Brassica rapa CURLY LEAF is a major H3K27 methyltransferase regulating flowering time.

MAIN CONCLUSION: In Brassica rapa, the epigenetic modifier BraA.CLF orchestrates flowering by modulating H3K27me3 levels at the floral integrator genes FT, SOC1, and SEP3, thereby influencing their expression. CURLY LEAF (CLF) is the catalytic subunit of the plant Polycomb Repressive Complex 2 that mediates the trimethylation of histone H3 lysine 27 (H3K27me3), an epigenetic modification that leads to gene silencing. While the function of CURLY LEAF (CLF) has been extensively studied in Arabidopsis thaliana, its role in Brassica crops is barely known. In this study, we focused on the Brassica rapa homolog of CLF and found that the loss-of-function mutant braA.clf-1 exhibits an accelerated flowering together with pleiotropic phenotypic alterations compared to wild-type plants. In addition, we carried out transcriptomic and H3K27me3 genome-wide analyses to identify the genes regulated by BraA.CLF. Interestingly, we observed that several floral regulatory genes, including the B. rapa homologs of FT, SOC1 and SEP3, show reduced H3K27me3 levels and increased transcript levels compared to wild-type plants, suggesting that they are direct targets of BraA.CLF and key players in regulating flowering time in this crop. In addition, the results obtained will enhance our understanding of the epigenetic mechanisms regulating key developmental traits and will aid to increase crop yield by engineering new Brassica varieties with different flowering time requirements.

Arabidopsis CURLY LEAF functions in leaf immunity against fungal pathogens by concomitantly repressing SEPALLATA3 and activating ORA59.

Arabidopsis non-host resistance against non-adapted fungal pathogens including Colletotrichum fungi consists of pre-invasive and post-invasive immune responses. Here we report that non-host resistance against non-adapted Colletotrichum spp. in Arabidopsis leaves requires CURLY LEAF (CLF), which is critical for leaf development, flowering and growth. Microscopic analysis of pathogen behavior revealed a requirement for CLF in both pre- and post-invasive non-host resistance. The loss of a functional SEPALLATA3 (SEP3) gene, ectopically expressed in clf mutant leaves, suppressed not only the defect of the clf plants in growth and leaf development but also a defect in non-host resistance against the non-adapted Colletotrichum tropicale. However, the ectopic overexpression of SEP3 in Arabidopsis wild-type leaves did not disrupt the non-host resistance. The expression of multiple plant defensin (PDF) genes that are involved in non-host resistance against C. tropicale was repressed in clf leaves. Moreover, the Octadecanoid-responsive Arabidopsis 59 (ORA59) gene, which is required for PDF expression, was also repressed in clf leaves. Notably, when SEP3 was overexpressed in the ora59 mutant background, C. tropicale produced clear lesions in the inoculated leaves, indicating an impairment in non-host resistance. Furthermore, ora59 plants overexpressing SEP3 exhibited a defect in leaf immunity to the adapted Colletotrichum higginsianum. Since the ora59 plants overexpressing SEP3 did not display obvious leaf curling or reduced growth, in contrast to the clf mutants, these results strongly suggest that concomitant SEP3 repression and ORA59 induction via CLF are required for Arabidopsis leaf immunity to Colletotrichum fungi, uncoupled from CLF's function in growth and leaf development.

A single amino acid residue substitution in BraA04g017190.3C, a histone methyltransferase, results in premature bolting in Chinese cabbage (Brassica rapa L. ssp. Pekinensis).

