RESUMEN
The misuse of antibiotics and antimycotics accelerates the emergence of antimicrobial resistance, prompting the need for novel strategies to combat this global issue. Metallic nanoparticles have emerged as effective tools for combating various resistant microbes. Numerous studies have highlighted their potential in addressing antibiotic-resistant fungi and bacterial strains. Understanding the mechanisms of action of these nanoparticles, including iron-oxide, gold, zinc oxide, and silver is a central focus of research within the life science community. Various hypotheses have been proposed regarding how nanoparticles exert their effects. Some suggest direct targeting of microbial cell membranes, while others emphasize the release of ions from nanoparticles. The most compelling proposed antimicrobial mechanism of nanoparticles involves oxidative damage caused by nanoparticles-generated reactive oxygen species. This review aims to consolidate knowledge, discuss the properties and mechanisms of action of metallic nanoparticles, and underscore their potential as alternatives to enhance the efficacy of existing medications against infections caused by antimicrobial-resistant pathogens.
Asunto(s)
Antiinfecciosos , Nanopartículas del Metal , Antibacterianos/farmacología , Antibacterianos/uso terapéutico , Farmacorresistencia Bacteriana , Nanopartículas del Metal/uso terapéutico , Antiinfecciosos/farmacología , Antiinfecciosos/uso terapéutico , BacteriasRESUMEN
This study was aimed on the eco-friendly synthesis of silver nanoparticles (AgNPs), reduced graphene oxide (rGO) and AgNPs decorated rGO (rGO/AgNPs) nanocomposite and appraisal of their bioactivities and toxicity. As-prepared nanomaterials were established through high resolution X-ray diffraction (HR-XRD), high resolution transmission electron microscopy (HR-TEM), X-ray photoelectron spectroscopy (XPS), Raman spectroscopy, UV-Vis. spectroscopy and Fourier transform infrared spectroscopy (FT-IR). In this study, leaves extract, graphene oxide (GO) and rGO did not show antibacterial and anticancer activities; no significant embryo toxicity was recorded. On the other hand, AgNPs displayed good antibacterial and anticancer activities; however, higher toxic effects were observed even at the lowest test concentration (0.7 µg/ml). In case of rGO/AgNPs nanocomposite, significant antibacterial activity together with low cytotoxicity was noticed. Interestingly, the embryo toxicity of AgNPs was significantly reduced by rGO, implying the biocompatible nature of as-synthesized nanocomposite. Taken together, these results clearly suggest that rGO/AgNPs nano hybrid composite could be developed as the promising biomaterial for future biomedical applications.
Asunto(s)
Nanopartículas del Metal , Nanocompuestos , Antibacterianos/toxicidad , Grafito , Nanopartículas del Metal/química , Nanopartículas del Metal/toxicidad , Nanocompuestos/química , Plata/química , Plata/toxicidad , Espectroscopía Infrarroja por Transformada de Fourier , Difracción de Rayos XRESUMEN
Silver nanoparticles (AgNPs), manganese dioxide nanoparticles (MnO2NPs) and silver-doped manganese dioxide nanoparticles (Ag-doped MnO2NPs) were synthesized by simultaneous green chemistry reduction approach. Aqueous extract from the leaves of medicinally important plant Cucurbita pepo was used as reducing and capping agents. Various characterization techniques were carried out to affirm the formation of nanoparticles. HR-TEM analysis confirmed the size of nanoparticles in the range of 15-70 nm and also metal doping was confirmed through XRD and EDS analyses. FT-IR analysis confirmed that the presence of biomolecules in the aqueous leaves extract was responsible for nanoparticles synthesis. Further, the concentration of metals and their doping in the reaction mixture was achieved by ICP-MS. The growth curve and well diffusion study of synthesized nanoparticles were performed against food- and water-borne Gram-positive and Gram-negative bacterial pathogens. The mode of interaction of nanoparticles on bacterial cells was demonstrated through Bio-TEM analysis. Interestingly, AgNPs and Ag-doped MnO2NPs showed better antibacterial activity against all the tested bacterial pathogens; however, MnO2NPs alone did not show any antibacterial properties. Hence, AgNPs and Ag-doped MnO2NPs synthesized from aqueous plant leaves extract may have important role in controlling various food spoilage caused by bacteria.
