Nearest-neighbor parameters for the prediction of RNA duplex stability in diverse in vitro and cellular-like crowding conditions.

RNA performs various spatiotemporal functions in living cells. As the solution environments significantly affect the stability of RNA duplexes, a stability prediction of the RNA duplexes in diverse crowded conditions is required to understand and modulate gene expression in heterogeneously crowded intracellular conditions. Herein, we determined the nearest-neighbor (NN) parameters for RNA duplex formation when subjected to crowding conditions with an ionic concentration relevant to that found in cells. Determination of the individual contributions of excluded volume effect and water activity to each of the NN parameters in crowded environments enabled prediction of the thermodynamic parameters and their melting temperatures for plenty of tested RNA duplex formation in vitro and in cell with significant accuracy. The parameters reported herein will help predicting RNA duplex stability in different crowded environments, which will lead to an improved understanding of the stability-function relationship for RNAs in various cellular organelles with different molecular environments.

Development of a Pseudocellular System to Quantify Specific Interactions Determining the G-Quadruplex Function in Cells.

Intracellular chemical microenvironments, including ion concentrations and molecular crowding, play pivotal roles in cell behaviors, such as proliferation, differentiation, and cell death via regulation of gene expression. However, there is no method for quantitative analysis of intracellular environments due to their complexity. Here, we have developed a system for highlighting the environment inside of the cell (SHELL). SHELL is a pseudocellular system, wherein small molecules are removed from the cell and a crowded intracellular environment is maintained. SHELL offers two prominent advantages: (1) It allows for precise quantitative biochemical analysis of a specific factor, and (2) it enables the study of any cell, thereby facilitating the study of target molecule effects in various cellular environments. Here, we used SHELL to study G-quadruplex formation, an event that implicated cancer. We show that G-quadruplexes are more stable in SHELL compared with in vitro conditions. Although malignant transformation perturbs cellular K+ concentrations, environments in SHELL act as buffers against G-quadruplex destabilization at lower K+ concentrations. Notably, the buffering effect was most pronounced in SHELL derived from nonaggressive cancer cells. Stable G-quadruplexes form due to the binding of the G-quadruplex with K+ in different cancer cells. Furthermore, the observed pattern of G-quadruplex-induced transcriptional inhibition in SHELL is consistent with that in living cells at different cancer stages. Our results indicate that ion binding to G-quadruplexes regulates gene expression during pathogenesis.

Quantum Mechanical Quantitative Nuclear Magnetic Resonance Enables Digital Reference Standards at All Magnetic Fields and Enhances qNMR Sustainability.

Quantum mechanics (QM)-driven 1H iterative functionalized spin analysis produces HifSA profiles, which encode the complete 1H spin parameters ("nuclear genotype") of analytes of interest. HifSA profiles enable the establishment of digital reference standards (dRS) that are portable, FAIR (findable - accessible - interoperable - reusable), and fit for the purpose of quantitative 1H NMR (qHNMR) analysis at any magnetic field. This approach enhances the sustainability of analytical standards. Moreover, the analyte-specific complete chemical shift and J-coupling information in HifSA-based dRS enable computational quantitation of substances in mixtures via QM-total-line-shape fitting (QM-qHNMR). We present the proof of concept for HifSA-based dRS by resolving the highly overlapping NMR resonances in the experimental spectra ("nuclear phenotypes") of the diastereomeric mixture of (2RS, 4RS)- and (2RS, 4SR)-difenoconazole (DFZ), a widely used antifouling food additive. The underlying 1H spin parameters are highly conserved in various solvents, are robust against variation in measurement temperature, and work across a wide range of magnetic fields. QM-qHNMR analysis of DFZ samples at 80, 400, 600, and 800 MHz showed high congruence with metrological reference values. Furthermore, this study introduces QM-qHNMR combined with chiral shift reagents for the analysis of all four DFZ stereoisomers: (2R, 4R)-, (2S, 4S)-, (2R, 4S)-, and (2S, 4R)-DFZ to perform chiral qHNMR measurements.

Engineering exosome polymer hybrids by atom transfer radical polymerization.