BACKGROUND: Flowering is an important inflection point in the transformation from vegetative to reproductive growth, and premature bolting severely decreases crop yield and quality. RESULTS: In this study, a stable early-bolting mutant, ebm3, was identified in an ethyl methanesulfonate (EMS)-mutagenized population of a Chinese cabbage doubled haploid (DH) line 'FT'. Compared with 'FT', ebm3 showed early bolting under natural cultivation in autumn, and curled leaves. Genetic analysis showed that the early-bolting phenotype was controlled by a single recessive nuclear gene. Modified MutMap sequencing, genotyping analyses and allelism test provide strong evidence that BrEBM3 (BraA04g017190.3 C), encoding the histone methyltransferase CURLY LEAF (CLF), was the strongly candidate gene of the emb3. A C to T base substitution in the 14th exon of BrEBM3 resulted in an amino acid change (S to F) and the early-bolting phenotype of emb3. The mutation occurred in the SET domain (Suppressor of protein-effect variegation 3-9, Enhancer-of-zeste, Trithorax), which catalyzes site- and state-specific lysine methylation in histones. Tissue-specific expression analysis showed that BrEBM3 was highly expressed in the flower and bud. Promoter activity assay confirmed that BrEBM3 promoter was active in inflorescences. Subcellular localization analysis revealed that BrEBM3 localized in the nucleus. Transcriptomic studies supported that BrEBM3 mutation might repress H3K27me3 deposition and activate expression of the AGAMOUS (AG) and AGAMOUS-like (AGL) loci, resulting in early flowering. CONCLUSIONS: Our study revealed that an EMS-induced early-bolting mutant ebm3 in Chinese cabbage was caused by a nonsynonymous mutation in BraA04g017190.3 C, encoding the histone methyltransferase CLF. These results improve our knowledge of the genetic and genomic resources of bolting and flowering, and may be beneficial to the genetic improvement of Chinese cabbage.

Polycomb repressive complex 2 attenuates ABA-induced senescence in Arabidopsis.

The phytohormone abscisic acid (ABA)-induced leaf senescence facilitates nutrient reuse and potentially contributes to enhancing plant stress tolerance. However, excessive senescence causes serious reductions in crop yield, and the mechanism by which senescence is finely tuned at different levels is still insufficiently understood. Here, we found that the double mutant of core enzymes of the polycomb repressive complex 2 (PRC2) is hypersensitive to ABA in Arabidopsis thaliana. To elucidate the interplay between ABA and PRC2 at the genome level, we extensively profiled the transcriptomic and epigenomic changes triggered by ABA. We observed that H3K27me3 preferentially targets ABA-induced senescence-associated genes (SAGs). In the double, but not single, mutant of PRC2 enzymes, these SAGs were derepressed and could be more highly induced by ABA compared with the wild-type, suggesting a redundant role for the PRC2 enzymes in negatively regulating ABA-induced senescence. Contrary to the rapid transcriptomic changes triggered by ABA, the reduction of H3K27me3 at these SAGs falls far behind the induction of their expression, indicating that PRC2-mediated H3K27me3 contributed to long-term damping of ABA-induced senescence to prevent an oversensitive response. The findings of this study may serve as a paradigm for a global understanding of the interplay between the rapid effects of a phytohormone such as ABA and the long-term effects of the epigenetic machinery in regulating plant senescence processes and environmental responses.

Dissecting the control of shoot development in grapevine: genetics and genomics identify potential regulators.

BACKGROUND: Grapevine is a crop of major economic importance, yet little is known about the regulation of shoot development in grapevine or other perennial fruits crops. Here we combine genetic and genomic tools to identify candidate genes regulating shoot development in Vitis spp. RESULTS: An F2 population from an interspecific cross between V. vinifera and V. riparia was phenotyped for shoot development traits, and three Quantitative Trait Loci (QTLs) were identified on linkage groups (LGs) 7, 14 and 18. Around 17% of the individuals exhibited a dwarfed phenotype. A transcriptomic study identified four candidate genes that were not expressed in dwarfed individuals and located within the confidence interval of the QTL on LG7. A deletion of 84,482 bp was identified in the genome of dwarfed plants, which included these four not expressed genes. One of these genes was VviCURLY LEAF (VviCLF), an orthologue of CLF, a regulator of shoot development in Arabidopsis thaliana. CONCLUSIONS: The phenotype of the dwarfed grapevine plants was similar to that of clf mutants of A. thaliana and orthologues of the known targets of CLF in A. thaliana were differentially expressed in the dwarfed plants. This suggests that CLF, a major developmental regulator in A. thaliana, also controls shoot development in grapevine.

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening.

BACKGROUND: Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. RESULTS: For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553-6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. CONCLUSIONS: SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

A noncoding RNA transcribed from the AGAMOUS (AG) second intron binds to CURLY LEAF and represses AG expression in leaves.

