[Experts consensus for the diagnosis, treatment, and prevention of coronavirus disease 2019 in the elderly].

Coronavirus disease 2019 (COVID-19) can cause great damage to the elderly patients and lead to high mortality. The clinical presentations and auxiliary examinations of the elderly patients with COVID-19 are atypical, due to the physiological ageing deterioration and basal pathological state. The treatment strategy for the elderly patients has its own characteristics and treatment protocol should be considered accordingly. To improve the diagnosis, treatment, and prevention of COVID-19 in the elderly, the Expert Committee of Geriatric Respiratory and Critical Care Medicine, China Society of Geriatrics established the "Expert consensus for the diagnosis, treatment, and prevention of coronavirus disease 2019 in the elderly" . We focused on the clinical characteristics and key points for better treatment and prevention of COVID-19 in the elderly. (1) For diagnosis, atypical clinical presentation of COVID-19 in the elderly should be emphasized, which may be complicated by underlying disease. (2) For treatment, strategy of multiple disciplinary team (mainly the respiratory and critical care medicine) should be adopted and multiple systemic functions should be considered. (3) For prevention, health care model about integrated management of acute and chronic diseases, in and out of hospital should be applied.

[The changes and influencing factors of corneal endothelial cell density after endothelial keratoplasty].

Endothelial keratoplasty is a surgery that selectively replaces the diseased endothelium and reserves the normal corneal epithelial and stromal layers. It is now gradually replacing penetrating keratoplasty in treating endothelial dysfunction. Although endothelial cell loss exists after endothelial keratoplasty, the number of lost cells is obviously less than that of penetrating keratoplasty. The amount and function of corneal endothelial cells are important factors for maintaining corneal transparency and indicating the survival of the graft. Thus, the changes of corneal endothelial cell density after surgery are significant in predicting the prognosis. This article elaborates on the changes of endothelial cell density after endothelial keratoplasty and related influencing factors, aiming to provide reference and basis for clinical diagnosis and treatment. (Chin J Ophthalmol, 2018, 54:954-960).

C-erbB-2 expression and prognosis of gastric cancer: a meta-analysis.

The prognostic role of c-erbB-2 in gastric cancer is controversial. We conducted a meta-analysis to evaluate the relationship between c-erbB-2 expression and the prognosis of gastric cancer. We evaluated 20 published studies assessing the relationship between c-erbB-2 and gastric cancer prognosis. The Revman 5.0 software was used to perform literature retrieval, article selection, data collection, and statistical analysis. We utilized a fixed-effect model to pool hazard ratios and 95% confidence intervals from the studies. A total of 20 eligible studies including 4468 gastric cancer patients were analyzed. We were unable to demonstrate the prognostic value of c-erbB-2 for gastric cancer (hazard ratio = 1.01, 95% confidence interval = 0.87-1.16, P = 0.93). The present study indicated that c-erbB-2 expression is not a prognostic factor for gastric cancer.

A crossed molecular beam and ab initio investigation of the exclusive methyl loss pathway in the gas phase reaction of boron monoxide (BO; X2Σ+) with dimethylacetylene (CH3CCCH3; X1A(1g)).

The crossed molecular beam reaction of boron monoxide ((11)BO; X(2)Σ(+)) with dimethylacetylene (CH3CCCH3; X(1)A(1g)) was investigated at a collision energy of 23.9 ± 1.5 kJ mol(-1). The scattering dynamics were suggested to be indirect (complex forming reaction) and were initiated by the addition of (11)BO(X(2)Σ(+)) with the radical center located at the boron atom to the π electron density at the acetylenic carbon-carbon triple bond without entrance barrier leading to cis-trans(11)BOC4H6 doublet radical intermediates. cis-(11)BOC4H6 underwent cis-trans isomerization followed by unimolecular decomposition via a methyl group (CH3) loss forming 1-propynyl boron monoxide (CH3CC(11)BO) in an overall exoergic reaction (experimental: -91 ± 22 kJ mol(-1); theoretical: -105 ± 9 kJ mol(-1); NIST: -104 ± 12 kJ mol(-1)) via a tight exit transition state; trans-(11)BOC4H6 was found to lose a methyl group instantaneously. Neither atomic nor molecular hydrogen loss pathways were detectable. The experimental finding of an exclusive methyl loss pathway gains full support from our computational study predicting a methyl group versus atomic hydrogen loss branching ratio of 99.99% to 0.01% forming 1-propynyl boron monoxide (CH3CC(11)BO) and 1-methyl-propadienyl boron monoxide (CH3((11)BO)CCCH2), respectively.