Asunto(s)
Antibacterianos/farmacología , Microbiología de Alimentos , Compuestos de Manganeso/química , Nanopartículas del Metal , Óxidos/química , Extractos Vegetales/farmacología , Plata/química , Microbiología del Agua , Pruebas de Sensibilidad Microbiana , Microscopía Electrónica de Rastreo , Difracción de Polvo , Espectrometría por Rayos X , Espectrofotometría UltravioletaRESUMEN
In the present study, silver nanoparticles (AgNPs) synthesized from aqueous leaves extract of Malva crispa and their mode of interaction with food- and water-borne microbes were investigated. Formation of AgNPs was conformed through UV-Vis, FE-SEM, EDS, AFM, and HR-TEM analyses. Further the concentration of silver (Ag) in the reaction mixture was conformed through ICP-MS analysis. Different concentration of nanoparticles (1-3 mM) tested to know the inhibitory effect of bacterial pathogens such as Bacillus cereus, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Salmonella typhi, Salmonella enterica and the fungal pathogens of Penicillium expansum, Penicillium citrinum, Aspergillus oryzae, Aspergillus sojae and Aspergillus niger. Interestingly, nanoparticles synthesized from 2 to 3 mM concentration of AgNO3 showed excellent inhibitory activities against both bacterial and fungal pathogens which are well demonstrated through well diffusion, poison food technique, minimum inhibitory concentration (MIC), and minimum fungicidal concentration (MFC). In addition, mode of interaction of nanoparticles into both bacterial and fungal pathogens was documented through Bio-TEM analysis. Further the genomic DNA isolated from test bacterial strains and their interaction with nanoparticles was carried out to elucidate the possible mode of action of nanoparticles against bacteria. Interestingly, AgNPs did not show any genotoxic effect against all the tested bacterial strains which are pronounced well in agarose gel electrophoresis and for supporting this study, UV-Vis and Bio-TEM analyses were carried out in which no significant changes observed compared with control. Hence, the overall results concluded that the antimicrobial activity of biogenic AgNPs occurred without any DNA damage.
Asunto(s)
Antiinfecciosos/administración & dosificación , Fenómenos Fisiológicos Bacterianos/efectos de los fármacos , Hongos/efectos de los fármacos , Malva/química , Nanopartículas del Metal/administración & dosificación , Plata/administración & dosificación , Antiinfecciosos/síntesis química , Supervivencia Celular/efectos de los fármacos , Microbiología de Alimentos , Hongos/fisiología , Nanopartículas del Metal/química , Hojas de la Planta/química , Plata/química , Microbiología del AguaRESUMEN
Cryptosporidiosis, a prevalent gastrointestinal illness worldwide, is caused by the protozoan parasite Cryptosporidium parvum. Calcium-dependent protein kinase 1 (CpCDPK1), crucial for the parasite's life cycle, serves as a promising drug target due to its role in regulating invasion and egress from host cells. While potent Pyrazolopyrimidine analogs have been identified as candidate hit molecules, they exhibit limitations in inhibiting Cryptosporidium growth in cell culture, prompting exploration of alternative scaffolds. Leveraging the most potent compound, RM-1-95, co-crystallized with CpCDPK1, an E-pharmacophore model was generated and validated alongside a deep learning model trained on known CpCDPK1 compounds. These models facilitated screening Enamine's 2 million HTS compound library for novel CpCDPK1 inhibitors. Subsequent hierarchical docking prioritized hits, with final selections subjected to Quantum polarized docking for accurate ranking. Results from docking studies and MD simulations highlighted similarities in interactions between the cocrystallized ligand RM-1-95 and identified hit molecules, indicating comparable inhibitory potential against CpCDPK1. Furthermore, assessing metabolic stability through Cytochrome 450 site of metabolism prediction offered crucial insights for drug design, optimization, and regulatory approval processes.