Dispersed H3K27 trimethylation (H3K27me3) of the AGAMOUS (AG) genomic locus is mediated by CURLY LEAF (CLF), a component of the Polycomb Repressive Complex (PRC) 2. Previous reports have shown that the AG second intron, which confers AG tissue-specific expression, harbors sequences targeted by several positive and negative regulators. Using RACE reverse transcription polymerase chain reaction, we found that the AG intron 2 encodes several noncoding RNAs. RNAi experiment showed that incRNA4 is needed for CLF repressive activity. AG-incRNA4RNAi lines showed increased leaf AG mRNA levels associated with a decrease of H3K27me3 levels; these plants displayed AG overexpression phenotypes. Genetic and biochemical analyses demonstrated that the AG-incRNA4 can associate with CLF to repress AG expression in leaf tissues through H3K27me3-mediated repression and to autoregulate its own expression level. The mechanism of AG-incRNA4-mediated repression may be relevant to investigations on tissue-specific expression of Arabidopsis MADS-box genes.

The Polycomb group protein CLF emerges as a specific tri-methylase of H3K27 regulating gene expression and development in Physcomitrella patens.

Packaging of eukaryotic DNA largely depends on histone modifications that affect the accessibility of DNA to transcriptional regulators, thus controlling gene expression. The Polycomb group (PcG) chromatin remodeling complex deposits a methyl group on lysine 27 of histone 3 leading to repressed gene expression. Plants encode homologs of the Enhancer of zeste (E(z)), a component of the PcG complex from Drosophila, one of which is a SET domain protein designated CURLY LEAF (CLF). Although this SET domain protein exhibits a strong correlation with the presence of the H3K27me3 mark in plants, the methyl-transferase activity and specificity of its SET domain have not been directly tested in-vivo. Using the evolutionary early-diverged land plant model species Physcomitrella patens we show that abolishment of a single copy gene PpCLF, as well as an additional member of the PcG complex, FERTILIZATION-INDEPENDENT ENDOSPERM (PpFIE), results in a specific loss of tri-methylation of H3K27. Using site-directed mutagenesis of key residues, we revealed that H3K27 tri-methylation is mediated by the SET domain of the CLF protein. Moreover, the abolishment of H3K27me3 led to enhanced expression of transcription factor genes. This in turn led to the development of fertilization-independent sporophyte-like structures, as observed in PpCLF and PpFIE null mutants. Overall, our results demonstrate the role of PpCLF as a SET protein in tri-methylation of H3K27 in-vivo and the importance of this modification in regulating the expression of transcription factor genes involved in developmental programs of P. patens.

Anti-hemostatic, antithrombotic, and chemical profiles of a curly-leaf variety of Petroselinum crispum (Apiaceae), a food and medicinal aromatic herb.

Thrombosis is currently among the major causes of morbidity and mortality in the World. New prevention and therapy alternatives have been increasingly sought in medicinal plants. In this context, we have been investigating parsley, Petroselinum crispum (Mill.) Nym, an aromatic herb with two leaf varieties. We report here the in vitro, in vivo, and ex vivo anti-hemostatic and antithrombotic activities of a parsley curly-leaf variety. Aqueous extracts of aerial parts (PCC-AP), stems (PCC-S), and leaves (PCC-L) showed significant in vitro antiplatelet activity. PCC-AP extract exhibited the highest activity (IC50 2.92 mg/mL) when using ADP and collagen as agonists. All extracts also presented in vitro anticoagulant activity (APTT and PT) and anti-thrombogenic activity. PCC-S was the most active, with more significant interference in the factors of the intrinsic coagulation pathway. The oral administration of PCC-AP extract in rats caused a greater inhibitory activity in the deep vein thrombi (50%; 65 mg/kg) than in arterial thrombi formation (50%; 200 mg/kg), without cumulative effect after consecutive five-day administration. PCC-AP extract was safe in the induced bleeding time test. Its anti-aggregating profile was similar in ex vivo and in vitro conditions but was more effective in the extrinsic pathway when compared to in vitro results. Apiin and coumaric acid derivatives are the main compounds in PCC-AP according to the HPLC-DAD-ESI-MS/MS profile. We demonstrated for the first time that extracts from different parts of curly parsley have significant antiplatelet, anticoagulant, and antithrombotic activity without inducing hemorrhage, proving its potential as a source of antithrombotic compounds.

Transcriptomic and epigenomic analyses revealed that polycomb repressive complex 2 regulates not only developmental but also stress responsive metabolism in Brassica rapa.

