Outer membrane vesicle vaccines.

Outer Membrane Vesicles (OMV) have received increased attention in recent years as a vaccine platform against bacterial pathogens. OMV from Neisseria meningitidis serogroup B have been extensively explored. Following the success of the MeNZB OMV vaccine in controlling an outbreak of N. meningitidis B in New Zealand, additional research and development resulted in the licensure of the OMV-containing four-component 4CMenB vaccine, Bexsero. This provided broader protection against multiple meningococcal B strains. Advances in the field of genetic engineering have permitted further improvements in the platform resulting in increased yields, reduced endotoxicity and decoration with homologous and heterologous antigens to enhance immuno genicity and provide broader protection. The OMV vaccine platform has been extended to many other pathogens. In this review, we discuss progress in the development of the OMV vaccine delivery platform, highlighting successful applications, together with potential challenges and gaps.

Review of current perspectives and future outlook on bacterial disease prevention through vaccination in Asian seabass (Lates calcarifer).

Asian seabass, Lates calcarifer, is an important aquatic species in mariculture. Intensive farming of this species has faced episodes of bacterial diseases, including those due to vibriosis, scale drop, and muscle necrosis disease, big belly disease, photobacteriosis, columnaris, streptococcosis, aeromoniasis, and tenacibaculosis. Vaccination is one of the most efficient, non-antibiotic, and eco-friendly strategies for protecting fish against bacterial diseases, contributing to aquaculture expansion and ensuring food security. As of now, although numerous vaccines have undergone laboratory research, only one commercially available inactivated vaccine, suitable for both immersion and injection administration, is accessible for preventing Streptococcus iniae. Several key challenges in developing vaccines for Asian seabass must be addressed, such as the current limited understanding of immunological responses to vaccines, the costs associated with vaccine production, forms, and routes of vaccine application, and how to increase the adoption of vaccines by farmers. The future of vaccine development for the Asian seabass industry, therefore, is discussed with these key critical issues in mind. The focus is on improving our understanding of Asian seabass immunity, including maternal immunity, immunocompetence, and immune responses post-vaccination, as well as developing tools to assess vaccine effectiveness. The need for an alignment of fish vaccines with state-of-the-art vaccine technologies employed in human and terrestrial animal healthcare is also discussed. This review also discusses the necessity of providing locally-produced autogenous vaccines, especially for immersion and oral vaccines, to benefit small-scale fish farmers, and the potential benefits that might be extended through changes to current husbandry practices such as the vaccination of broodstock and earlier life stages of their off-spring.

Application of natural-products repurposing strategy to discover novel FtsZ inhibitors: Bactericidal evaluation and the structure-activity relationship of sanguinarine and its analogs.

The novel bactericidal target-filamentous temperature-sensitive protein Z (FtsZ)-has drawn the attention of pharmacologists to address the emerging issues with drug/pesticide resistance caused by pathogenic bacteria. To enrich the structural diversity of FtsZ inhibitors, the antibacterial activity and structure-activity relationship (SAR) of natural sanguinarine and its analogs were investigated by using natural-products repurposing strategy. Notably, sanguinarine and chelerythrine exerted potent anti-Xanthomonas oryzae pv. oryzae (Xoo) activity, with EC50 values of 0.96 and 0.93 mg L-1, respectively, among these molecules. Furthermore, these two compounds could inhibit the GTPase activity of XooFtsZ, with IC50 values of 241.49 µM and 283.14 µM, respectively. An array of bioassays including transmission electron microscopy (TEM), fluorescence titration, and Fourier transform infrared spectroscopy (FT-IR) co-verified that sanguinarine and chelerythrine were potential XooFtsZ inhibitors that could interfere with the assembly of FtsZ filaments by inhibiting the GTPase hydrolytic ability of XooFtsZ protein. Additionally, the pot experiment suggested that chelerythrine and sanguinarine demonstrated excellent curative activity with values of 59.52% and 54.76%, respectively. Excitedly, these two natural compounds also showed outstanding druggability, validated by acceptable drug-like properties and low toxicity on rice. Overall, the results suggested that chelerythrine was a new and potential XooFtsZ inhibitor to develop new bactericide and provided important guiding values for rational drug design of FtsZ inhibitors. Notably, our findings provide a novel strategy to discover novel, promising and green bacterial compounds for the management of plant bacterial diseases.