Asunto(s)
Cryptosporidium parvum , Aprendizaje Profundo , Ensayos Analíticos de Alto Rendimiento , Inhibidores de Proteínas Quinasas , Proteínas Quinasas , Cryptosporidium parvum/efectos de los fármacos , Cryptosporidium parvum/enzimología , Proteínas Quinasas/metabolismo , Proteínas Quinasas/química , Inhibidores de Proteínas Quinasas/farmacología , Inhibidores de Proteínas Quinasas/química , Estructura Molecular , Simulación del Acoplamiento Molecular , Evaluación Preclínica de Medicamentos , Antiprotozoarios/farmacología , Antiprotozoarios/química , FarmacóforoRESUMEN
The present study focused on Rosmarinus officinalis Linn. leaves extract (ROE) mediated synthesis of silver nanoparticles (AgNPs), selenium nanoparticles (SeNPs), reduced graphene oxide (rGO) and silver and selenium nanoparticles decorated on rGO nanomaterials (Ag&SeNPs@rGONM's) for its antibacterial and antifungal in silico mechanistic insight applications. In addition, the toxicity of the synthesized nanomaterials was evaluated using Artemia salina. The formation of AgNPs, SeNPs, rGO and Ag&SeNPs@rGONM's was completed within 1.0, 140, 120 and 144 h, respectively. Various optical and microscopic examinations were evident in the nanomaterial's synthesis. Further, the average size and stability of the synthesized nanomaterials were conformed through dynamic light scattering (DLS) and zeta potential analyzer, respectively. The synthesized Ag&SeNPs@rGONM's were pronounced promising results against Gram-negative bacteria of Escherichia coli and the results achieved from the route of entry and action, reactive oxygen species (ROS), and antioxidant nature of nanoparticles were evidence of its properties. Computational studies further supported these findings, indicating much of the phytochemicals present in ROE well interact with the bacterial surface proteins. Similarly, the synthesized Ag&SeNPs@rGONM's was effective against Fusarium graminearum and Alternaria alternata in a dose dependent manner than its original nanomaterials. In addition, the docking study also confirmed that rosmarinic acid and caffeic acid prominently interacted with the fungal proteins. Interestingly, Ag&SeNPs@rGONM's pronounced less toxic effect compared to AgNPs and SeNPs against Artemia salina, which shows its biocompatibility.
Asunto(s)
Antibacterianos , Artemia , Nanopartículas del Metal , Plata , Plata/química , Plata/toxicidad , Animales , Artemia/efectos de los fármacos , Nanopartículas del Metal/toxicidad , Nanopartículas del Metal/química , Antibacterianos/toxicidad , Antibacterianos/química , Grafito/toxicidad , Grafito/química , Selenio/química , Selenio/toxicidad , Extractos Vegetales/química , Extractos Vegetales/toxicidad , Antioxidantes/química , Rosmarinus/química , Escherichia coli/efectos de los fármacos , Especies Reactivas de Oxígeno/metabolismo , Hojas de la Planta/química , Tecnología Química Verde , Simulación por Computador , Antifúngicos/toxicidad , Antifúngicos/químicaRESUMEN
Aflatoxin B1 (AFB1) is a naturally occurring toxin produced by Aspergillus flavus and Aspergillus parasiticus. The AFB1 is classified as a potent carcinogen and poses significant health risks both to humans and animals. Early detection of the toxin in post-harvest agricultural products will save lives and promote healthy food production. In this study, stratified docking approach was utilized to screen and identify potential aptamers that can bind to AFB1. ssDNA sequences were acquired from the Mendeley dataset, secondary and tertiary structures were predicted through a series of bioinformatics pipelines. Further, the final DNA tertiary structures were minimized and SiteMap algorithm was used to probe and locate binding cavities. According to the final XP docking result, a 34 nt sequence (5'-ATCCTGTGAGGAATGCTCATGCATAGCAAGGGCT-3') aptamer with a docking score of -5.959 kcal/mol was considered for 200 ns MD Simulation. Finally, the screened DNA-aptamer was immobilized over the gold surface based on Au-S chemistry and utilized for the detection of AFB1. The fabricated DNA-aptamer electrode demonstrated a good analytical performance including wide linear range (1.0 to 1000 ng L-1), detection limit (1.0 ng L-1), high stability, and reproducibility.Communicated by Ramaswamy H. Sarma.
