the prepandemic period. This result indicates the altered circulation of non-SARS CoV-2 during pandemic. CONCLUSIONS: A considerable proportion of respiratory infection was correlated with respiratory viruses. Prevalence of non-SARS CoV-2 respiratory viruses was high at the time of infection when compared with pre-pandemic period, at Car Nicobar Island. This study enlightened the change in circulation of other respiratory viruses among the indigenous Nicobarese tribes. Clinicians and allied medical staff should be more prudent of these respiratory infections.
Asunto(s)
COVID-19 , Subtipo H1N1 del Virus de la Influenza A , Gripe Humana , Infecciones del Sistema Respiratorio , COVID-19/epidemiología , Humanos , India/epidemiología , Subtipo H3N2 del Virus de la Influenza A , Gripe Humana/epidemiología , Pandemias , Estudios Prospectivos , Infecciones del Sistema Respiratorio/epidemiología , SARS-CoV-2RESUMEN
BACKGROUND: Demand for family planning is predominantly for birth limiting rather than birth spacing in India. Despite several family planning programmes in India, the use of reversible contraception for limiting family planning has been stagnant and largely depends on female sterilization. Though many researchers have examined patterns and determinants of using modern contraception for total family planning, studies on patterns and determinants of contraceptive use for birth limiting are limited in India. This paper examines the patterns of contraceptive use for liming demand and its determinants in India. METHODS: The National Family Health Survey-4, 2015-16 data was used. Bivariate chi-square significant test and multivariate binary logistic regression model used to accomplish the study objectives. RESULTS: Majority of women (86.5%) satisfied limiting demand (SLD) in India; the SLD was found significantly low among the women's age 15-19 years (53.1%) and parity 0 (42%). The satisfied limiting demand by modern reversible contraception (mrSLD) was found significantly high in age group 15-19 years (49.1%), Muslims (30.6%) and North-east region (45.4%). The satisfied limiting demand by traditional contraception (tSLD) was almost three times higher in North-east region (26.1%) than national average of India (8.7%). The women's years of schooling, wealth status, religion and presence of son child found to be significant determinants of mrSLD. The likelihood of tSLD was found significantly high among the women who had no son child (AOR = 1.41; 95% CI:1.34, 1.48), Muslim (AOR = 1.78; 95% CI:1.70, 1.87). A considerable regional variability in levels of SLD, mrSLD and tSLD was found in India. CONCLUSION: Public investment in family planning is required to promote and provide subsidized modern reversible contraception (MRC) services, especially to women from North-east region, Muslim, Scheduled tribe, poor household and who had no son child. Improving the quality and availability of MRC services in public health centre will be helpful to increase SLD among the above mentioned women. Besides, the promotion of MRC will be supportive to overcome the issues of sterilization regrets in India.
Asunto(s)
Anticonceptivos , Servicios de Planificación Familiar , Adolescente , Adulto , Niño , Anticoncepción , Conducta Anticonceptiva , Anticonceptivos/uso terapéutico , Femenino , Encuestas Epidemiológicas , Humanos , India , Embarazo , Adulto JovenRESUMEN
BACKGROUND: In India, the demand for outpatient care is substantially higher than inpatient care among older adults. Therefore, the current study examines the level, patterns, and factors associated with outpatient care use. METHODS: The present research used data from the first wave of the Longitudinal Ageing Study in India (LASI, 2017-18). A total of 34,588 older adults (45 years and above) who accessed outpatient healthcare services in one year prior to the survey were included in this study. A bivariate chi-square test was applied to present the percentage distribution of types of outpatient healthcare utilization by background characteristics and healthcare responsiveness. Multinomial logistic regression analyses were employed to explore the interplay of outpatient healthcare utilization and allied predisposing, enabling, and need factors. RESULTS: About 63.7% of total older adults used a private facility, followed by 22.8% used a public facility, and 13.5% used other facilities. Years of schooling, household wealth status, place of residence, self-rated health, and health insurance were all found to be significant determinants of public or private facility use. In contrast, respondents' sex was found to be a significant determinant of private healthcare use only. The study finds that there was inadequate healthcare reaction to public health facilities. CONCLUSION: The current study revealed that the use of private facility for outpatient care is noticeably high in India. Older adults' educational attainments, health insurance coverage, and household level economic background were found to be significant factors in healthcare choice. The current study emphasizes the need to strengthen public healthcare services for outpatient care.