Transmission and Management of Pathogenic Agrobacterium tumefaciens and Rhodococcus fascians in Select Ornamentals.

Pathogenic Agrobacterium tumefaciens and Rhodococcus fascians are phytobacteria that induce crown gall and leafy gall disease, respectively, resulting in undesirable growth abnormalities. When present in nurseries, plants infected by either bacterium are destroyed, resulting in substantial losses for growers, especially those producing plants valued for their ornamental attributes. There are many unanswered questions regarding pathogen transmission on tools used to take cuttings for propagation and whether products used for bacterial disease control are effective. We investigated the ability to transmit pathogenic A. tumefaciens and R. fascians on secateurs and the efficacy of registered control products against both bacteria in vitro and in vivo. Experimental plants used were Rosa × hybrida, Leucanthemum × superbum, and Chrysanthemum × grandiflorum for A. tumefaciens and Petunia × hybrida and Oenothera 'Siskiyou' with R. fascians. In separate experiments, we found secateurs could convey both bacteria in numbers sufficient to initiate disease in a host-dependent manner and that bacteria could be recovered from secateurs after a single cut through an infected stem. In in vivo assays, none of six products tested against A. tumefaciens prevented crown gall disease, although several products appeared promising in in vitro trials. Likewise, four compounds trialed against R. fascians failed to prevent disease. Sanitation and clean planting material remain the primary means of disease management.

Increase of Bacterial Leaf Streak in Hard Red Spring Wheat in North Dakota and Yield Loss Considerations.

Bacterial leaf streak (BLS), caused by Xanthomonas translucens pv. undulosa, has increased in both prevalence and severity in the major hard red spring wheat (HRSW)-producing state North Dakota. The disease is readily observed after flag leaf emergence and can quickly lead to defoliation and severe yield loss. The objectives of this research were to document the prevalence and incidence of BLS in North Dakota and provide estimations of yield and economic losses. Trained field scouts determined the incidence and prevalence of BLS in ND on HRSW plants between Feekes growth stage (FGS) 8 and FGS 11.2 from 2015 to 2021, and data were used to determine BLS-affected hectares. Yield data in combination with BLS ratings were obtained from HRSW performance trials to estimate the impact of BLS on yield. The combination of variety identity, hectarage data, BLS-affected hectarage estimates, and yield loss estimates was used to estimate economic losses from BLS in 2019 and 2020. Our data suggest that BLS-affected hectares ranged from 747 to 141,680 between 2015 and 2021. Yield loss was observed at multiple HRSW performance trial locations, with estimated yield losses as high as 60% on susceptible varieties. The amount of BLS-affected hectares was the highest in 2019 and 2020, and direct economic losses for North Dakota HRSW producers were estimated to be as high as $4.7 and $8.0 million, respectively. These data highlight the importance of BLS in HRSW and the need to procure resources for breeding efforts and grower education on management of BLS.

Design, synthesis, antibacterial activity, and mechanism of novel resveratrol derivatives containing an 1,3,4-oxadiazole moiety.

Rice bacterial diseases seriously threaten the development of rice industry in the world, and chemical control is still one of the effective means to control it. To find novel antibacterial agents, 42 resveratrol derivatives were designed and synthesized based on natural product resveratrol as lead structure, and their antibacterial activities were evaluated. Most compounds have excellent antibacterial activities. Among them, the EC50 values of compound B1 against Xanthomonas oryzae pv. oryzae (Xoo) and Xanthomonas oryzae pv. oryzicola (Xoc) were 4.76 and 8.85 mg/L, respectively. The curative activities of compound B1 against bacterial leaf blight and bacterial leaf streak were 45.57 and 38.40%, and the protective activities were 49.41 and 35.93%, respectively. In addition, compound B1 could change bacterial cell surface morphology by inhibiting biofilm formation and exopolysaccharide production, and increasing membrane permeability, thereby affecting the normal growth of bacteria. Furthermore, transcriptome analysis showed that differential expressed genes were mainly enriched in plant-pathogen interaction pathway and MAPK signaling pathway-plant after compound B1 treated susceptible rice. We will further optimize the structure of compound B1 in future work to find more efficient antibacterial agents.