RESUMEN
Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.
Asunto(s)
Aptámeros de Nucleótidos , Técnicas Biosensibles , Ciprofloxacina , Simulación del Acoplamiento Molecular , Simulación de Dinámica Molecular , Ciprofloxacina/química , Ciprofloxacina/análisis , Aptámeros de Nucleótidos/química , Técnicas Biosensibles/métodos , Simulación por ComputadorRESUMEN
Late-onset hypogonadism (LOH) is an age-related disease in men characterized by decreased testosterone levels with symptoms such as decreased libido, erectile dysfunction, and depression. Thymus quinquecostatus Celakovski (TQC) is a plant used as a volatile oil in traditional medicine, and its bioactive compounds have anti-inflammatory potential. Based on this knowledge, the present study aimed to investigate the effects of TQC extract (TE) on LOH in TM3 Leydig cells and in an in vivo aging mouse model. The aqueous extract of T. quinquecostatus Celakovski (12.5, 25, and 50⯵g/mL concentrations) was used to measure parameters such as cell viability, testosterone level, body weight, and gene expression, via in vivo studies. Interestingly, TE increased testosterone levels in TM3 cells in a dose-dependent manner without affecting cell viability. Furthermore, TE significantly increased the expression of genes involved in the cytochrome P450 family (Cyp11a1, Cyp17a1, Cyp19a1, and Srd5a2), which regulate testosterone biosynthesis. In aging mouse models, TE increased testosterone levels without affecting body weight and testicular tissue weight tissue of an aging animal group. In addition, the high-dose TE-treated group (50â¯mg/kg) showed significantly increased expression of the cytochrome p450 enzymes, similar to the in vitro results. Furthermore, HPLC-MS analysis confirmed the presence of caffeic acid and rosmarinic acid as bioactive compounds in TE. Thus, the results obtained in the present study confirmed that TQC and its bioactive compounds can be used for LOH treatment to enhance testosterone production.
Asunto(s)
Envejecimiento , Extractos Vegetales , Testículo , Testosterona , Thymus (Planta) , Animales , Testosterona/sangre , Masculino , Envejecimiento/efectos de los fármacos , Envejecimiento/metabolismo , Ratones , Extractos Vegetales/farmacología , Testículo/efectos de los fármacos , Testículo/metabolismo , Thymus (Planta)/química , Células Intersticiales del Testículo/efectos de los fármacos , Células Intersticiales del Testículo/metabolismo , Supervivencia Celular/efectos de los fármacos , Línea Celular , Hipogonadismo/tratamiento farmacológico , Modelos Animales de EnfermedadRESUMEN
Multi-drug resistant bacteria sometimes known as "superbugs" developed through overuse and misuse of antibiotics are determined to be sensitive to small concentrations of silver nanoparticles. Various methods and sources are under investigation for the safe and efficient synthesis of silver nanoparticles having effective antibacterial activity even at low concentrations. We used a medicinal plant named Salvia moorcroftiana to extract phytochemicals with antibacterial, antioxidant, and reducing properties. Three types of solvents; from polar to nonpolar, i.e., water, dimethyl sulfoxide (DMSO), and hexane, were used to extract the plant as a whole and as well as in fractions. The biosynthesized silver nanoparticles in all extracts (except hexane-based extract) were spherical, smaller than 20 nm, polydispersed (PDI ranging between 0.2 and 0.5), and stable with repulsive force of action (average zeta value = -18.55±1.17). The tested bacterial strains i.e., Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, and Enterococcus faecalis were found to be sensitive to even small concentrations of Ag-NPs, especially P. aeruginosa. The antibacterial effect of these Ag-NPs was associated with their ability to generate reactive oxygen species. DMSO (in fraction) could efficiently extract antibacterial phytochemicals and showed activity against MDR bacteria (inhibition zone = 11-12 mm). Thus, the antibacterial activity of fractionated DMSO extract was comparable to that of Ag-NPs because it contained phytochemicals having solid antibacterial potential. Furthermore, Ag-NPs synthesized from this extract owned superior antibacterial activity. However, whole aqueous extract-based Ag-NPs MIC was least (7-32 µg/mL) as compared to others.