Theoretical study on reaction mechanism of ground-state cyano radical with 1,3-butadiene: prospect of pyridine formation.

The reaction of ground-state cyano radicals, CN(X(2)Σ(+)), with the simplest polyene, 1,3-butadiene (C4H6(X(1)Ag)), is investigated to explore probable routes and feasibility to form pyridine at ultralow temperatures. The isomerization and dissociation channels for each of the seven initial collision complexes are characterized by utilizing the unrestricted B3LYP/cc-pVTZ and the CCSD(T)/cc-pVTZ calculations. With facilitation of RRKM rate constants, through ab initio paths composed of 7 collision complexes, 331 intermediates, 62 hydrogen atom, 71 hydrogen molecule, and 3 hydrogen cyanide dissociated products, the most probable paths at collision energies up to 10 kcal/mol, and thus the reaction mechanism, are determined. Subsequently, the corresponding rate equations are solved that the concentration evolutions of collision complexes, intermediates, and products versus time are obtained. As a result, the final products and yields are determined. The low-energy routes for the formation of most thermodynamically stable product, pyridine, are identified. This study, however, predicts that seven collision complexes would produce predominately 1-cyano-1,3-butadiene, CH2CHCHCHCN (p2) plus atomic hydrogen via the collision complex c1(CH2CHCHCH2CN) and intermediate i2(CH2CHCH2CHCN), with a very minor amount of pyridine. Our scheme also effectively excludes the presence of 2-cyano-1,3-butadiene, which has energy near-degenerate to 1-cyano-1,3-butadiene, as supported by experimental findings.

Selection pressure and founder effects constrain genetic variation in differentiated populations of soilborne bymovirus Wheat yellow mosaic virus (Potyviridae) in China.

To study the population genetic structure and forces driving the evolution of Wheat yellow mosaic virus (WYMV), the nucleotide sequences encoding the coat protein (CP) (297 sequences) or the genome-linked virion protein (VPg) (87 sequences) were determined from wheat plants growing at 11 different locations distributed in five provinces in China. There were close phylogenetic relationships between all sequences but clustering on the phylogenetic trees was congruent with their provenance, suggesting an origin-dependent population genetic structure. There were low levels of genetic diversity, ranging from 0.00035 ± 0.00019 to 0.01536 ± 0.00043 (CP), and 0.00086 ± 0.00039 to 0.00573 ± 0.00111 (VPg), indicating genetic stability or recent emergence of WYMV in China. The results may suggest that founder effects play a role in shaping the genetic structure of WYMV. Between-population diversity was consistently higher than within-population diversity, suggesting limited gene flow between subpopulations (average FST 0.6241 for the CP and 0.7981 for the VPg). Consistent amino acid substitutions correlated with the provenance of the sequences were observed at nine positions in the CP (but none in the VPg), indicating an advanced stage in population structuring. Strong negative (purifying) selection was implicated on both the CP and VPg but positive selection on a few codons in the CP, indicating an ongoing molecular adaptation.

Effect evaluation of denosumab combined with curettage and bone cement reconstruction in the treatment of recurrent giant cell tumor of bone around the knee joint.

OBJECTIVE: Giant cell tumor of bone (GCTB) is a common primary bone tumor with latent malignant tendency. GCTB is prone to occur around the knee joint, and surgery is the major treatment method. There are relatively few reports on denosumab in the treatment of recurrent GCTB around the knee joint and postoperative function evaluation of patients. This research aimed to explore the appropriate surgical options for the treatment of recurrent GCTB around the knee joint. PATIENTS AND METHODS: 19 patients with recurrent GCTB around the knee joint, who were admitted to Hospital for 3 months following denosumab treatment from January 2016 to December 2019, were included as the research subjects. The prognosis was compared between patients treated with curettage combined with polymethylmethacrylate (PMMA) and those with extensive-resection replacement of tumor prosthesis (RTP). A deep learning model of Inception-v3 combined with a Faster region-based convolutional neural network (Faster-RCNN) was constructed to classify and identify X-ray images of patients. The Musculoskeletal Tumor Society (MSTS) score, short form-36 (SF-36) score, recurrence, and the rate of complications were also analyzed during the follow-up period. RESULTS: The results showed that the Inception-v3 model trained on the low-rank sparse loss function was obviously the best for X-ray image classification, and the classification and identification effect of the Faster-RCNN model was significantly better than that of the convolutional neural network (CNN), U-Net, and Fast region-based convolutional neural network (Fast-RCNN) models. During the follow-up period, the MSTS score in the PMMA group was significantly higher than that in the RTP group (p<0.05), while there was no significant difference in the SF-36 score, recurrence, and the rate of complications (p>0.05). CONCLUSIONS: The deep learning model could improve the classification and identification of the lesion location in the X-ray images of GCTB patients. Denosumab was an effective adjuvant for recurrent GCTB, and widely extensive-resection RTP could reduce the risk of local recurrence after denosumab treatment for recurrent GCTB.