Exosomes are emerging as ideal drug delivery vehicles due to their biological origin and ability to transfer cargo between cells. However, rapid clearance of exogenous exosomes from the circulation as well as aggregation of exosomes and shedding of surface proteins during storage limit their clinical translation. Here, we demonstrate highly controlled and reversible functionalization of exosome surfaces with well-defined polymers that modulate the exosome's physiochemical and pharmacokinetic properties. Using cholesterol-modified DNA tethers and complementary DNA block copolymers, exosome surfaces were engineered with different biocompatible polymers. Additionally, polymers were directly grafted from the exosome surface using biocompatible photo-mediated atom transfer radical polymerization (ATRP). These exosome polymer hybrids (EPHs) exhibited enhanced stability under various storage conditions and in the presence of proteolytic enzymes. Tuning of the polymer length and surface loading allowed precise control over exosome surface interactions, cellular uptake, and preserved bioactivity. EPHs show fourfold higher blood circulation time without altering tissue distribution profiles. Our results highlight the potential of precise nanoengineering of exosomes toward developing advanced drug and therapeutic delivery systems using modern ATRP methods.

Chromatographic Evaluation and Characterization of Constituents of Sunflower Seed Extract Used as Food Additives.

Sunflower seed extract, an antioxidant agent registered on the List of Existing Food Additives in Japan, was evaluated using HPLC, and three common constituents were detected. These peaks were identified as monocaffeoylquinic acids (3-O-caffeoylquinic acid, 4-O-caffeoylquinic acid, and 5-O-caffeoylquinic acid [chlorogenic acid]). Upon scrutinizing other components, dicaffeoylquinic acids (isochlorogenic acids; 3,4-di-O-caffeoylquinic, 3,5-di-O-caffeoylquinic, and 4,5-di-O-caffeoylquinic acids) were also identified. Structures of two newly isolated compounds were determined to be 3-O-(3S-2-oxo-3-hydroxy-indole-3-acetyl)-5-O-caffeoylquinic and 4-O-(3S-2-oxo-3-hydroxy-indole-3-acetyl)-5-O-caffeoylquinic acids. To identify the components that contribute to the antioxidant activity of sunflower seed extract, we fractionated the food additive sample solution and examined the active fractions for 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity. Monocaffeoylquinic and dicaffeoylquinic acids showed high DPPH activity, including their contribution to the antioxidant activity of this food additive. DPPH radical scavenging activity of the new compounds showed almost the same value as that of the positive control, Trolox. Therefore, the contribution of these compounds was also considered.

Quantitative 31P-NMR for the Purity Determination of the Organophosphorus Compound Brigatinib and Its Method Validation.

The spectrum of 31P-NMR is fundamentally simpler than that of 1H-NMR; consequently identifying the target signal(s) for quantitation is simpler using quantitative 31P-NMR (31P-qNMR) than using quantitative 1H-NMR (1H-qNMR), which has been already established as an absolute determination method. We have previously reported a 31P-qNMR method for the absolute determination of cyclophosphamide hydrate and sofosbuvir as water-soluble and water-insoluble organophosphorus compounds, respectively. This study introduces the purity determination of brigatinib (BR), an organophosphorus compound with limited water solubility, using 31P-qNMR at multiple laboratories. Phosphonoacetic acid (PAA) and 1,4-BTMSB-d4 were selected as the reference standards (RSs) for 31P-qNMR and 1H-qNMR, respectively. The qNMR solvents were chosen based on the solubilities of BR and the RSs for qNMR. CD3OH was selected as the solvent for 31P-qNMR measurements to prevent the influence of deuterium exchange caused by the presence of exchangeable intramolecular protons of BR and PAA on the quantitative values, while CD3OD was the solvent of choice for the 1H-qNMR measurements to prevent the influence of water signals and the exchangeable intramolecular protons of BR and PAA. The mean purity of BR determined by 31P-qNMR was 97.94 ± 0.69%, which was in agreement with that determined by 1H-qNMR (97.26 ± 0.71%), thus indicating the feasibility of purity determination of BR by 31P-qNMR. Therefore, the findings of this study may provide an effective method that is simpler than conventional 1H-qNMR for the determination of organophosphorus compounds.

Unincreased mortality of patients with early rheumatoid arthritis compared to the general population in the past 17 years: Analyses from the IORRA cohort.