First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

Differential Microbial Communities in Paddy Soils Between Guiyang Plateaus and Chengdu Basins Drive the Incidence of Rice Bacterial Diseases.

Southwest China has the most complex rice-growing regions in China. With great differences in topography, consisting mainly of basins and plateaus, ecological factors differ greatly between regions. In this study, bulk paddy soils collected from long-term rice fields in Chengdu (basins) and Guiyang (plateaus) were used to study the correlation between microbial diversity and the incidence of rice bacterial diseases. Results showed that the microbial community composition in paddy soils and the microbial functional categories differed significantly between basins and plateaus. They shared >70% of the dominant genera (abundance >1%), but the abundance of the dominant genera differed significantly. Functional analysis found that bulk paddy soils from Chengdu were significantly enriched in virulence factor-related genes; soils from Guiyang were enriched in biosynthesis of secondary metabolites, especially antibiotics. Correspondingly, Chengdu was significantly enriched in leaf bacterial pathogens Acidovorax, Xanthomonas, and Pseudomonas. Greenhouse experiments and correlation analysis showed that soil chemical properties had a greater effect on microbial community composition and positively correlated with the higher incidence of rice bacterial foot rot in Guiyang, whereas temperature had a greater effect on soil microbial functions and positively correlated with the higher severity index of leaf bacterial diseases in Chengdu. Our results provide a new perspective on how differences in microbial communities in paddy soils can influence the incidence of rice bacterial diseases in areas with different topographies.

First report of Bougainvillea spectabilis Willd bacterial leaf spot caused by Pantoea stewartii subspecies indologenes in China.

Bougainvillea spectabilis Willd. is an important ornamental flowering plant belonging to the family Nyctaginaceae. It is widely used in landscape designs in tropical and subtropical regions. In December 2020, severe disease-causing leaf spots were discovered on the leaves of B. spectabilis in the Modern Agricultural Park (110°19' E, 21°26' N) Zhanjiang City, Guangdong Province, China. Field surveys revealed that the disease was widespread, with an incidence of 60-80%. Early symptoms on the leaves appeared as tiny leaf spots that later developed into concentric circles surrounded by a yellowish halo (Fig. 1). Diseased leaves with typical symptoms were collected for pathogen isolation. The leading edges of the lesions were excised, sanitized in 75% ethanol for 30 s and in 3% sodium hypochlorite for 3 min, and rinsed three times with sterile distilled water (SDW). The diseased tissue was crushed in 1 mL SDW, soaked for 15 min, and then spread onto nutrient agar medium on a petri dish. Circular, bright yellow colonies with smooth margins were observed after 24 h of incubation at 28 °C. The isolate (SJM1) was a gram-negative bacillus with positive results for catalase, indole synthesis, maltose, and arbutin and negative results for sorbitol, lactose, salicin, and starch hydrolysis. The SJM1 genomic DNA was extracted using the TIANamp Bacterial DNA Kit, and partial 16S rDNA gene segments were amplified using the bacterial generic primers 27F and 1492R. The collated 16S rDNA gene sequences were submitted to the NCBI GenBank (MZ723935). BLAST analysis of the sequences revealed 99.38% identity with Pantoea stewartii (MG517424.1). Amplification using subspecies-specific primers galE (#562/564; Gehring et al. 2014), glmS (#356/341; Wensing et al. 2010), and pstC + pstS (#338/339; Wensing et al. 2010) revealed that the genes showed 99-100% identity with P. stewartii subsp. indologenes (galE = 100%, MZ754494.1; glmS = 99.79%, MZ75496.1; and pstC + pstS = 99.89%, MZ754495.1). Phylogenetic trees were constructed using the neighbor-joining method (MEGA X), with both the 16S rDNA sequence (Fig. 2 2A) and the concatenated 16S rDNA, galE, pstC + pstS, and glmS sequences (Fig.2 2B). The SJM1 isolate belonged to the same clade as P. stewartii subsp. indologenes and was 99% homologous to P. stewartii subsp. indologenes strain ZJ-FGZX1 (Fig. 2 2B; Ren et al. 2020). Pathogenicity tests were performed through prick wound inoculation. Sterile needles were used to create fresh wounds on healthy young leaves of one-year-old B. spectabilis plants. Wounds were inoculated with 20 µl bacterial suspension (1 × 108 CFU/ml) or SDW. Four leaves per plant and three plants per treatment were evaluated. The plants were incubated at 28 °C temperature and 80-90% relative humidity. After 4-7 days of inoculation, all plants inoculated with the bacterial suspension had spot symptoms with a halo, similar to those observed in the field. However, leaves inoculated with SDW alone did not show any symptoms. Furthermore, the colony morphology and 16S rDNA sequences of the strains isolated from the inoculated leaves were identical to those of the original isolates. These results verified Koch's postulates. Based on biochemical identification and sequencing analysis, the pathogen causing B. spectabilis leaf spot was identified as P. stewartii subsp. indologenes. Previous reports have shown that P. stewartii subsp. indologenes can cause diseases in Dracaena sanderiana, Cenchrus americanus, and Allium cepa (Zhang et al. 2020, Ashajyothi et al. 2021, Stumpf et al. 2018). To our knowledge, this is the first report of P. stewartii subsp. indologenes causing B. spectabilis leaf spot disease in China.