First Report of Fusarium pseudograminearum Causing Crown Rot of Wheat in Henan, China.

Fusarium pseudograminearum (O'Donnell & Aoki), a residue-borne pathogen, is responsible for crown rot of wheat (Triticum aestivum L.). Since its first detection in Queensland, Australia in 1951, it has been reported in many other countries, but not China (2). In May 2011, a crown rot disease was observed in wheat cv. Aikang 58 in a wheat-maize rotation, irrigable and loam field in Henan Province, China. Diseased wheat plants showed honey brown discoloration in the stem bases and whitehead in some plants, which are symptoms of crown rot with about 70% incidence in a surveyed field (2). The pathogen was isolated from diseased stem base on potato dextrose agar (PDA) after being surface-disinfested with 5% NaClO solution for 2 min. Pure cultures were established on carnation leaf agar (CLA) through a single spore technique and identified by morphological and molecular methods according to protocols described previously (1,3,4). Macroconidia of F. pseudograminearum were formed in abundant sporodochia on CLA cultures grown under the BLB light. Macroconidia were usually five septate (about three to seven) and 27 to 91 × 2.7 to 5.5 µm. Colonies grown on PDA from a single conidium in the dark at 25°C had average radial growth rates of ~4.7 to 9.9 mm per day. Colony pigment on PDA grown under light varied from rose to burgundy, while mycelium ranged from rose to yellow white. Two isolates (WZ-8A and WZ-2B) were selected for molecular identification. The translation elongation factor 1-α gene and rDNA ITS gene were amplified by PCR using the specific primers described previously (4). PCR products were sequenced (GenBank Accession Nos. JN862232 to JN862235). Phylogenic analysis of the sequence indicated that the isolates were identified as F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). The expected PCR products of 520 bp were produced only in F. pseudograminearum. Isolates WZ-2B and WZ-8A were deposited in the Agriculture Culture Collection of China as ACCC38067 and ACCC 38068, respectively. Pathogenicity tests were conducted by inoculating winter wheat cultivar Wenmai 19 with isolates WZ-8A and WZ-2B through soil inoculation. Inoculum was prepared by growing cultures on sterilized wheat bran and chopped wheat-straw (4:1, v/v) after incubation at 25°C for 2 weeks. This inoculum was added to sterilized soil at 1% by volume and no inoculum was added in control treatment. Five seeds were planted in a 15 cm wide pot in a 20 to 25°C greenhouse, with six replications. Seedling death and crown browning occurred in the inoculated wheat plants after 4 weeks with over 90% incidence, while no symptoms developed in the control plants. The fungus was reisolated from inoculated plants, fulfilling Koch's postulates. To our knowledge, this is the first report of F. pseudograminearum causing crown rot of wheat in China. Considering Henan is the largest wheat production province in China with over 5 million hectares planting area, and the soil and climate conditions are suitable for this disease, it will be a important pathogen of wheat in Henan in the future. References: (1) T. Aoki et al. Mycologia 91:597, 1999. (2) L. W. Burgess. Page 271 in: Crown Rot of Wheat: Fusarium. B. A. Summerell et al., eds. APS Press, St. Paul, MN, 2001. (3) R. G. Francis et al. Trans. Brit. Mycol. Soc. 68:421, 1977. (4) J. B. Scott et al. Mycol. Res. 110:1413, 2006.

I2 molecular elimination in single-photon dissociation of CH2I2 at 248 nm by using cavity ring-down absorption spectroscopy.