Asunto(s)
Atención Ambulatoria , Instituciones de Salud , Humanos , Anciano , India/epidemiología , Aceptación de la Atención de Salud , Atención a la SaludRESUMEN
BACKGROUND: The prevalence of unsafe abortions significantly varies with geography; therefore, more research is needed to understand the rural-urban differences in unsafe abortion practices in India. The present study aims to explore the rural-urban differences in predisposing, enabling, and need factors of unsafe abortion in India. METHODS: The present study used the fourth round of the National Family Health Survey (2015-16) and included the women aged 15-49 who terminated pregnancies by induced abortion during the 5 years prior to the survey (N = 9113) as the study sample. Descriptive statistics, bivariate chi-square significance test and multivariate logistic regression model were used to accomplish the study objectives. RESULTS: The findings revealed that almost one-third of pregnancies were terminated through unsafe measures with sharp rural-urban contrast. The likelihood of unsafe abortions increases with decreasing women's age and spousal level of education. Younger women in urban settings were more vulnerable to unsafe abortion practices. In rural settings, women with an uneducated spouse are more likely to have unsafe abortions (OR: 1.92). Poor households were more likely to undergo unsafe abortions, which were more common in rural settings (OR: 1.26). The unmet need for family planning was revealed to be a significant need factor for unsafe abortion, particularly in rural settings. CONCLUSION: Although abortion is legal, India's high estimated frequency of unsafe abortions reveals a serious public health issue. Due to socio-economic vulnerability, unmet family planning needs, and a lack of awareness, significant numbers of women still practice unsafe abortions in India.
Asunto(s)
Aborto Inducido , Aborto Espontáneo , Escolaridad , Servicios de Planificación Familiar , Femenino , Humanos , Embarazo , Población RuralRESUMEN
Passiflora edulis, commonly known as passion fruit, is a vine species of passionflower native to South America. In Colombia, yellow passion fruit (P. edulis f. flavicarpa) is the most important species in terms of net production and local consumption. Recently two brevipalpus transmitted cileviruses, (i) passion fruit green spot virus (PfGSV) and (ii) hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) were detected in passion fruit in Brazil and Hawaii, respectively (Ramos-González et al., 2020, Olmedo-Velarde et al., 2022). CiLV-C2H infects both citrus and hibiscus in Colombia (Roy et al., 2015, 2018) but there was no report of PfGSV elsewhere apart from Brazil and Paraguay (Costa-Rodrigues et al., 2022). Apart from emerging begomovirus diseases, five major viruses are known to infect passion fruit in Colombia: soybean mosaic virus (SMV), cowpea aphid-borne mosaic virus, passion fruit yellow mosaic virus, cucumber mosaic virus, and a tentative Gulupa bacilliform badnavirus A (Cardona et al., 2022). Current findings of CiLV-C2H in passion fruit and PfGSV in hibiscus motivated us to investigate the possibilities of cilevirus infection in passion fruit in Colombia. During surveys, along with healthy yellow passion fruit leaves, five symptomatic plant samples from Meta and three from Casanare were collected before sent to the Molecular Plant Pathology Laboratory at Beltsville, MD under APHIS permit. Passion fruit samples from Meta showed leaf mottling, rugose mosaic, and leaf distortion, whereas leaf variegation, chlorotic spots, yellowing, green spots in senescent leaves and green vein banding were observed in the Casanare samples (Supp. Fig. 1). Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, USA). To know the potential cilevirus infection in these samples, three PfGSV specific (Ramos-González et al. 2020) and a CiLV-C2 generic primer pairs (Olmedo-Velarde et al. 2021) were used in the RT-PCR assays. All five passion fruit samples from Meta failed to produce either CiLV-C2 or CiLV-C2H or PfGSV amplicon whereas all three Casanare samples successfully amplified 321, 244 and 299 nts of PfGSV-RNA1 and -RNA2 amplicons using C13F/C13R, C6F/C6R and C8F/C8R primers, respectively. Bi-directional amplicon sequencing followed by BlastN analysis revealed ≥99% nt identity with the PfGSV-RNA1 (MK804173) and -RNA2 (MK804174) genome sequences. An optimized ribo-depleted library preparation protocol was utilized to prepare two cDNA libraries using the RNA extracts of a PfGSV suspected positive (Casanare) and a negative (Meta) samples (Chellappan et al., 2022). HTS libraries of Casanare and Meta samples resulted in 22.7 to 29.5 million raw reads, respectively. After adapter trimming and filtering, clean reads were mapped to the Arabidopsis thaliana reference genome and unmapped reads were de novo assembled (Chellappan et al., 2022). BlastN analysis from the assembled contigs identified 1-3 contigs corresponding to PfGSV-RNA1 and -RNA2, respectively, from Casanare sample whereas 3 contigs of SMV were identified in Meta passion fruit sample. No other virus sequence was obtained from either of the libraries. Assembled contigs covered 99.33% of the RNA1 and 94.42% of the RNA2 genome, with read depths of 64,474 and 119,549, respectively. Meta sample contigs (OP564897) covered >99% of the SMV genome, which shared >99% nt identity with the Colombian SMV isolates (KY249378, MW655827). Both RNA-1 (OP564895) and -2 (OP564896) segments of the Casanare isolate shared 99% nt identity with PfGSV isolate (MK804173-74). Our discovery identified PfGSV in Colombia, for the first-time outside Brazil and Paraguay. The findings of PfGSV in yellow passion fruit increases the potential threat and possibility of PfGSV movement via Brevipalpus sp. from passion fruit to other hosts.