Control of Bacterial Diseases of Banana Using CRISPR/Cas-Based Gene Editing.

Banana is an important staple food crop and a source of income for smallholder farmers in about 150 tropical and sub-tropical countries. Several bacterial diseases, such as banana Xanthomonas wilt (BXW), blood, and moko disease, cause substantial impacts on banana production. There is a vast yield gap in the production of bananas in regions where bacterial pathogens and several other pathogens and pests are present together in the same field. BXW disease caused by Xanthomonas campestris pv. musacearum is reported to be the most destructive banana disease in East Africa. The disease affects all the banana varieties grown in the region. Only the wild-type diploid banana, Musa balbisiana, is resistant to BXW disease. Developing disease-resistant varieties of bananas is one of the most effective strategies to manage diseases. Recent advances in CRISPR/Cas-based gene editing techniques can accelerate banana improvement. Some progress has been made to create resistance against bacterial pathogens using CRISPR/Cas9-mediated gene editing by knocking out the disease-causing susceptibility (S) genes or activating the expression of the plant defense genes. A synopsis of recent advancements and perspectives on the application of gene editing for the control of bacterial wilt diseases are presented in this article.

Discovery of Epipodophyllotoxin-Derived B2 as Promising XooFtsZ Inhibitor for Controlling Bacterial Cell Division: Structure-Based Virtual Screening, Synthesis, and SAR Study.

The emergence of phytopathogenic bacteria resistant to antibacterial agents has rendered previously manageable plant diseases intractable, highlighting the need for safe and environmentally responsible agrochemicals. Inhibition of bacterial cell division by targeting bacterial cell division protein FtsZ has been proposed as a promising strategy for developing novel antibacterial agents. We previously identified 4'-demethylepipodophyllotoxin (DMEP), a naturally occurring substance isolated from the barberry species Dysosma versipellis, as a novel chemical scaffold for the development of inhibitors of FtsZ from the rice blight pathogen Xanthomonas oryzae pv. oryzae (Xoo). Therefore, constructing structure-activity relationship (SAR) studies of DMEP is indispensable for new agrochemical discovery. In this study, we performed a structure-activity relationship (SAR) study of DMEP derivatives as potential XooFtsZ inhibitors through introducing the structure-based virtual screening (SBVS) approach and various biochemical methods. Notably, prepared compound B2, a 4'-acyloxy DMEP analog, had a 50% inhibitory concentration of 159.4 µM for inhibition of recombinant XooFtsZ GTPase, which was lower than that of the parent DMEP (278.0 µM). Compound B2 potently inhibited Xoo growth in vitro (minimum inhibitory concentration 153 mg L-1) and had 54.9% and 48.4% curative and protective control efficiencies against rice blight in vivo. Moreover, compound B2 also showed low toxicity for non-target organisms, including rice plant and mammalian cell. Given these interesting results, we provide a novel strategy to discover and optimize promising bactericidal compounds for the management of plant bacterial diseases.