Following single-photon dissociation of CH(2)I(2) at 248 nm, I(2) molecular elimination is detected by using cavity ring-down absorption spectroscopy. The technique comprises two laser beams propagating in a perpendicular configuration, in which a tunable laser beam along the axis of the ring-down cell probes the I(2) fragment in the B (3)Π(ou)(+) - X (1)Σ(g)(+) transition. The nascent vibrational populations for v = 0, 1, and 2 levels are obtained with a population ratio of 1:(0.65 ± 0.10):(0.30 ± 0.05), corresponding to a Boltzmann-like vibrational temperature of 544 ± 73 K. The quantum yield of the ground state I(2) elimination reaction is determined to be 0.0040 ± 0.0025. With the aid of ab initio potential energy calculations, the pathway of molecular elimination is proposed on the energetic ground state CH(2)I(2) via internal conversion, followed by asynchronous three-center dissociation. A positive temperature effect supports the proposed mechanism.

First Record of the Cereal Cyst Nematode Heterodera filipjevi in China.

Cereal cyst nematode (CCN) is now recognized as a widespread and often damaging parasite of wheat in China. Only Heterodera avenae has been reported in China (4). However, molecular analysis of four samples from Beijing and one from Shanxi Province indicated genetic differences from H. avenae and other named species (3). Here we report the detection of H. filipjevi at a site in Henan Province that was not included in any previous study or report. The infested crop was rainfed winter wheat (Triticum aestivum) cv. Wenmai 19 in a field near Banpopu Village in Xuchang County (34.0447°N, 113.7415°E) with a long-established maize-wheat semiannual crop rotation. During the winter growing season, the crop was patchy with uneven growth and cyst nematode females were observed on the roots. In June 2009, soil was collected and mature cysts were extracted for morphological and molecular identification. Cysts were also kept at 4°C for 2 months and then incubated in shallow water at 15°C for a month to obtain second-stage juveniles (J2). Measurements (range; mean ± sd) of 10 cysts were body length including neck (569 to 786 µm; 699 ± 56), body width (403 to 600 µm; 523 ± 55), length:width ratio (1.3 to 1.5; 1.3 ± 0.1), neck length (61 to 125 µm; 106 ± 19) and width (49 to 83 µm; 69 ± 13), fenestra length (52 to 59 µm; 57 ± 2.9) and width (24.5 to 34.4; 27.9 ± 3.5), underbridge (64 to 101 µm; 85 ± 10), and vulval slit (7.4 to 10.0 µm; 9.6 ± 1.0). Lemon-shaped cysts were brown with a surface zigzag pattern. The vulval cone was bifenestrate with horseshoe-shaped semifenestra, with heavy underbridge and many bullae. The J2 (n = 22) measurements were body length (496 to 590 µm; 552 ± 24), body width (20.0 to 23.8; 21.5 ± 0.9), stylet (22.8 to 25.3; 24.0 ± 1.0) with anchor-shaped basal knobs, tail (47 to 64; 61.6 ± 4.4), and hyaline tail terminus (32 to 43; 40.2 ± 3.0). The J2 had up to four lateral lines, but the inner two were often the only lines clearly visible, and the shape of the stylet knobs, tail, and tail terminus were consistent with H. filipjevi. All morphological data and characters were consistent with H. filipjevi (1). Specimens have been lodged with the Australian National Insect Collection. DNA from single cysts was extracted to amplify the internal transcribed spacer region of rDNA by PCR with forward primer TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and reverse primer AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (2). The PCR product was sequenced (Genbank Accession No. HM027892) and digested by restriction enzymes (AluI, CfoI, HaeI, HinfI, PstI, RsaI, TaqI, and Tru9I) to obtain restriction fragment length polymorphism profiles (2). Profiles for the Xuchang population consistently matched those published for H. filipjevi and were distinct from those of H. avenae and other species (3). Phylogenic analysis of the sequence further indicated conspecificity with H. filipjevi. These morphological and molecular data confirmed that the specimens from Xuchang were H. filipjevi, which represents the first detection of H. filipjevi in China, and extends the known distribution of the species from Europe, North America, South Asia, and West Asia to East Asia. This finding adds complexity to the management of CCN in China, especially for control by host resistance, which now must consider both species and pathotype diversity. References: (1) Z. A. Handoo. J. Nematol. 34:250, 2002. (2) S. A. Subbotin et al. Nematology 2:153, 2000. (3) S. A. Subbotin et al. Nematology 5:515, 2003. (4) H. X. Yuan et al. Australas. Plant Pathol. 39:107, 2010.

Photodissociation of 1,2-dibromoethylene at 248 nm: Br2 molecular elimination probed by cavity ring-down absorption spectroscopy.

