Cooperative effects of three preservatives on physiological quality, endophytic bacterial community and volatile organic compounds of postharvest Codonopsis pilosula var. modesta roots.

BACKGROUND: Codonopsis pilosula var. modesta (CPVM) is a famous medicinal and edible plant of Campanulaceae. However, fresh CPVM roots (FCPVR) are prone to softening, browning and spoilage after concentrated harvesting in the main production area of Gansu Province, China in autumn, which poses great challenges to their large-scale storage and modern processing. In this study, effects of chitosan (CS), natamycin (NA) and modified atmosphere agent (MA) on the postharvest quality of FCPVR were first investigated. The roots after different treatments were stored at 4 °C and relative humidity of 75 ± 5% for 100 days. Their overall quality changes were evaluated from three perspectives: physiological quality, endophytic bacterial community and volatile organic compounds. RESULTS: The clustering heatmap and principal component analysis results indicated that CS (2 g kg-1), NA (0.5 g kg-1) and MA (5 g) had a synergistic effect on physiological quality. The roots in the CS + NA + MA group maintained better physiological state, effective components and antioxidant capacity throughout the storage process. On this basis, compared with room temperature storage, the relative abundance of the main spoilage bacterium Pseudomonas in the CS + NA + MA group roots decreased by 44% on the 100th day of storage. Furthermore, after CS + NA + MA composite treatment, the roots produced richer esters with fruit aroma during low-temperature storage. CONCLUSIONS: The CS + NA + MA composite treatment could maintain the physiological quality and flavor of FCPVR, inhibit spoilage by microbial contamination and maintain the optimal quality during low-temperature storage for up to 100 days. © 2024 Society of Chemical Industry.

Genomic characterization of an Omono River virus isolated from Culex tritaeniorhynchus in eastern China.

Omono River virus (OMRV) is a newly reported, unclassified RNA virus in the family Totiviridae, which infects mosquitoes and bats. In this study, we report the isolation of an OMRV strain SD76 from Culex tritaeniorhynchus captured in Jinan city, China. The cytopathic effect was characterized by cell fusion on C6/36 cell line. Its complete genome was 7611 nucleotides in length, with 71.4-90.4% similarities with other OMRV strains. Phylogenetic analysis based on complete genomes showed all OMRV-like strains can be divided into 3 groups with between-group distances ranging from 0.254 to 0.293. These results revealed that the OMRV isolate had high genetic diversity with those identified previously, and enriched the genetic information of family Totiviridae.

Detection and diversity of human enteroviruses from domestic sewage in Weishan Lake region, eastern China, 2018-2019.

AIMS: Next generation sequencing (NGS) technology has been widely used in monitoring and identifying microbiomes in sewage. We aimed to evaluate the ability of NGS analysis in directly detecting enterovirus (EV) in sewage and to understand the diversity of EVs circulated in the residents in Weishan Lake region. METHODS AND RESULTS: Fourteen sewage samples were collected in Jining, Shandong Province, China from 2018 to 2019 and were parallelly investigated by the P1 amplicon-based NGS method and cell culture method. The results showed that 20 different serotypes belonging to species Enterovirus A (EV-A) (n = 5), EV-B (n = 13), and EV-C (n = 2) were identified by NGS in the sewage concentrates, which exceeded the number of types detected by cell culture method (n = 9). Echovirus 11 (E11), Coxsackievirus (CV) B5 and CVA9 were the most detected types in those sewage concentrates. Phylogenetic analysis revealed that E11 sequences obtained in this study belonged to genogroup D5 and had close genetic relationship with clinical sequences. CONCLUSIONS: Various EV serotypes circulated in populations near Weishan Lake. The combination of NGS technology into environmental surveillance will greatly contribute to improving our knowledge about EV circulation patterns in the population.

Comparative study on molecular epidemiology of measles H1 outbreak and sporadic cases in Shandong Province, 2013-2019.