RESUMEN
In Hawaii, passionfruit (Passiflora edulis; Passifloraceae) is grown primarily in residential properties and community gardens (CG). In 2019, passionfruit plants displaying chlorotic spots on young leaves, and green spots in senescing leaves were observed at two CG in Honolulu. Symptoms resembled those of passionfruit green spot virus (PfGSV) infection in Passiflora spp. (Ramos-González et al. 2020) and of the hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) infection in hibiscus in Hawaii (Melzer et al. 2013). Both viruses belong to the genus Cilevirus, family Kitaviridae. Total RNA was extracted from two sample pools comprised of 40 symptomatic leaves collected from both the CG following a CTAB-based procedure (Li et al. 2008). To identify the virus associated with the P. edulis infection, reverse transcription (RT)-polymerase chain reaction (PCR) was performed using CiLV-C2 (Olmedo-Velarde et al. 2021) and PfGSV specific primers (Ramos-González et al. 2020). RT-PCR assay amplified the CiLV-C2 amplicon but failed to produce the PfGSV amplicon from infected leaves. Amplicon sequencing followed by a BLASTn search showed the nucleotide sequence had >99% identity with the CiLV-C2H-RNA1 (KC626783). A ribo-depleted RNA library created using the TruSeq Stranded Total RNA Library Prep kit (Illumina) underwent high throughput sequencing (HTS) on a NextSeq550 Illumina platform (2x75 cycles). The 6.5 million raw reads obtained were trimmed, filtered, and de novo assembled using Metaviral SPAdes v. 3.15.02 (Antipov et al. 2020). The resulting contigs were searched against an in-house database generated from GenBank virus and viroid sequences using BLASTn. This identified 12 and 3 contigs corresponding to CiLV-C2H and watermelon mosaic virus, respectively, with the latter being previously reported in passionfruit (Watanabe et al. 2016). RNA1 contigs covered 80.17% of the CiLV-C2H genome, whereas RNA2 contigs covered 94.5% with an average coverage depth of 31.660 and 57.121, respectively. To obtain the near complete genome of CiLV-C2H, gaps from the assembled HTS data were filled by overlapping RT-PCR followed by Sanger sequencing. RNA1 (8,536 nt, Acc. No. MW413437) and RNA2 (4,878 nt, MW413438) genome sequences shared 99.2% and 97.0% identity with CiLV-C2H-RNA1 (KC626783) and -RNA2 (KC626784). To further confirm the presence of CiLV-C2H in symptomatic P. edulis plants, 40 symptomatic leaf samples were individually tested by RT-PCR, and 30 samples were positive. Brevipalpus mites collected from CiLV-C2H-positive P. edulis leaves were transferred to common bean (Phaseolus vulgaris) seedlings (Garita et al. 2013). At 15-30 days post-transfer, RNA extracted from lesions observed in recipient plants tested positive for CiLV-C2H by RT-PCR. Total RNA from individual Brevipalpus mites was isolated, and cDNA was prepared to tentatively identify the mite species involved in CiLV-C2H transmission in passionfruit (Druciarek et al 2019, Olmedo-Velarde et al. 2021). CiLV-C2H was detected in individual mites, and the 28S ribosomal mite RNA sequence (MZ478051) shared 99-100% nucleotide identity with B. yothersi (MK293678 and MT812697), a vector of CiLV-C2 (Roy et al. 2013). CiLV-C2 currently has a host range limited to the families Malvaceae, Araceae, and Rutaceae (Roy et al. 2015). CiLV-C2H infects hibiscus alone and citrus in mixed infection with CiLV-C2 (Roy et al; 2018) which is responsible for causing citrus leprosis disease. Detection of CiLV-C2H in passionfruit expands the number of host families of CiLV-C2H.