The Br2 elimination channel is probed for 1,2-C2H2Br2 in the B(3)Pi(+)ou-X(1)Sigma(+)g transition upon irradiation at 248 nm by using cavity ring-down absorption spectroscopy (CRDS). The nascent vibrational population ratio of Br2(v=1)/Br2(v=0) is obtained to be 0.7+/-0.2, thus indicating that the Br2 fragment is produced in hot vibrational states. The obtained Br2 products are anticipated to result primarily from photodissociation of the ground-state cis isomer via four-center elimination or from cis/trans isomers via three-center elimination, each mechanism involving a transition state that has a Br-Br distance much larger than that of ground state Br2. According to ab initio potential energy calculations, the pathways that lead to Br2 elimination may proceed either through the electronic ground state by internal conversion or through the triplet state by intersystem crossing. Temperature-dependence measurements are examined, thereby supporting the pathway that involves internal conversion--which was excluded previously by using product translational spectroscopy (PTS). The quantum yield for the Br2 elimination reaction is determined to be 0.120.1, being substantially contributed by the ground-state Br2 product. The discrepancy of this value from that (of 0.2) obtained by PTS may rise from the lack of measurements in probing the triplet-state Br2 product.

Characterization and expression analysis of TNFR-associated factor 1 (TRAF1) in grass carp Ctenopharyngodon idella.

TNF receptor associated factor 1 (TRAF1) plays an important role in regulating the TNF signaling and protecting cells from apoptosis. In the present study, a TRAF1 gene has been cloned from grass carp (Ctenopharyngodon idella) by reverse transcription (RT)-PCR and rapid amplification of cDNA ends (RACE). The full-length cDNA is 2235bp, including a 250bp 5' UTR (untranslated region), a 1659bp open reading frame, and a 326bp 3' UTR. The polyadenylation signal (AATAAA, AATAA) and one mRNA instability motif (AUUUA) were found followed by a poly (A) tail in the 3' UTR. No signal peptide or transmembrane region has been found in the putative amino acids of grass carp TRAF1 (gcTRAF1). The putative amino acids of gcTRAF1 share 72% identity with the homologue in zebrafish. It is characterized by a zinc finger at the N-terminus and a TRAF domain (contains one TRAF-C and one TRAF-N) at the C-terminus. The identity of the TRAF domain among all the TRAF1 homologues in vertebrates varies from 52% to 58%, while the identities of TRAF-C were almost the same as 70%. The recombinant gcTRAF1 has been constructed successfully and expressed in Escherichia coli by using pET-32a expression vector. The polyclonal antibody for rabbit has been successfully obtained. The expression of gcTRAF1 in different organs was examined by real-time quantitative PCR and Western blotting, respectively. It was widely distributed in heart, head kidney, thymus, brain, gill, liver, spleen, and trunk kidney. This is the first report of TRAF1 homologue molecule found in fish.

Formation of interstellar 2,4-pentadiynylidyne, HCCCCC(X 2Pi), via the neutral-neutral reaction of ground state carbon atom, C(3P), with diacetylene, HCCCCH(X 1Sigma(g)+).

The interstellar reaction of ground-state carbon atom with the simplest polyyne, diacetylene (HCCCCH), is investigated theoretically to explore probable routes to form hydrogen-deficient carbon clusters at ultralow temperature in cold molecular clouds. The isomerization and dissociation channels for each of the three collision complexes are characterized by utilizing the unrestricted B3LYP/6-311G(d,p) level of theory and the CCSD(T)/cc-pVTZ calculations. With facilitation of RRKM and variational RRKM rate constants at collision energies of 0-10 kcalmol, the most probable paths, thus reaction mechanism, are determined. Subsequently, the corresponding rate equations are solved that the evolutions of concentrations of collision complexes, intermediates, and products versus time are obtained. As a result, the final products and yields are identified. This study predicts that three collision complexes, c1, c2, and c3, would produce a single final product, 2,4-pentadiynylidyne, HCCCCC(X (2)Pi), C(5)H (p1)+H, via the most stable intermediate, carbon chain HC(5)H (i4). Our investigation indicates the title reaction is efficient to form astronomically observed 2,4-pentadiynylidyne in cold molecular clouds, where a typical translational temperature is 10 K, via a single bimolecular gas phase reaction.