Attribution of Illnesses Transmitted by Food and Water to Comprehensive Transmission Pathways Using Structured Expert Judgment, United States.

Illnesses transmitted by food and water cause a major disease burden in the United States despite advancements in food safety, water treatment, and sanitation. We report estimates from a structured expert judgment study using 48 experts who applied Cooke's classical model of the proportion of disease attributable to 5 major transmission pathways (foodborne, waterborne, person-to-person, animal contact, and environmental) and 6 subpathways (food handler-related, under foodborne; recreational, drinking, and nonrecreational/nondrinking, under waterborne; and presumed person-to-person-associated and presumed animal contact-associated, under environmental). Estimates for 33 pathogens were elicited, including bacteria such as Salmonella enterica, Campylobacter spp., Legionella spp., and Pseudomonas spp.; protozoa such as Acanthamoeba spp., Cyclospora cayetanensis, and Naegleria fowleri; and viruses such as norovirus, rotavirus, and hepatitis A virus. The results highlight the importance of multiple pathways in the transmission of the included pathogens and can be used to guide prioritization of public health interventions.

Novel Applications of Metagenomics for Detection of Tickborne Pathogens.

BACKGROUND: Tick populations have expanded in many parts of the globe, bringing with them an enhanced appreciation and discovery of novel tickborne pathogens, as well an increased in reported human cases of tickborne disease. Targeted and unbiased (shotgun) clinical metagenomic sequencing tests are increasingly used for detection of known and emerging infectious agents and have recently been employed for detection of tickborne pathogens. CONTENT: This review describes the types of metagenomic sequencing assays used for detection of emerging tickborne pathogens and reviews the recent literature on this topic. Important diagnostic and interpretative challenges are also covered. SUMMARY: Metagenomic analysis has emerged as a powerful tool for detection, discovery, characterization, and classification of tickborne pathogens. Shotgun metagenomics is especially promising because it allows for detection of all tickborne bacteria, viruses, and parasites in a single specimen. Despite the potential advantages, there are several important challenges, including high cost, complexity of testing and interpretation, and slow turnaround time. No doubt, these challenges will diminish with increased use and advances in the field.

Granulomatous bacterial diseases in fish: An overview of the host's immune response.

Bacterial diseases represent the main impediment to the development of fish aquaculture. Granulomatous diseases caused by bacteria lead to fish culture losses by high mortality rates and slow growth. Bacteria belonging to genera Streptococcus spp., Mycobacterium sp., Nocardia sp., Francisella sp., and Staphylococcus sp. have been implicated in the development of granulomatous processes. The granuloma formation and the fish's immune response continue to be the subject of scientific research. In fish, the first defense line is constituted by non-specific humoral factors through growth-inhibiting substances such as transferrin and antiproteases, or lytic effectors as lysozyme and antimicrobial peptides, and linking with non-specific phagocyte responses. If the first line is breached, fish produce antibody constituents for a specific humoral defense inhibiting bacterial adherence, as well as the mobilization of non-phagocytic host cells and counteracting toxins from bacteria. However, bacteria causing granulomatous diseases can be persistent microorganisms, difficult to eliminate that can cause chronic diseases, even using some immune system components to survive. Understanding the infectious process leading to granulomatosis and how the host's immune system responds against granulomatous diseases is crucial to know more about fish immunology and develop strategies to overcome granulomatous diseases.