RESUMEN
Little-explored hydrosilylation of ketenes promoted by main-group catalysts is reported. The boron Lewis acid tris(pentafluorophenyl)borane accelerates the slow uncatalyzed reaction of ketenes and hydrosilanes, thereby providing a convenient access to the new class of ß,ß-di- and ß-monoaryl-substituted aldehyde-derived silyl enol ethers. Yields are moderate to high, and Z configuration is preferred. The corresponding silyl bis-enol ethers are also available when using dihydrosilanes. The related trityl-cation-initiated hydrosilylation involving self-regeneration of silylium ions is far less effective.
RESUMEN
BACKGROUND: Caesarean section delivery is a major life-saving obstetric surgical intervention for mothers and babies from pregnancy and childbirth related complications. This paper attempts to investigate the geographical variations and correlating factors of caesarean section delivery in India, particularly focusing on the states of Bihar and Tamil Nadu, accounting for one of the lowest and highest prevalence states of caesarean section delivery respectively. METHODS: This study is based on secondary data, collected from the fourth round of the National Family Health Survey (NFHS-4), 2015-16. We utilized 190,898 women aged 15-49 years who had a living child during the past 5 years preceding the survey. In this study, caesarean section delivery was the outcome variable. A variety of demographic, socio-economic, and pregnancy- and delivery-related variables were considered as explanatory variables. Descriptive statistics, bivariate percentage distribution, Pearson's Chi-square test, and multivariate binary logistic regression models were employed to draw the inferences from data. RESULTS: Of participants, about 19% of women had undergone caesarean section delivery in the country. The state-wise distribution shows that Telangana (60%) followed by Andhra Pradesh (42%) and Tamil Nadu (36%) represented the topmost states in caesarean delivery, while Bihar (7%), Madhya Pradesh (10%), and Jharkhand (11%) placed at the bottom end. Multivariate logistic models show that the likelihood of caesarean delivery was higher among older women (35-49 years), women with higher levels of education, Muslims, women belonging to the upper quintiles of the household wealth, and those who received antenatal care (ANC), experienced pregnancy loss and delivery complications. Moreover, the odds of caesarean section delivery were remarkably greater for the private health sector than the public health sector in both focused states: Bihar (odds ratio [OR] = 12.84; 95% confidence interval [CI]: 10.90, 15.13) and Tamil Nadu (OR = 2.90; 95% CI: 2.54, 3.31). CONCLUSION: Findings of this study suggest that improvement in female education, providing economic incentives, and spreading awareness through mass media could raise the caesarean section delivery among women whose vaginal delivery could be unsafe for them as well as for their babies. Moreover, providing adequate ANC and well-equipped public healthcare services would facilitate caesarean delivery among needy women.