Asunto(s)
Nanopartículas del Metal , Nanopartículas del Metal/química , Plata/química , Hexanos , Solventes , Dimetilsulfóxido , Antibacterianos/química , Bacterias , Fitoquímicos/farmacología , Extractos Vegetales/farmacología , Extractos Vegetales/química , Pruebas de Sensibilidad MicrobianaRESUMEN
The present study demonstrated the in vitro embryotoxicity assessment of gold nanoparticles (AuNPs) and copper nanoparticles (CuNPs) prepared from the leaves extract of Angelica keiskei (Miq.) Koidz. and addressed their mode of antibacterial mechanisms. Both AuNPs and CuNPs were rapidly synthesized and the formations were observed within 1 h and 24 h, respectively. Further the morphological images of the nanoparticles were confirmed through transmission electron microscopy (TEM), field emission scanning electron microscopy (FE-SEM) and atomic force microscopy (AFM). The high-resolution X-ray diffraction (HR-XRD) analysis of the biosynthesized AuNPs and CuNPs were matched with joint committee on powder diffraction standards (JCPDS) file no of 04-0784 and 89-5899, respectively. A strong prominent Au and Cu signals were observed through energy dispersive spectroscopy (EDS) analysis. Fourier transform infrared spectroscopy (FT-IR) analysis confirmed the responsible phytochemicals for the synthesis of AuNPs and CuNPs. In order to assess the toxic effects of AuNPs and CuNPs, bactericidal activity was performed against few of the test pathogens in which the effective inhibition was observed against Gram-negative bacteria than the Gram-positive bacteria. The mode of action and interaction of nanoparticles were performed on the bacterial pathogens and the results concluded that the interaction of nanoparticles initially initiated on the surface of the cell wall adherence followed by ruptured the cells and caused the cell death. In addition to the antibacterial activity, in vitro embryotoxicity studies were performed against zebrafish embryos and the results confirmed that 200 µg/ml concentration of AuNPs showed the embryotoxicity, whereas 2 µg/ml of CuNPs resulted the embryotoxicity. Furthermore, the morphological anomalies of zebrafish embryos revealed the toxic nature of the synthesized nanoparticles.
RESUMEN
Cryptosporidium species has been identified as an important pediatric diarrheal pathogen in resource-limited countries, particularly in very young children (0-24 months). However, the only available drug (nitazoxanide) has limited efficacy and can only be prescribed in a medical setting to children older than one year. Many drug development projects have started to investigate new therapeutic avenues. Cryptosporidium's unique biology is challenging for the traditional drug discovery pipeline and requires novel drug screening approaches. Notably, in recent years, new methods of oocyst generation, in vitro processing, and continuous three-dimensional cultivation capacities have been developed. This has enabled more physiologically pertinent research assays for inhibitor discovery. In a short time, many great strides have been made in the development of anti-Cryptosporidium drugs. These are expected to eventually turn into clinical candidates for cryptosporidiosis treatment in the future. This review describes the latest development in Cryptosporidium biology, genomics, transcriptomics of the parasite, assay development, and new drug discovery.