The first non-mammalian CXCR3 in a teleost fish: gene and expression in blood cells and central nervous system in the grass carp (Ctenopharyngodon idella).

A novel fish chemokine receptor gene, chemokine (C-X-C motif) receptor 3 (CXCR3)-like was isolated from the grass carp Ctenopharyngodon idella, with its full-length genomic sequence. The cDNA of grass carp CXCR3-like (gcCXCR3-like) consists of 1261 bp with a 49 bp 5'-UTR and a 189bp 3'-UTR. An open reading frame of 1023 bp encodes a 341-amino acid peptide, with seven transmembrane helices. The deduced amino acid sequence showed the same sequence identities (37.8%) with its counterparts in goat and human. The gcCXCR3-like gene consists of two exons, with one intervening intron, spaced over approximately 2 kb of genomic sequence. Phylogenetic analyses clearly demonstrated that the gcCXCR3-like resembles the CXCR3s of other vertebrates. Real-time PCR analysis showed that gcCXCR3-like was expressed in all tested organs except heart and the expression level of gcCXCR3-like was highest in brain. Flow cytometric analyses showed the positive rate of labelled leukocytes from the healthy grass carp was 17.3%, and the labelled leukocytes were divided into three types by cell sorting. Immunohistochemical localization revealed that gcCXCR3-like expressed in whole brain regions including cerebel, diencephalon, medulla oblongata, optic lobe, and rhinencephalon, and that the labelled leukocytes are actually populations of monocyte and/or phagocyte, lymphocyte and the granulocyte. It is considered that fish CXCR expression and their function may need to be investigated in both nervous and immune systems.

Quality measures in ventral hernia repair: a systematic review.

BACKGROUND: The US healthcare system is shifting towards reimbursement for quality over quantity of care. Quality measures are tied to financial incentives in these healthcare models. It is important that surgeons become familiar with quality measures addressing ventral hernia repair and understand candidate measures that may drive future quality measure development. STUDY DESIGN: We performed a systematic review of society websites, quality measure databases, and the literature (Pubmed, Embase/Scopus, and Google Scholar) for quality measures addressing ventral hernia surgery. Clinical practice guidelines were included as candidate quality measures. All measures were categorized as structure, process or outcome according to Donabedian domains, as well as within the six National Quality Strategy (NQS) domains. RESULTS: Thirty quality measures and candidate measures were identified. Eight candidate measures from the American Hernia Society addressed ventral hernia repair, and 22 quality measures in general surgery were also relevant to ventral hernia repair. Of the candidate measures, 6 (75%) were outcome and 2 (25%) were process measures. Of existing general surgery quality measures, 9 (41%) were outcome and 13 (59%) were process measures. No structural measures were identified. Overall, the majority of measures addressed NQS priorities of effective clinical care (33%) and patient safety (27%), while few addressed other domains. CONCLUSION: Both the Donabedian domains of quality and NQS priorities were unequally represented in the current measures addressing ventral hernia repair. Recognizing and addressing the under-represented areas will provide a more balanced framework for developing quality measures and ensure that ventral hernia surgery is appropriately evaluated in value-based payment models.

Gene structure and transcription of IRF-1 and IRF-7 in the mandarin fish Siniperca chuatsi.

The genes of IRF-1 and IRF-7 have been cloned from the mandarin fish (Siniperca chuatsi). The IRF-1 gene has 4919 nucleotides (nt) and contains 10 exons and 9 introns, with an open reading frame (ORF) of 903nt encoding 301aa. The IRF-7 gene has 6057nt and also contains 10 exons and 9 introns, with an ORF of 1308nt encoding 436aa. The IRF-1 and IRF-7 genes have only one copy each in the genome. The transcription of IRF-1 and IRF-7 in different organs was analyzed by real-time PCR, and both molecules were constitutively expressed. The IRF-1 and IRF-7 mRNAs were abundant in gill, spleen, kidney and pronephros. The temporal transcriptional changes for IRF-1, IRF-7 and Mx were investigated within 48h after poly I: C stimulation in liver, gill, spleen and pronephros. An increased transcription was detected for IRF-1 and IRF-7 12h post-stimulation, being earlier than the transcription of Mx protein; however, IRF-1 and IRF-7 transcription decreased while the Mx protein was stable at 48h post-stimulation.

Synthesis of urea in cometary model ices and implications for Comet 67P/Churyumov-Gerasimenko.