Asunto(s)
Aborto Espontáneo , Cesárea , Anciano , Niño , Parto Obstétrico , Femenino , Humanos , India/epidemiología , Embarazo , Atención Prenatal , Factores SocioeconómicosRESUMEN
In June 2020, Orchid fleck virus (OFV) was detected in a species of Liriope in Leon and Alachua County, Florida (Fife et al; 2021). In October of the same year, four adjacent dune/ear-leaf greenbrier vines, Smilax auriculata (Smilaceae: Liliales), showed yellowing and mottling symptoms (Figure 1). Infected and healthy S. auriculata leaves samples were collected in Alachua County by the Florida Department of Agriculture and Consumer Services, Gainesville, Florida. OFV primers successfully detected in four Smilax samples by conventional RT-PCR assay. Amplicon sequences (Acc. No. MZ645935 and MZ645938) shared 99% nucleotide identity with OFV infecting orchids (LC222629) and citrus (MK522804). The OFV subgroup I (OFV-Orc1) and subgroup II (OFV-Orc2) specific primers (Kondo et al 2017) were utilized to confirm the presence of OFV type strains infecting Smilax. Sanger sequencing of subgroup I specific amplicons (MZ645934) shared 99% nucleotide identity with OFV-Orc1 (LC222629) whereas subgroup II specific amplicon sequence (MZ645930) shared 98-99 % nucleotide identity with OFV-Orc2 (AB244417). Further confirmation was done by USDA-APHIS-PPQ-Plant Pathogen Confirmatory Diagnostics Laboratory utilizing optimized conventional RT-PCR protocols (Roy et al. 2020) and deep sequencing on a on a NextSeq550 Illumina platform. Assembled reads identified seven non-overlapping viral contigs. Five RNA1 and two RNA2 contigs covered more than 97% of the bipartite OFV genome with average coverage depth of 5297.61 and 5186.04, respectively. Contigs of RNA1 and RNA2 shared 98-99% nt identity to OFV-Orc2-RNA1 (AB244417) and OFV-Orc-RNA2 (AB244418 and LC222630). No other pathogen sequences were identified. This is the first time the genus Smilax has been identified as a natural host of OFV. Very recent findings of OFV-Orc in Florida in Liriope, Aspidistra, and Ophiopogon among the Asparagaceae family members (Fife et al; 2021) and now in the Smilacaceae suggest a broader host range of the virus than previously known; further research should be conducted to better characterize the potential risk of introduction into citrus in Florida.
RESUMEN
Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.
RESUMEN
PURPOSE: This paper aims to investigate the prevalence by geographical locations and socio-demographic correlates of menstrual hygienic practices among young currently married Indian women. METHODS: The study is based on secondary data, collected from the latest round of the National Family Health Survey (NFHS-4), conducted in 2015-16. A total of 94,034 young currently married women aged 15-24 years were utilised in this study. The prevalence of menstrual hygienic practices was portrayed across regions, states, and districts of India. Bivariate and multivariate analyses were carried out to assess the factors associated with menstrual hygienic practices. RESULTS: Nearly half of the women (49.3%) practice hygienic methods to contain menstrual bloodstains. The prevalence of menstrual hygiene practices is lower in low-income states of central and eastern India. Multivariate analyses reveal that education of women and wealth status are found to be the most important positive factors of menstrual hygienic practices. Women's autonomy and exposure to mass media also have a positive impact on the use of menstrual hygiene practice. In contrast, women residing in rural areas, belonging in scheduled tribes and unemployed women are less likely to use hygienic methods during their menstruation. CONCLUSION: The findings of this study suggest increasing opportunities for female education, providing economic incentives, enhancing women's autonomy could help to increase hygienic practices of women during menstruation period. Furthermore, interventions should target socio-economically disadvantaged women to raise the use of sanitary napkins.
Asunto(s)
Conocimientos, Actitudes y Práctica en Salud/etnología , Matrimonio/estadística & datos numéricos , Productos para la Higiene Menstrual/estadística & datos numéricos , Menstruación/etnología , Menstruación/psicología , Adolescente , Estudios Transversales , Femenino , Humanos , India , Prevalencia , Características de la Residencia , Población Rural/estadística & datos numéricos , Factores Socioeconómicos , Encuestas y Cuestionarios , Población Urbana/estadística & datos numéricos , Adulto JovenRESUMEN
For a long time, the Me3 Si group has been ostracized from the family of aryl- and heteroatom-substituted congeners for the difficulties associated with its further chemoselective manipulation into another synthetically useful functional group. A hypervalent iodine reagent has now been shown to do exactly that by electrophilic demethylation. Coupled with the Tamao-Fleming oxidation, the Me3 Si group becomes a placeholder for a hydroxy group.
RESUMEN
A ligand-free Ni(ii)-catalyzed cascade annulation reaction for the synthesis of 4-aryl-substituted isotetronic acids from 2-acetamido-3-arylacrylates via vinylic C-H functionalization is reported. The reaction proceeds through heteroatom guided electrophilic insertion of nickel to the vinylic double bond followed by annulation with dibromomethane. This unconventional route features cascade steps, sole product formation, multiple functional group tolerance, low cost of catalysts and reagents, and readily available starting materials. Using this method, various aryl-substituted isotetronic acids have been synthesized which are biologically relevant. The annulation of 2-acetamido-3-arylacrylates has also been assessed with 1,2-dichloroethane, which resulted in the rearranged annulated products of 5-methyl substituted isotetronic acids.