RESUMEN
Cryptosporidium parvum (Cp) causes a gastro-intestinal disease called Cryptosporidiosis. C. parvum Inosine 5' monophosphate dehydrogenase (CpIMPDH) is responsible for the production of guanine nucleotides. In the present study, 37 known urea-based congeneric compounds were used to build a 2D and 3D QSAR model against CpIMPDH. The built models were validated based on OECD principles. A deep learning model was adopted from a framework called Deep Purpose. The model was trained with 288 known active compounds and validated using a test set. From the training set of the 3D QSAR, a pharmacophore model was built and the best pharmacophore hypotheses were scored and sorted using a phase-hypo score. A phytochemical database was screened using both the pharmacophore model and a deep learning model. The screened compounds were considered for glide XP docking, followed by quantum polarized ligand docking. Finally, the best compound among them was considered for molecular dynamics simulation study.
Asunto(s)
Criptosporidiosis , Cryptosporidium parvum , Cryptosporidium , Aprendizaje Profundo , Cryptosporidium/metabolismo , Cryptosporidium parvum/metabolismo , Inhibidores Enzimáticos/farmacología , Humanos , IMP Deshidrogenasa/metabolismo , Inosina , Simulación del Acoplamiento Molecular , Relación Estructura-Actividad CuantitativaRESUMEN
Hydrogen peroxide (H2O2) is widely used in various industries and biological fields. H2O2 rapidly contaminants with water resources and hence simple detection process is highly wanted in various fields. The present study was focused on the biosensing, antimicrobial and embryotoxicity of bioinspired chitosan nanoparticles (Cs NPs), selenium nanoparticles (Se NPs), chitosan/selenium nanocomposites (Cs/Se NCs), silver nanoparticles (Ag NPs) and chitosan/silver nanocomposites (Cs/Ag NCs) synthesized using the aqueous Cucurbita pepo Linn. leaves extract. The physico-chemical properties of as-synthesized nanomaterials were confirmed by various spectroscopic and microscopic techniques. Further, hydrogen peroxide (H2O2) sensing properties and their sensitivities were confirmed by cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and chronoamperometry (CA) methods, in which Cs/Ag NCs showed pronounced sensing properties. In addition, the mode of antibacterial interaction results clearly demonstrated the effective inhibitory activity of as-prepared Ag NPs and Cs/Ag NCs against Gram negative pathogenic bacteria. The highest embryotoxicity was recorded at 0.19 µg/ml of Ag NPs and 1.56 µg/ml of Se NPs. Intriguingly, the embryo treated with Cs/Se NCs and Cs/Ag NCs significantly reduced the toxicity in the presence of Cs matrix. However, Cs/Se NCs did not show good response in H2O2 sensing than the Cs/Ag NCs, implying the biocompatibility of Cs/Ag NCs. Overall, the obtained results clearly suggest that Cs/Ag NCs could be suitable for dual applications such as for the detection of environmental pollutant biosensors and for biomedical research.
Asunto(s)
Quitosano , Nanopartículas del Metal , Nanocompuestos , Selenio , Antibacterianos/química , Quitosano/química , Peróxido de Hidrógeno , Nanopartículas del Metal/química , Nanopartículas del Metal/toxicidad , Nanocompuestos/química , Nanocompuestos/toxicidad , Selenio/farmacología , Plata/químicaRESUMEN
Despite significant progress made in the past two decades, silver nanoparticles (AgNPs) have not yet made it to the clinical trials. In addition, they showed both positive and negative effects in their toxicity from unicellular organism to well-developed multi-organ system, for example, rat. Although it is generally accepted that capped (bio)molecules have synergistic bioactivities and diminish the toxicity of metallic Ag core, convincing evidence is completely lacking. Therefore, in this review, we first highlight the recent in vivo toxicity studies of chemically manufactured AgNPs, biologically synthesized AgNPs and reference AgNPs of European Commission. Then, their toxic effects are compared with each other and the overlooked factors leading to the potential conflict of obtained toxicity results are discussed. Finally, suggestions are given to better design and conduct the future toxicity studies and to fast-track the successful clinical translation of AgNPs as well.