OBJECTIVES: The aim of this article is to investigate the mortality rate of patients with early rheumatoid arthritis (RA) over the past 17 years. METHODS: Japanese patients with early RA enrolled in the Institute of Rheumatology, Rheumatoid Arthritis cohort from 2001 to 2012 were classified into Groups A (2001-06) and B (2007-12). The standardized mortality ratio (SMR) and 5-year survival rate were calculated. RESULTS: Groups A and B had 1609 and 1608 patients, of which 167 and 178 patients were lost during follow-up and 47 and 45 deaths were confirmed, respectively. The SMR (95% confidence intervals) for Groups A and B were 0.81 (0.59-1.08) and 0.78 (0.57-1.04), respectively, with the condition that all untraceable patients were alive. Assuming that the mortality rate of untraceable patients was twice as high as that of the general population, the SMR was 0.90 (0.68-1.19) for Group A and 0.92 (0.68-1.23) for Group B. The 5-year survival rates were 96.9% and 97.0% for Groups A and B, respectively. CONCLUSIONS: The 5-year mortality of patients with early RA has been comparable to that of the general Japanese population. The 5-year survival rate has been stable over the past 17 years.

In-Cell Stability Prediction of RNA/DNA Hybrid Duplexes for Designing Oligonucleotides Aimed at Therapeutics.

In cells, the formation of RNA/DNA hybrid duplexes regulates gene expression and modification. The environment inside cellular organelles is heterogeneously crowded with high concentrations of biomolecules that affect the structure and stability of RNA/DNA hybrid duplexes. However, the detailed environmental effects remain unclear. Therefore, the mechanistic details of the effect of such molecular crowding were investigated at the molecular level by using thermodynamic and nuclear magnetic resonance analyses, revealing structure-dependent destabilization of the duplexes under crowded conditions. The transition from B- to A-like hybrid duplexes due to a change in conformation of the DNA strand guided by purine-pyrimidine asymmetry significantly increased the hydration number, which resulted in greater destabilization by the addition of cosolutes. By quantifying the individual contributions of environmental factors and the bulk structure of the duplex, we developed a set of parameters that predict the stability of hybrid duplexes with conformational dissimilarities under diverse crowding conditions. A comparison of the effects of environmental conditions in living cells and in vitro crowded solutions on hybrid duplex formation using the Förster resonance energy transfer technique established the applicability of our parameters to living cells. Moreover, our derived parameters can be used to estimate the efficiency of transcriptional inhibition, genome editing, and silencing techniques in cells. This supports the usefulness of our parameters for the visualization of cellular mechanisms of gene expression and the development of nucleic acid-based therapeutics targeting different cells.

Cladogenetic Orthogonal Light-Up Aptamers for Simultaneous Detection of Multiple Small Molecules in Cells.

Recent successes in construction of light-up RNA aptamers allowed fluorescence-based live-cell imaging of RNAs. In addition, light-up aptamers have been converted into signaling aptamers that enable fluorometric detection of small chemicals. To date, only a single target chemical has been detected at a time in cells. In this study, we selected cladogenetic orthogonal light-up aptamers that output three different colors from the RNA library having the same ligand binding core. Two of the three functioned in mammalian cells. These two aptamers, which fluoresce blue and green upon binding of cognate fluorogen, were converted into signaling aptamers. Using these signaling aptamers in combination with a previously described light-up aptamer with red fluorescence, we demonstrated simultaneous detection of multiple chemicals in living cells. The cladogenetic orthogonal light-up aptamers developed in this study and the simple strategy for rational designing of the signaling aptamers will provide innovative advances in the field of RNA-based bioimaging.

Roles of non-canonical structures of nucleic acids in cancer and neurodegenerative diseases.