BACKGROUND: Measles caused by measles virus (MeV) is a highly contagious viral disease which has also been associated with complications including pneumonia, myocarditis, encephalitis, and subacute sclerosing panencephalitis. The current study isolated 33 strains belonging to 2 groups, outbreak and sporadic strains, in 13 cities of Shandong province, China from 2013 to 2019. Comparison of genetic characterization among 15 outbreak strains and 18 sporadic strains was performed by analyzing nucleotide sequences of the C-terminal region of N protein gene (N-450). RESULTS: All 33 stains belonged to genotype H1. The outbreak strains and sporadic strains distributed crossly in phylogenetic tree. Sequences alignment revealed some interesting G to A transversion which changed the amino acids on genomic sites 1317, 1422, and 1543. The nucleotide and amino acid similarities among outbreak isolates were 98-100% (0-10 nucleotide variations) and 97.7-100%, respectively; They were 97.3-100% and 96.6-100%, respectively for sporadic isolates. Evolutionary genetics analysis revealed that the mean evolution rates of outbreak and sporadic isolates were 1.26 N 10- 3 and 1.48 N 10- 3 substitutions per site per year separately, which were similar with corresponding data before 2012. Local transmission analysis suggested that there were three transmission chains in this study, two of them originated from Japan. Outbreak cases and sporadic cases emerged alternatively and were reciprocal causation on the transmission chains. CONCLUSIONS: Our study investigated the phylogeny and evolutional genetics of MeV during a 7-year surveillance, and compared epidemic and genetic characteristics of outbreak strains and sporadic strains. These results underscore the importance of evolutionary study alongside with sporadic cases in discovering and tracing possible outbreaks, especially in the stage of measles elimination.

Identification of the first C1 subgenotype of enterovirus 71 in the Chinese mainland in a retrospective study.

The C4 sub-genotype of Enterovirus 71 (EV71) has been identified as the most dominant sub-genotype circulating in the Chinese mainland since 1998. The circulation situation of EV71 before 1998 is not well established due to insufficient experimental data. The C1 subgenotype of EV71 has not yet been reported in the Chinese mainland by now. Based on the AFP surveillance system of the mainland of China, this study conducted a retrospective study of AFP cases for 1985-1999: a strain of EV-A71 C1 subgenotype was found. To our knowledge, this strain (SD92-41) is the first C1 sub-genotype reported in the Chinese mainland. This study demonstrates that the C1 gene subtype also appeared in the Chinese mainland, but it is unknown whether it is an imported or a local epidemic strain. With sufficient information known from retrospective studies, the source of the SD92-41 strain will be identified and the prevalence of EV-A71 in the Chinese mainland before 1998 will be clearer.

Environmental Surveillance Complements Case-Based Surveillance of Acute Flaccid Paralysis in Polio Endgame Strategy 2019-2023.

The Polio Endgame Strategy 2019-2023 has been developed. However, more effective and efficient surveillance activities should be conducted with the preparedness of emergence for vaccine-derived poliovirus (VDPV) or wild poliovirus (WPV). We reviewed the impact of the case-based acute flaccid paralysis (AFP) surveillance (1991 to 2018) and environmental surveillance (2011 to 2018) in polio eradication in Shandong province of China. Clinical characteristics of AFP cases and enterovirus (EV) investigation of research samples were assessed. During the period, 10,224 AFP cases were investigated, and 352 sewage samples were collected. The nonpolio AFP rate sustained at over 2.0/100,000 since 1997. Of 10,224 cases, males and young children experienced a higher risk of severe diseases, and 68.5% suffered lower limb paralysis. We collected 1,707 EVs from AFP cases, including 763 polioviruses and 944 nonpolio enteroviruses (NPEVs). No WPV was isolated since 1992. The AFP surveillance showed high sensitivity in detecting 143 vaccine-associated paralytic poliomyelitis (VAPP) cases and 6 VDPVs. For environmental surveillance, 217 (61.6%) samples were positive for poliovirus, and altogether, 838 polioviruses and 2,988 NPEVs were isolated. No WPV was isolated in environmental surveillance, although one VDPV2 was identified. Phylogenetic analysis revealed environmental surveillance had the capacity to detect a large scope of NPEVs. The case-based AFP surveillance will be indispensable for detecting VAPP cases and VDPV circulation in countries using oral polio vaccine. Environmental surveillance is advantageous in identifying EV circulation and responding to ongoing circulating VDPV outbreaks and should be expanded to complement the AFP surveillance.IMPORTANCE Interrupting wild poliovirus transmission and stopping circulating vaccine-derived poliovirus (cVDPV) outbreaks have been proposed as two global goals by the World Health Organization in the Global Polio Eradication Initiative (GPEI). This analysis, based on the 28-year acute flaccid paralysis (AFP) surveillance and 8-year environmental surveillance, provides continued high-quality surveillance performance in achieving the GPEI and detecting the circulation of enterovirus. Given the ongoing cVDPV outbreaks in the world, we present the surveillance capacity of environmental surveillance in capturing enterovirus circulation. The final poliovirus (especially VDPV) elimination has become increasingly complex, and the case-based AFP surveillance alone will lead to difficulties in early detecting dynamics of poliovirus transmission and monitoring the extent of environmental circulation. This study goes beyond previous work to provide a detailed comprehensive evaluation of the enterovirus surveillance and can be used to formulate a set of implementation plan and performance indicators for environmental surveillance.