Asunto(s)
Nanopartículas del Metal , Plata , Animales , Nanopartículas del Metal/toxicidad , Ratas , Plata/toxicidadRESUMEN
Cigarette smoke (CS) is the main cause of chronic obstructive pulmonary disease (COPD), and continuous CS exposure causes lung inflammation and deterioration. To investigate the protective effects of Artemisia gmelinii against lung inflammation in this study, cigarette smoke extract (CSE)/lipopolysaccharide (LPS)-treated alveolar macrophages (AMs) and mice stimulated with CSE/porcine pancreas elastase (PPE) were used. Artemisia gmelinii ethanol extract (AGE) was effective in decreasing the levels of cytokines, chemokine, inducible nitric oxide synthase, and cyclooxygenase-2 by inhibiting mitogen-activated protein (MAP) kinases/nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) signaling pathway in AMs. Additionally, oral administration of AGE suppressed inflammatory cells' infiltration and secretion of inflammatory cytokines, chemokines, matrix metallopeptidase 9, and neutrophil extracellular traps in bronchoalveolar lavage fluid from the COPD model. Moreover, the obstruction of small airways, the destruction of the lung parenchyma, and expression of IL-6, TNF-α, IL-1ß, and MIP-2 were suppressed by inhibiting NF-κB activation in the lung tissues of the AGE group. These effects are associated with scopolin, chlorogenic acid, hyperoside, 3,4-di-O-caffeoylquinic acid, 3,5-di-O-caffeoylquinic acid, and 4,5-di-O-caffeoylquinic acid, which are the main components of AGE. These data demonstrate the mitigation effect of AGE on lung inflammation via inhibition of MAPK and NF-κB pathways, suggesting that AGE may be instrumental in improving respiratory and lung health.
RESUMEN
Microorganisms, their cell filtrates, and live biomass have been utilized for synthesizing various gold nanoparticles. The shape, size, stability as well as the purity of the bio synthesized nanoparticles become very essential for application purpose. In the present study, gold nanoparticles have been synthesized from the supernatant, live cell filtrate, and biomass of the fungus Penicillium brevicompactum. The fungus has been grown in potato dextrose broth which is also found to synthesize gold nanoparticles. The size of the particles has been investigated by Bio-TEM before purification, following purification and after storing the particles for 3 months under refrigerated condition. Different characterization techniques like X-ray diffraction, Fourier transform infrared spectroscopy, and UV-visible spectroscopy have been used for analysis of the particles. The effect of reaction parameters such as pH and concentration of gold salt have also been monitored to optimize the morphology and dispersity of the synthesized gold nanoparticles. A pH range of 5 to 8 has favored the synthesis process whereas increasing concentration of gold salt (beyond 2 mM) has resulted in the formation of bigger sized and aggregated nanoparticles. Additionally, the cytotoxic nature of prepared nanoparticles has been analyzed using mouse mayo blast cancer C(2)C(12) cells at different time intervals (24, 48, and 72 h) of incubation period. The cells are cultivated in Dulbecco's modified Eagle's medium supplemented with fetal bovine serum with antibiotics (streptopenicillin) at 37°C in a 5% humidified environment of CO(2). The medium has been replenished every other day, and the cells are subcultured after reaching the confluence. The viability of the cells is analyzed with 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide method.
Asunto(s)
Antineoplásicos/metabolismo , Antineoplásicos/farmacología , Oro/metabolismo , Oro/farmacología , Nanopartículas/química , Penicillium/metabolismo , Animales , Línea Celular Tumoral , Supervivencia Celular , Medios de Cultivo/química , Concentración de Iones de Hidrógeno , Ratones , Mioblastos/efectos de los fármacos , Mioblastos/fisiología , Análisis Espectral , Difracción de Rayos XRESUMEN
In the present study we investigated the extra cellular synthesis of gold and silver nanoparticles by using the yeast Candida guilliermondii. The formation of noble metal nanoparticles was monitored by the UV-Visible spectroscopy. As prepared gold and silver nanoparticles showed distinct surface plasmon peaks at 530 nm and 425 nm respectively. Phase and morphology of the as synthesized materials were investigated by X-ray diffraction and electron microscopy techniques respectively. XRD patterns confirmed the formation of gold and silver nanoparticles with face centered cubic structures. Bio-TEM images showed the formation of near spherical, well dispersed gold and silver nanoparticles in the size range of 50-70 nm and 10-20 nm respectively. The biosynthesized nanoparticles were tested for their antimicrobial activity against five pathogenic bacterial strains. The highest efficiency for both gold and silver nanoparticles was observed against Staphylococcus aureus. A comparative study was also done to find the effect of chemically synthesized noble metal nanoparticles against the above test strains. Chemically synthesized particles had no antimicrobial activity against any of the pathogenic strains. The results obtained suggest that biosynthesized gold and silver nanoparticles can be used as effective antimicrobial agents against some of the potential harmful pathogenic microorganisms.