Cancer and neurodegenerative diseases are caused by genetic and environmental factors. Expression of tumour suppressor genes is suppressed by mutations or epigenetic silencing, whereas for neurodegenerative disease-related genes, nucleic acid-based effects may be presented through loss of protein function due to erroneous protein sequences or gain of toxic function from extended repeat transcripts or toxic peptide production. These diseases are triggered by damaged genes and proteins due to lifestyle and exposure to radiation. Recent studies have indicated that transient, non-canonical structural changes in nucleic acids in response to the environment can regulate the expression of disease-related genes. Non-canonical structures are involved in many cellular functions, such as regulation of gene expression through transcription and translation, epigenetic regulation of chromatin, and DNA recombination. Transcripts generated from repeat sequences of neurodegenerative disease-related genes form non-canonical structures that are involved in protein transport and toxic aggregate formation. Intracellular phase separation promotes transcription and protein assembly, which are controlled by the nucleic acid structure and can influence cancer and neurodegenerative disease progression. These findings may aid in elucidating the underlying disease mechanisms. Here, we review the influence of non-canonical nucleic acid structures in disease-related genes on disease onset and progression.

Transcriptome screening followed by integrated physicochemical and structural analyses for investigating RNA-mediated berberine activity.

Non-coding RNAs are regarded as promising targets for the discovery of innovative drugs due to their abundance in the genome and their involvement in many biological processes. Phytochemicals (PCs) are the primary source of ligand-based drugs due to their broad spectrum of biological activities. Since many PCs are heterocyclic and have chemical groups potentially involved in the interaction with nucleic acids, detailed interaction analysis between PCs and RNA is crucial to explore the effect of PCs on RNA functions. In this study, an integrated approach for investigating interactions between PCs and RNAs were demonstrated to verify the RNA-mediated PCs functions by using berberine (BRB) as a model PC. RNA screening of a transcriptome library followed by sequence refinement found minimal RNA motif consisting of a cytosine bulge with U-A and G-U neighbouring base pairs for interaction with BRB. NMR-based structure determination and physicochemical analyses using chemical analogues of BRB demonstrated the importance of electrostatic and stacking interactions for sequence selective interaction and RNA stabilization. The selective interaction with a relatively small RNA motif based on a chemical structure of a planer heterocyclic highlights the biological activities of various PCs mediated by the interactions with particular functional RNAs. In addition, the systematic and quantitative investigations demonstrated in this study could be useful for the development of therapeutic chemicals targeting functional RNAs, based on the PCs, in the future.

Nearest-neighbor parameters for predicting DNA duplex stability in diverse molecular crowding conditions.

The intracellular environment is crowded and heterogeneous. Although the thermodynamic stability of nucleic acid duplexes is predictable in dilute solutions, methods of predicting such stability under specific intracellular conditions are not yet available. We recently showed that the nearest-neighbor model for self-complementary DNA is valid under molecular crowding condition of 40% polyethylene glycol with an average molecular weight of 200 (PEG 200) in 100 mM NaCl. Here, we determined nearest-neighbor parameters for DNA duplex formation under the same crowding condition to predict the thermodynamics of DNA duplexes in the intracellular environment. Preferential hydration of the nucleotides was found to be the key factor for nearest-neighbor parameters in the crowding condition. The determined parameters were shown to predict the thermodynamic parameters (∆H°, ∆S°, and ∆G°37) and melting temperatures (Tm) of the DNA duplexes in the crowding condition with significant accuracy. Moreover, we proposed a general method for predicting the stability of short DNA duplexes in different cosolutes based on the relationship between duplex stability and the water activity of the cosolute solution. The method described herein would be valuable for investigating biological processes that occur under specific intracellular crowded conditions and for the application of DNA-based biotechnologies in crowded environments.

[Proposal for Guidelines on the Notation and Investigation of Scientific Names for the Source of Natural Food Additives in Japanese Standards].

The official specifications for food additives from natural sources list the species according to their scientific and Japanese names, thereby providing a unique identifier for the species. This helps to prevent the use of nonprescribed species, which might cause unexpected or unintended health hazards. However, there are cases in which the names of the source species listed in the official specifications differ from the accepted scientific names based on the latest taxonomic research. In this paper, we argue that it is more important to define scientific and Japanese names with an emphasis on traceability in order to control the range of food additive ingredients in a rational and sustainable manner. Therefore, we proposed a method for ensuring traceability as well as a specific notation procedure for scientific and Japanese names. Using this method, we examined the source species for three food additives. In some cases, the range of sources species expanded with the change in scientific names. Ensuring traceability is extremely important, but it is also necessary to confirm whether unexpected species are included when names are changed.