Urea is considered a fundamental building block in prebiotic chemistry. Its formation on early Earth has not yet been explained satisfactorily and exogenous delivery has been considered. We report on the synthesis along with the first online and in situ identification of urea after exposing inorganic ices to ionizing radiation.

Continued EGFR-TKIs treatment promotes the survival of elderly patients with acquired resistance to EGFR-TKIs therapy.

OBJECTIVE: Continued EGFR-TKIs treatment is still controversial for NSCLC patients with activating EGFR mutations, who acquire resistance to the drug. Of these patients, elderly ones were worth to be investigated to further examine efficacy of continued EGFR-TKIs treatment. PATIENTS AND METHODS: A total of 232 NSCLC patients (≥ 70-year-old) were recruited from the Chinese People's Liberation Army General Hospital between January 1, 2009, and July 31, 2014. And 44 patients were qualified for further retrospectively investigated, which were divided into dramatic and non-dramatic progression groups based on the characteristics of progression during first-line EGFR-TKIs treatment. And they were also divided into two groups: continued EGFR-TKIs group and discontinued EGFR-TKIs group. Subsequently, progression-free survival (PFS), post-progression survival (PPS), and overall survival (OS) of these groups were investigated by multivariate analysis. RESULTS: Median OS (28.9 months vs. 23.2 months, p = 0.46) and median PPS (16.9 months vs. 4.4 months, p = 0.216) were both not significantly different between continued EGFR-TKIs groups and discontinued ones. However, when focusing on patients with non-dramatic progression, the median OS (29.0 months vs. 23.2 months, p = 0.039) and median PPS (21.3 months vs. 3.9 months, p = 0.001) were significantly longer in the continued EGFR-TKIs patients than discontinued ones. DISCUSSION: Continued EGFR-TKIs beyond PD may be a good option for elderly patients with non-dramatic progression. The characteristic of progression after first-line EGFR-TKIs treatment should be taken into account to determine which part of patients is suitable for continued EGFR-TKIs treatment, especially for the speed of progression. CONCLUSION: Continued EGFR-TKIs treatment promotes the survival of elderly patients with acquired resistance to EGFR-TKIs therapy.

Molecular cloning of TRAF2 binding protein gene and its promoter region from the grass carp Ctenopharyngodon idellus.

A tumor necrosis factor receptor-associated factor 2 binding protein (T2BP) gene was isolated from the grass carp (Ctenopharyngodon idellus) by utilizing suppression subtractive hybridization (SSH) and rapid amplification of cDNA ends (RACE). The grass carp T2BP (GT2BP) gene contains an open reading frame of 579 nucleotide(s) (nt), encoding 193 amino acids, with 23 nt 5'-untranslated region and a long 3'-untranslated region of 434 nt including poly (A), 1 AUUUA motif and 4 AUUUUA motifs. No signal peptide has been detected in the predicted GT2BP, but a characteristic forkhead associated domain is present. The GT2BP mRNA shares 83% identity with the zebrafish DNA sequence, and they both have no introns in the genomic DNA. The putative transcription factor binding sites of GT2BP include two C/EBP alpha binding sites, and one c-Jun binding, one AP-1 binding, and one nuclear factor kappaB (NF kappaB) binding sites. Southern blot analysis revealed that the GT2BP was a single-copy gene. Individual difference was observed in GT2BP expression in examined organs of healthy grass carp. However, the expression of GT2BP in all examined organs in a fish with the highest copepod infection level and the significantly higher expression level in spleen and liver in infected fish may indicate its up-regulation with the parasite infection.

Molecular cloning of the viperin gene and its promoter region from the mandarin fish Siniperca chuatsi.

A viperin gene has been cloned from the mandarin fish (Siniperca chuatsi). From the first transcription initiation site, the mandarin fish viperin gene extends 3163 nucleotides to the end of the 3' untranslated region, and it contains six exons and five introns. The open reading frame of the viperin transcript has 1062 nucleotides which encode a 354 amino acid peptide. The amino acid sequence of mandarin fish viperin shows high identities with its homologues in teleosts and mammals except for the first 70 amino acids. A characteristic feature in the viperin promoter region was the presence of five putative ICSBP (IRF8) binding sites and one IRF1 binding site. The viperin gene expressed mainly in lymphoid tissues before stimulation, but its expression can be examined in almost all the organs investigated after stimulation with virus or Poly I:C. The expression pattern and promoter sequence may be considered as the indirect evidence that the transcription of viperin is regulated by interferons or interferon induced genes.