Complete genome characterization of three enterovirus C96 isolates in China.

Enterovirus C96 (EV-C96) is a newer member of the species Enterovirus C. In this study, we determined the complete genome sequences of three EV-C96 isolates, one recovered from domestic sewage in 2013 and the other two isolated during surveillance of acute flaccid paralysis cases in 1991 and 2009, respectively. The complete genome sequences of these isolates were 75.6-84.2% identical to each other, 75.1-81.8% identical to the prototype strain, and 75.0-91.5% identical to other previously reported strains. Phylogenetic analysis of VP1 sequences revealed a high degree of genetic divergence among currently available EV-C96 sequences in the GenBank database, with an overall mean p-distance of 0.176. It is interesting to note that the 1991 strain 127/SD/CHN/1991 is the earliest EV-C96 isolate so far. Although EV-C96 is not frequently isolated during enterovirus surveillance, its great genetic diversity and the above findings suggest that this serotype has been circulating in China for many years.

Multiple transmission chains of coxsackievirus A4 co-circulating in China and neighboring countries in recent years: Phylogenetic and spatiotemporal analyses based on virological surveillance.

Coxsackievirus A4 (CV-A4) has been reported frequently in association with many infectious diseases and cases of hand, foot, and mouth disease potentially associated with CV-A4 infection are also identified. This study summarized the Shandong CV-A4 strains isolated from 25years acute flaccid paralysis surveillance, with an emphasis on exploring the phylogenetic analyses and spatiotemporal dynamics of CV-A4 at the global scale. We sampled 43 CV-A4 isolates and utilized VP1 gene to construct phylogenetic trees. Further extensive Bayesian phylogeographic analysis was carried out to investigate the evolution of CV-A4 and understand the spatiotemporal diffusion around the world using BEAST and SPREAD software. Phylogenetic trees showed that CV-A4 emerged to be more active in recent decades and multiple transmission chains were co-circulating. The molecular clock analysis estimated a mean evolutionary rate of 6.4×10-3 substitutions/site/year, and the estimated origin of CV-A4 around 1944. The phylogeographic analyses suggested the origin of CV-A4 could be in the USA, however regional dissemination was mainly located around the Asia-Europe region. The spatiotemporal dynamics of CV-A4 exhibited frequent viral traffic among localities, and virus from Shandong province seemed to have played a central role in spreading around China and neighboring countries. Our phylogenetic description and phylogeographic analyses indicate the importance of large spatial- and temporal-scale studies in understanding epidemiological dynamics of CV-A4, particularly the diffusion routes will be of great importance to global control efforts.

Identification and genetic analysis of Kadipiro virus isolated in Shandong province, China.

BACKGROUND: Kadipiro virus (KDV) belongs to the Reoviridae family, which consists of segmented, non-enveloped, double-stranded RNA viruses. It has previously been isolated from Culex, Anopheles, Armigeres and Aedes mosquitoes in Indonesia and China. Here, we describe the isolation and characterization of SDKL1625 from Anopheles sinensis mosquitoes in Shandong province, China. METHODS: In this study, we isolated Kadipiro virus in Aedes albopictus C6/36 cell culture and the complete genome sequencing was made by next generation sequencing. RESULTS: We isolated and characterized a Kadipiro virus from Anopheles sinensis mosquitoes in 2016 in Shandong province, China. Nucleotide and amino acid homology analysis of SDKL1625 showed higher levels of sequence identity with QTM27331 (Odonata, China, 2016) than with JKT-7075 (Culex fuscocephalus, Indonesia, 1981). The SDKL1625 has 86-97% amino acid identity with the JKT-7075, 88-99% amino acid identity with the QTM27331. Among the 12 fragments, VP1, VP2, VP4, VP6, VP7, VP9 and VP12 showed high amino acid identity (> 90%) and VP5 showed the lowest identity (86% and 88%). CONCLUSIONS: This is the first identification of KDV from mosquito in China. Virus morphology and genome organization were also determined, which will further enrich our understanding of the molecular biological characteristics of KDV and seadornaviruses.