[Plasticizers Used in Polyvinyl Chloride Toys (2019-2020)].

We determined the fifteen types of plasticizers, including four kinds of phthalic acid esters (PAEs) used in 220 polyvinyl chloride (PVC) toys on Japanese market from 2019 to 2020. Three kinds of previously undetected types of PAEs were also detected, but not identified in this study. Di (2-ethylhexyl) terephthalate (DEHTP) was the highest detection rate in 209 soft PVC toys out of 220 toys, with 71.2% for designated toys and 88.9% for not-designated toys, respectively, showing a gradual increase from the previous reports in 2009 and 2014. On the other hand, the usages of o-acetyl tributyl citrate and adipic acid esters decreased, but the six types of PAEs prohibited to use for the designated toys in Japan were not detected in them, the usage of diisobutyl phthalate were increased. In contrast, four types of PAEs were detected in not-designated toys. Among them, the detection ratio of di (2-ethyhexyl) phthalate decreased to about 1/10. The content levels of plasticizers in per each sample were continued to keep low level from the report five years ago. These results showed that the main plasticizer used in PVC toys is DEHTP, and that the usage of other plasticizers was decreased.

[Suitability of Culture Broth and Conditions for Escherichia coli Growth and Gas Production as a Test for Food Additives in EC Broth].

The growth and gas production test for Escherichia coli in the microbiological examination of food additives is stipulated in the ninth edition of Japan's Specifications and Standards for Food Additives (JSFA) and described as a part of the "Confirmation Test for Escherichia coli" in "Microbial Limit Tests" in the same manuscript. The growth and gas production test for E. coli indicated that the positive or negative of "gas production and/or turbidity" in EC broth should be confirmed after incubating at 45.5±0.2℃ for 24±2 h. If both gas production and turbidity are negative, the culture is additionally incubated up to 48±2 h to determine E. coli contamination. The internationally referenced Bacteriological Analytical Manual of the U.S. FDA had revised the incubation temperature in tests for coliforms and E. coli from 45.5±0.2℃ to 44.5±0.2℃ in 2017. Therefore, we conducted research in anticipation of this temperature change being reflected in the microbiological examination of the JSFA. We used seven EC broth products and six food additives across eight products that are available in Japan in order to compare the growth and gas production at temperatures of 45.5±0.2℃ and 44.5±0.2℃ of E. coli NBRC 3972, which is designated as the test strain in JSFA. Both with/without food additives, the number of EC broth products in which medium turbidity and gas production by the strain were positive in three out of three tubes at all test times was greater at 44.5±0.2℃ than at 45.5±0.2℃. These results suggest that the growth and gas production test for E. coli could be more appropriately conducted by incubation at 44.5±0.2℃ in the "Confirmation Test for Escherichia coli" for E. coli in the JSFA in comparison to 45.5±0.2℃. Furthermore, there were differences in the growth and gas production of E. coli NBRC 3972 depending on the EC broth product used. Therefore, the importance of "Media growth promotion test" and "Method suitability test" in the ninth edition of the JSFA should be emphasized.

Trends in risks of malignancies in Japanese patients with rheumatoid arthritis: Analyses from a 14-year observation of the IORRA cohort.

OBJECTIVES: The aim is to investigate the trends in risks of overall and site-specific malignancies in patients with rheumatoid arthritis (RA). METHODS: Among Japanese patients with RA enrolled in the Institute of Rheumatology, Rheumatoid Arthritis cohort, all malignancies that occurred from 2000 to 2013 were extracted. The standardized incidence ratios and 95% confidence intervals for overall and site-specific malignancies were calculated during three periods: pre-biologics, 2000-04; early biologics, 2005-09; and recent biologics, 2010-13. Risk factors for overall and specific malignancies were analysed using time-dependent Cox regression models. RESULTS: Among 11,299 patients with RA (68,483 person-years), 507 malignancies were confirmed. Similar risks were observed versus the general Japanese population for overall malignancies throughout the three periods, with standardized incidence ratios (95% confidence intervals) of 0.96 (0.80-1.14) in the pre-biologics period, 0.95 (0.82-1.09) in the early biologics period, and 0.87 (0.75-1.01) in the recent biologics period. A significantly increased risk for malignant lymphoma was observed throughout the observation period (standardized incidence ratio 4.61, 95% confidence interval 3.58-5.85). The disease activity was a significant risk factor for overall malignancies and lung cancer. CONCLUSIONS: Despite the expanding use of methotrexate and biologics, there were no increases in malignancy risk in Japanese patients with RA.