Huanglongbing and Citrus Variegated Chlorosis Integrated Management Based on Favorable Periods for Vector Population Increase and Symptom Expression.

Huanglongbing (HLB, associated with Candidatus Liberibacter asiaticus and transmitted by the Asian citrus psyllid Diaphorina citri) and citrus variegated chlorosis (CVC, caused by Xylella fastidiosa subsp. pauca and transmitted by sharpshooter species) have been managed by vector control and removal of symptomatic trees. Although vectors and new symptomatic trees can be detected year round, peaks of vector populations are higher in spring and summer, and the most symptomatic trees are found in autumn and winter. This work aimed to compare the management of both diseases during these favorable periods. The experiment was conducted during 5 years in a commercial orchard and had a three-by-two factorial design. The factor "vector control" had three levels: monthly vector control year round (VCYR), monthly vector control in spring and summer (VCSS), and vector control when a threshold level of 10% occupancy was detected (VCOT). The factor "inoculum removal" had two levels: monthly eradication year round (TEYR) and monthly eradication in autumn and winter (TEAW). Host flush, both HLB and CVC vector populations, and the number of symptomatic citrus plants were visually assessed. The level of vectors over the seasons, as measured using the average area under the curve (AUC), was similar for all treatments with the exception of psyllid abundance, which was approximately 4.5 times higher for VCSS than for other treatments. For both diseases, no difference in the average AUC of disease progress and disease final incidence was observed. VCOT or adjusted VCSS associated with TEAW could be integrated for sustainable citrus production.

Molecular epidemiology of certain vector-borne bacterial microorganisms in domestic animals and their ectoparasites in Egypt.

Vector-borne bacterial diseases (VBBD) are a diverse group of tropical and subtropical zoonotic diseases. This study investigated the possibility of domestic animals to carry certain vector-borne bacterial microorganisms (VBBMs), as well as the presence of these targeted DNAs in their ectoparasites in different localities of Egypt using molecular analyses. For this study, 234 animal hosts (112 cattle, 38 sheep, 28 goats, 26 buffaloes, 22 donkeys, and 8 horses) in addition to 115 ectoparasites (95 ticks and 20 lice) were investigated for the molecular detection of Bartonella spp., Borrelia spp., and Rickettsia spp., targeting 16S-23S rRNAITS, 16S rRNA, and gltA genes, respectively. The results indicated that the overall prevalence of VBBD was observed in 17 animals (7.26%), of which 16 (6.84%) were positive for Bartonella spp. and one (0.43%) was positive for Borrelia theileri. All blood samples were negative for the DNA of Rickettsia spp. In addition, the results demonstrated that all ectoparasites were free from VBBDNA. Furthermore, of the animals examined for ectoparasite infestation, 28 (11.97%) and 5 (2.14%) represented Rhipicephalus annulatus ticks and Haematopinus tuberculatus lice, respectively, which infested animals. Analysis of epidemiological factors revealed that gender, age, and ectoparasitic infestation of animals had a significant effect on Bartonella infection, whereas no significant difference between animal species was observed. Hence, we report a potential novel Bartonella sp. from cattle and buffaloes, including a new genotype of Bo. theileri from cattle, in Egypt.

A good career start can open doors: the plusses and minuses of an international graduate student program-a student's perspective.

There are many Ph.D. programs from various funding agencies that provide excellent starts to a scientific career. Multinational Ph.D. positions attract students because they provide students with much-required exposure to the international scientific community at an early stage of the career. For this reason, multinational Ph.D. positions can be considered as a better career opportunity over Ph.D. positions confined to a single country. In addition, these multidisciplinary research programs connect different organizations to deal with the problems of global interest. One of these multi-disciplinary research programs is the viral and bacterial adhesion network training-innovative training network (ViBrANT). ViBrANT is a multifaceted platform that develops the required skillsets in young researchers and thereby also contributes to building a multidisciplinary research community. Is this the only parameter to be considered or are there other factors that can also stimulate one's career development? In this perspective article, I will discuss the key reasons why I chose a multinational Ph.D. program along with the merits of being part of ViBrANT. I also discuss the challenges I faced while moving from India to the United Kingdom.