Evolutionary phylogeography and transmission pattern of echovirus 14: an exploration of spatiotemporal dynamics based on the 26-year acute flaccid paralysis surveillance in Shandong, China.

BACKGROUND: Echovirus 14 (E-14) causes various clinical recognized syndromes, mostly with gastrointestinal syndrome and paralysis. The current study summarized the Shandong E-14 strains isolated from a 26-year acute flaccid paralysis (AFP) surveillance, and elucidated the characterization of phylogenetic and phylogeographic relationships of E-14 worldwide. RESULTS: As a predominant serotype circulating in AFP surveillance, phylogenetic analysis showed that E-14 exhibited both time and geographic subdivision worldwide. In order to know the evolutionary history and spatial temporal dynamics of E-14, evolutionary phylogeography was reconstructed using BEAST and SPREAD software based on the VP1 sequences. The time of the most recent common ancestor of E-14 was estimated around 85 years and evolved with 9.17 × 10-3 substitutions/site/year. Phylogeographic analysis suggested that two regional transmissions of E-14 were mainly detected, with one located between Europe and Africa countries and the other was in the Asia-Pacific region. CONCLUSIONS: Our study investigates the molecular evolution and phylogeographic of E-14, and brings new insight to the dispersal of E-14 worldwide. Regional transmission was mainly detected and Australia may be responsible for the spread of E-14 in recent years.

Continuous detection and genetic diversity of human rotavirus A in sewage in eastern China, 2013-2014.

BACKGROUND: Rotavirus is the leading viral agent for pediatric gastroenteritis. However, the case-based surveillance for rotavirus is limited in China, and its circulation in the environment is not well investigated. METHODS: From 2013 to 2014, rotavirus was detected in raw sewage samples of Jinan and Linyi by quantitative PCR (qPCR) and conventional reverse transcription PCR (RT-PCR). After sequenced and genotyped, sequences analysis was conducted. RESULTS: A total of 46 sewage samples were collected monthly for the detection of rotavirus, and rotavirus was positive in 43 samples (93.5 %, 43/46). By quantitative assessment, the concentrations of rotavirus in raw sewage ranged from 4.1 × 10(3) to 1.3 × 10(6) genome copies (GC)/L in Jinan, and from 1.5 × 10(3) to 3.0 × 10(5) GC/L in Linyi. A total of 318 sequences of 5 G-genotypes and 318 sequences of 5 P-genotypes were obtained. G9 (91.8 %, 292/318) and P[8] (56.0 %, 178/318) were the most common G- and P-genotype, respectively. Multiple transmission lineages were recognized in these genotypes. Interestingly, an intragenic recombination event between two G9 lineages was observed. CONCLUSIONS: This study provided the first report of comprehensive environmental surveillance for rotavirus in China. The results suggest that the concentration of rotavirus in raw sewage was high, and multiple rotavirus transmission lineages continuously co-circulated in Shandong.

Molecular characterization of coxsackievirus A21 in Shandong, China.