Asunto(s)
Antiinfecciosos/metabolismo , Candida/metabolismo , Oro/metabolismo , Nanopartículas del Metal , Plata/metabolismo , Antiinfecciosos/farmacología , Oro/farmacología , Pruebas de Sensibilidad Microbiana , Plata/farmacología , Espectrofotometría Ultravioleta , Staphylococcus aureus/efectos de los fármacos , Difracción de Rayos XRESUMEN
In the present study, the synthesis of gold and silver nanoparticles was investigated using the culture supernatant broth of the yeast Saccharomyces cerevisae. Gold nanoparticles were formed within 24 hours of gold ion coming in contact with the culture supernatant broth. In case of silver the reduction process took 48 hours. The synthesized nanoparticles were investigated by UV-Visible spectroscopy. Distinct surface plasmon peaks were observed at 540 nm and 415 nm for gold and silver nanoparticles respectively. Bio-TEM micrographs of the synthesized nanoparticles indicated that the particles were well dispersed and near spherical in shape. The size range of the gold and silver nanoparticles was around 20-100 nm and 5-20 nm respectively. XRD patterns showed the presence of three distinct peaks corresponding to gold and silver nanoparticles respectively. A pH range of 4 to 6 and 8 to 10 favored optimum synthesis of gold and silver nanoparticles respectively. The process of reduction being extra cellular could be used in future for downstream processing in an eco friendly manner.
Asunto(s)
Oro/metabolismo , Nanopartículas del Metal/química , Saccharomyces cerevisiae/metabolismo , Plata/metabolismo , Espacio Extracelular/metabolismo , Oro/química , Concentración de Iones de Hidrógeno , Microscopía Electrónica de Transmisión , Tamaño de la Partícula , Plata/química , Espectrofotometría Ultravioleta , Difracción de Rayos XRESUMEN
Calcium Dependent Protein Kinases are found in the Apicomplexan, algae, and plants; however, they are not reported in vertebrates and are regarded as excellent drug targets for pharmaceutical interventions. Calcium Dependent Protein Kinases of Cryptosporidium are probably involved in the regulation of invasion and egress process during the infection of the host cells. The previous study reported that after the Calcium Dependent Protein Kinase 1 gene, Calcium Dependent Protein Kinase 6 of Cryptosporidium parvum is expressed in all stages of the parasite (merozoites/schizonts as well as sexual stages) at a comparable level and makes it as a valid drug target. In this study, an attempt is made to address the similarity in sequences and phylogenetic study of Calcium Dependent Protein Kinase 6 (CDPK6) among Calcium Dependent Protein Kinases of Apicomplexans. Further, the three-dimensional structure determination of CDPK6 of C. parvum was performed through a molecular modeling approach followed by virtual screening of small-molecule inhibitors from different datasets. The best inhibitor from Tres Cantos Antimalarial Set with ID 11730 reported a binding affinity of -8.2 kcal/mol against CDPK6 of C. parvum. Furthermore, the reliability of the binding mode of the inhibitor is validated through a complex molecular dynamics simulation study for a time interval of 100 ns. The simulation study advocates that the inhibitor Tres Cantos Antimalarial Set_11730 formed a stable interaction with the predicted active site residues and can be considered for industrial pharmaceutical research in future.Communicated by Ramaswamy H. Sarma.