Novel vanillin derivatives containing a 1,3,4-thiadiazole moiety as potential antibacterial agents.

In this study, thirty-four novel vanillin derivatives containing a 1,3,4-thiadiazole structure were obtained and their antibacterial activities were evaluated. The results indicate that most of the title compounds displayed inhibitory effects on Xanthomonas oryzae pv. oryzae (Xoo) and Xanthomonas oryzae pv. oryzicola (Xoc). Among them, compound 29 exhibited excellent antibacterial activities against Xoo and Xoc in vitro, with the EC50 values of 3.14 and 8.83 µg/mL, respectively, much superior to thiodiazole copper (87.03 and 108.99 µg/mL) and bismerthiazol (67.64 and 79.26 µg/mL). Under greenhouse condition, the protective efficiency of compound 29 against rice bacterial leaf blight was 49.34%, and curative efficiency was 40.96%. In addition, compound 29 can reduce the exopolysaccharides production of Xoo, increase the permeability of cell membrane and damage cell membrane.

A commercial autogenous injection vaccine protects ballan wrasse (Labrus bergylta, Ascanius) against Aeromonas salmonicida vapA type V.

Atypical Aeromonas salmonicida (aAs) and Vibrionaceae related species are bacteria routinely recovered from diseased ballan wrasse used as cleaner fish in the Atlantic salmon farming industry. Autogenous (i.e. farm specific inactivated) multivalent vaccines formulated from these microorganisms are widely used to protect farmed wrasse despite limited experimental proof that they are primary pathogens. In this study, the components of a commercial multivalent injection vaccine containing four strains of Aeromonas salmonicida and one strain of Vibrio splendidus previously isolated from ballan wrasse in Scotland, were tested for infectivity, pathogenicity and virulence via intra peritoneal injection at pre-deployment size (25-50 g) and the efficacy of the vaccine for protection against aAs assessed. Injection with 3.5 × 109, 8 × 109 1.8 × 109 and 5 × 109 cfu/fish of Vibrio splendidus, V. ichthyoenteri, Aliivibrio logeii and A. salmonicida, respectively, did not cause significant mortalities, lesions or clinical signs after a period of 14 days. IP injection with both aAs and Photobacterium indicum successfully reproduced the clinical signs and internal lesions observed during natural outbreaks of the disease. Differences in virulence (LD50 at day 8-post infection of 3.6 × 106 cfu/fish and 1.6 × 107 cfu/fish) were observed for two aAs vapA type V isolates. In addition, the LD50 for Photobacterium indicum was 2.2 × 107 cfu/fish. The autogenous vaccine was highly protective against the two aAs vapA type V isolates after 700-degree days of immunisation. The RPSFINAL values for the first isolate were 95 and 91% at 1 × 106 cfu/fish and 1 × 107 cfu/fish, respectively, and 79% at 1 × 107 cfu/fish for the second isolate tested. In addition, significantly higher anti aAs seral antibodies (IgM), were detected by ELISA in vaccinated fish in contrast with control (mock vaccinated) fish. These results suggest wrasse can be effectively immunised and protected against aAs infection by injection with oil adjuvanted vaccines prepared with inactivated homologous isolates.

Complete Genome Sequence Resource of a Strain of Curtobacterium flaccumfaciens pv. flaccumfaciens, the Causal Agent of Bacterial Wilt of Common Bean, from Turkey.

Curtobacterium flaccumfaciens pv. flaccumfaciens is the causal agent of bacterial wilt of common bean (Phaseolus vulgaris), a disease that can reduce yields of this economically important crop worldwide. Current genomics resources for this bacterial pathogen are limited. Therefore, long-read sequencing was used to determine the complete genome sequence of a pathogenic C. flaccumfaciens pv. flaccumfaciens strain isolated from common bean leaves showing irregular necrotic lesions with yellow borders collected in a commercial field in Turkey in 2015.