Coxsackievirus A21 (CV-A21) is a rarely detected serotype belonging to the species Enterovirus C (EV-C). In this study, we report the isolation and genetic characterization of CV-A21 in Shandong Province, China, during 1997 to 2013. A total of 13 strains were obtained from surveillance of cases of acute flaccid paralysis (AFP) (n = 9) and from environmental sewage (n = 4). Sequence comparison of the VP1 genes revealed high nucleotide sequence similarity (94.1 % to 99.8 % identity) among these Shandong strains during the period of 17 years and 75.8 % to 98.5 % sequence identity to foreign strains. Bayesian phylodynamic evolutionary analysis of Shandong and global CV-A21 VP1 sequences revealed that the inferred CV-A21 ancestral sequence dated back to 1750 (1643-1841) and evolved with 2.943 × 10(-3) substitutions per site per year. Alignment of the deduced VP1 amino acid sequences revealed changes that might alter the hydropathicity of the encoded protein. The complete genome of one strain from 2013 was sequenced and evidence of recombination was detected by similarity plot and bootscanning analyses. This study describes the complete genome characterization and molecular epidemiology of CV-A21 in China and gives further insight into CV-A21 evolution.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Environmental surveillance of human enteroviruses in Shandong Province, China, 2008 to 2012: serotypes, temporal fluctuation, and molecular epidemiology.

Environmental surveillance is an effective approach in investigating the circulation of polioviruses (PVs) and other human enteroviruses (EVs) in the population. The present report describes the results of environmental surveillance conducted in Shandong Province, China, from 2008 to 2012. A total of 129 sewage samples were collected, and 168 PVs and 1,007 nonpolio enteroviruses (NPEVs) were isolated. VP1 sequencing and typing were performed on all isolates. All PV strains were Sabin-like, with the numbers of VP1 substitutions ranging from 0 to 7. The NPEVs belonged to 19 serotypes, and echovirus 6 (E6), E11, coxsackievirus B3 (CVB3), E3, E12, and E7 were the six main serotypes, which accounted for 18.3%, 14.8%, 14.5%, 12.9%, 9.0%, and 5.7% of NPEVs isolated, respectively. Typical summer-fall peaks of NPEV were observed in the monthly distribution of isolation, and an epidemic pattern of annual circulation was revealed for the common serotypes. Phylogenetic analysis was performed on environmental CVB3 and E3 strains with global reference strains and local strains from aseptic meningitis patients. Shandong strains formed distinct clusters, and a close relationship was observed between local environmental and clinical strains. As an EV-specific case surveillance system is absent in China and many other countries, continuous environmental surveillance should be encouraged to investigate the temporal circulation and phylogeny of EVs in the population.

Complete genome sequence analysis of an enterovirus 75 isolate from China.

Enterovirus 75 (EV-B75) is a member of the species Enterovirus B (EV-B). So far, only the complete genome of the prototype strain from the United States is available. Here, we report the genome sequence of an EV-B75 isolate from an acute flaccid paralysis patient in China. Sequence analysis revealed high nucleotide sequence divergence from foreign EV-B75 strains and suggested several recombination events with other serotypes of EV-B.

Complete genome analysis of human enterovirus B73 isolated from an acute flaccid paralysis patient in Shandong, China.

Human enterovirus B73 (EV-B73) is a member of species Enterovirus B. To date, only one complete genome sequence of prototype strain CA55-1988 from California has been available. In this study, the complete genome analysis of an EV-B73 strain 088/SD/CHN/04 isolated from an acute flaccid paralysis case in Shandong Province, China in 2004 is conducted. It had 75.6 and 79.3 % nucleotide similarity with prototype strain CA55-1988 in the VP1 coding region and the complete genome, respectively. It had great VP1 nucleotide divergence (16.7-24.4 %) with EV-B73 strains from other parts of the world. Similarity plot and bootscanning analyses provided evidence of recombination with other EV-B viruses.

Metagenomic sequencing reveals viral diversity of mosquitoes from Shandong Province, China.