Identification and characterization of xanthone biosynthetic genes contributing to the vivid red coloration of red-flowered gentian.

Cultivated Japanese gentians traditionally produce vivid blue flowers because of the accumulation of delphinidin-based polyacylated anthocyanins. However, recent breeding programs developed several red-flowered cultivars, but the underlying mechanism for this red coloration was unknown. Thus, we characterized the pigments responsible for the red coloration in these cultivars. A high-performance liquid chromatography with photodiode array analysis revealed the presence of phenolic compounds, including flavones and xanthones, as well as the accumulation of colored cyanidin-based anthocyanins. The chemical structures of two xanthone compounds contributing to the coloration of red-flowered gentian petals were determined by mass spectrometry and nuclear magnetic resonance spectroscopy. The compounds were identified as norathyriol 6-O-glucoside (i.e., tripteroside designated as Xt1) and a previously unreported norathyriol-6-O-(6'-O-malonyl)-glucoside (designated Xt2). The copigmentation effects of these compounds on cyanidin 3-O-glucoside were detected in vitro. Additionally, an RNA sequencing analysis was performed to identify the cDNAs encoding the enzymes involved in the biosynthesis of these xanthones. Recombinant proteins encoded by the candidate genes were produced in a wheat germ cell-free protein expression system and assayed. We determined that a UDP-glucose-dependent glucosyltransferase (StrGT9) catalyzes the transfer of a glucose moiety to norathyriol, a xanthone aglycone, to produce Xt1, which is converted to Xt2 by a malonyltransferase (StrAT2). An analysis of the progeny lines suggested that the accumulation of Xt2 contributes to the vivid red coloration of gentian flowers. Our data indicate that StrGT9 and StrAT2 help mediate xanthone biosynthesis and contribute to the coloration of red-flowered gentians via copigmentation effects.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Volumetric Strategy for Quantitatively Elucidating a Local Hydration Network around a G-Quadruplex.

Hydration around nucleic acids, such as DNA and RNA, is an important factor not only for the stability of nucleic acids but also for their interaction with binding molecules. Thus, it is necessary to quantitatively elucidate the hydration properties of nucleic acids around a certain structure. In this study, volumetric changes in G-quadruplex (G4) RNA formation were investigated by systematically changing the number of G-quartet stacks under high pressure. The volumetric contribution at the level of each G4 structural unit revealed that the core G4 helix was significantly more dehydrated than the other parts, including the edges of G-quartets and loops. These findings will help in predicting the binding of G4 ligands on the surface of G4, depending on the chemical structure of the ligand and solution environment. Therefore, the preset volumetric parameter provides information that can predict molecular interactions in G4 formations during molecular crowding in cells.

Positive and negative effects of land abandonment on butterfly communities revealed by a hierarchical sampling design across climatic regions.

Land abandonment may decrease biodiversity but also provides an opportunity for rewilding. It is therefore necessary to identify areas that may benefit from traditional land management practices and those that may benefit from a lack of human intervention. In this study, we conducted comparative field surveys of butterfly occurrence in abandoned and inhabited settlements in 18 regions of diverse climatic zones in Japan to test the hypotheses that species-specific responses to land abandonment correlate with climatic niches and habitat preferences. Hierarchical models that unified species occurrence and habitat preferences revealed that negative responses to land abandonment were associated with species that have cold climatic niches and use open habitats, suggesting that species negatively impacted by land abandonment will decline more due to future climate warming. Maps representing species gains and losses due to land abandonment, which were created from the model estimates, showed similar geographical patterns, but some areas exhibited high species losses relative to gains. Our hierarchical modelling approach was useful for scaling up local-scale effects of land abandonment to a macro-scale assessment, which is crucial to developing spatial conservation strategies in the era of depopulation.