Mosquitoes carry a large number of known and unknown viruses, some of which could cause serious diseases in humans or animals. Metagenomic sequencing for mosquito viromes is crucial for understanding the evolutionary history of viruses and preventing emerging mosquito-borne diseases. We collected 1,598 mosquitoes belonging to four species from five counties in Shandong Province, China in 2021. They were grouped by species and sampling locations and subjected to metagenomic next-generation sequencing for the analysis of the viromes. A total of 233,317,352 sequencing reads were classified into 30 viral families and an unclassified group. Comparative analysis showed that mosquitoes in Shandong Province generally possessed host-specific virome. We detected mosquito-borne viruses including Japanese encephalitis virus, Getah virus, and Kadipiro virus in Culex tritaeniorhynchus and Anopheles sinensis samples. Phylogenetic analysis showed that these pathogenic viruses may have existed in mosquitoes in Shandong Province for a long time. Meanwhile, we identified 22 novel viruses belonging to seven families and the genus Negevirus. Our study comprehensively described the viromes of several common mosquito species in Shandong Province, China, and demonstrated the major role of host species in shaping mosquito viromes. Furthermore, the metagenomic data provided valuable epidemiological information on multiple mosquito-borne viruses, highlighting the potential risk of infection transmission. IMPORTANCE: Mosquitoes are known as the source of various pathogens for humans and animals. Culex tritaeniorhynchus, Armigeres subalbatus, and Anopheles sinensis have been found to transmit the Getah virus, which has recently caused increasing infections in China. Cx. tritaeniorhynchus and Culex pipiens are the main vectors of Japanese encephalitis virus and have caused epidemics of Japanese encephalitis in China in past decades. These mosquitoes are widely present in Shandong Province, China, leading to a great threat to public health and the breeding industry. This study provided a comprehensive insight into the viromes of several common mosquito species in Shandong Province, China. The metagenomic sequencing data revealed the risks of multiple pathogenic mosquito-borne viruses, including Japanese encephalitis virus, Getah virus, and Kadipiro virus, which are of great importance for preventing emerging viral epidemics.

Environmental Surveillance of Human Astroviruses in Jinan City of China, 2020-2021.

Human astroviruses (HAstVs) are a significant etiological agent of acute gastroenteritis in children. In order to investigate the circulation of HAstVs during the COVID-19 pandemic, a 2-year environmental surveillance was conducted in Jinan between 2020 and 2021. A total of 24 sewage samples were collected and concentrated. Real-time PCR indicated a positive rate of 83.3%, 79.2% (19/24), and 62.5% for classic, MLB, and VA types of HAstV in sewage samples, respectively, with genomic copies ranging from 6.4 × 103 to 3.7 × 107, 3.2 × 104 to 2.2 × 106, and 1.2 × 104 to 1.6 × 107 l-1. Next-generation sequencing (NGS) analysis on complete ORF2 amplicons from each sewage concentrate revealed the presence of 11 HAstV types, including HAstV-1, -2, -4, -5, MLB1, and VA1 to VA6, as well as non-human animal astroviruses. The most abundant HAstV types were HAstV-1, -4, and -5, which accounted for 70.3%, 12.6%, and 9.1% of total HAstV reads, respectively. Phylogenetic analysis revealed that the sequences obtained in this study were segregated into multiple transmission lineages, yet exhibited less genetic divergence among themselves than with foreign strains. These findings provide insight into the genotype diversity and genetic characterization of HAstVs during the COVID-19 pandemic, and highlight the effectiveness of utilizing NGS approaches to investigate sewage HAstVs.

Complete genome sequence of an enterovirus 80 strain isolated in China.

Enterovirus 80 (EV80) is a newly identified serotype of the species Human enterovirus B. An EV80 strain designated HZ01/SD/CHN/2004 was isolated from an acute flaccid paralysis case in Shandong, China, in 2004. Complete genome comparison revealed 79.5% similarity with the prototype strain and an insertion of 36 nucleotides in the 3' end of the VP1 coding region. Intertypic recombination with other serotypes was observed. This is the first report of the complete genome of EV80 in China.

A coxsackievirus B5-associated aseptic meningitis outbreak in Shandong Province, China in 2009.

In 2009, a major outbreak of aseptic meningitis was noted in Linyi city, Shandong province, China. From June to September 2009, a total of 2,104 cases were involved in this outbreak, and 98.6% of patients were <16 years of age. To determine the pathogen of the outbreak, 42 cerebrospinal fluid specimens collected from aseptic meningitis cases were tested for cell culture, and 17 (40.5%) enteroviruses were isolated and identified as Coxsackievirus B5 (CVB5). Homologous comparison indicated that these isolates had 0-7.7% nucleotide divergence with each other. Phylogenetic reconstruction showed global CVB5 could be separated into four genogroups, and all Linyi CVB5 isolates belonged to the genogroup C which had been circulating for recent 27 years in Asia and Europe. Interestingly, two distinct lineages were observed for the 17 isolates in the phylogenetic tree, indicating that at least two different transmission chains of CVB5 were responsible for this outbreak. This study showed that CVB5-associated aseptic meningitis is an emerging concern in China.