Polycomb group proteins (PcG) play a crucial role in developmental programs in eukaryotic organisms, including plants. PcG-mediated gene repression is achieved by epigenetic histone modification on target chromatins. Loss of PcG components leads to severe developmental defects. CURLY LEAF (CLF), a PcG component in Arabidopsis, catalyzes the trimethylation of histone H3 on lysine 27 (H3K27me3), a repressive histone mark in numerous genes in Arabidopsis. In this study, we isolated a single homolog of Arabidopsis CLF, namely, BrCLF, in Brassica rapa ssp. trilocularis. Transcriptomic analysis revealed that BrCLF participated in B. rapa developmental processes, such as seed dormancy, leaf and flower organ development, and floral transition. BrCLF was also involved in stress signaling and stress-responsive metabolism, such as aliphatic and indolic glucosinolate metabolism in B. rapa. Epigenome analysis showed that H3K27me3 was substantially enriched in genes related to these developmental and stress-responsive processes. Thus, this study provided a basis for elucidating the molecular mechanism of the PcG-mediated regulation of development and stress responses in B. rapa.

EYFP fusions to HD-Zip IV transcription factors enhance their stability and lead to phenotypic changes in Arabidopsis.

Green fluorescent protein (GFP) and its derivatives are extensively used for labeling cells, monitoring gene expression and/or tracking the localization or interactions of proteins. Previous reports of detrimental effects of fluorescent protein (FP) expression include cytotoxicity and interference with fusion protein function or localization. Only a few studies have documented the fluorescent tag-specific effects in plants. Here, we show that placing an enhanced yellow FP (EYFP) tag on the amino-terminus of GLABRA2 (GL2) and PROTODERMAL FACTOR2 (PDF2), two developmentally important HD-Zip IV transcription factors from Arabidopsis, enhances their protein stability. Additionally, expression of EYFP:GL2 not only rescued the gl2 null mutant but also resulted in the abnormal development of abaxially curled leaves associated with EYFP-tag induced GL2 overexpression. Our study raises concerns on the use of FPs regarding their effects on the native properties of target proteins as well as biological consequences of fusion protein expression on morphology.

CURLY LEAF Regulates MicroRNA Activity by Controlling ARGONAUTE 1 Degradation in Plants.

CURLY LEAF (CLF) encodes the methyltransferase subunit of the Polycomb Repressor Complex 2 (PRC2), which regulates the expression of target genes through H3K27 trimethylation. We isolated a new CLF mutant allele (clf-78) using a genetic screen designed to identify microRNA (miRNA) deficient mutants. CLF mutant plants showed impaired miRNA activity caused by increased ubiquitination and enhanced degradation of ARGONAUTE 1 (AGO1) in specific tissues. Such CLF-mediated AGO1 regulation was evident when plants were exposed to UV radiation, which caused increased susceptibility of clf mutants to some UV-induced responses. Furthermore, we showed that CLF directly regulates FBW2, which in turn triggers AGO1 degradation in the clf mutants. Interestingly, AGO1 bound to a target appeared particularly prone to degradation in the mutant plants, a process that was exacerbated when the complex bound a non-cleavable target. Thus, prolonged AGO1-target interaction seems to favor AGO1 degradation, suggesting that non-cleavable miRNA targets may overcome translation inhibition by modulating AGO1 stability in plants.

Genome-wide occupancy of histone H3K27 methyltransferases CURLY LEAF and SWINGER in Arabidopsis seedlings.

The Polycomb Group (PcG) proteins form two protein complexes, PcG Repressive Complex 1 (PRC1) and PRC2, which are key epigenetic regulators in eukaryotes. PRC2 represses gene expression by catalyzing the trimethylation of histone H3 lysine 27 (H3K27me3). In Arabidopsis (Arabidopsis thaliana), CURLY LEAF (CLF) and SWINGER (SWN) are two major H3K27 methyltransferases and core components of PRC2, playing essential roles in plant growth and development. Despite their importance, genome-wide binding profiles of CLF and SWN have not been determined and compared yet. In this study, we generated transgenic lines expressing GFP-tagged CLF/SWN under their respective native promoters and used them for ChIP-seq analyses to profile the genome-wide distributions of CLF and SWN in Arabidopsis seedlings. We also profiled and compared the global H3K27me3 levels in wild-type (WT) and PcG mutants (clf, swn, and clf swn). Our data show that CLF and SWN bind to almost the same set of genes, except that SWN has a few hundred more targets. Two short DNA sequences, the GAGA-like and Telo-box-like motifs, were found enriched in the CLF and SWN binding regions. The H3K27me3 levels in clf, but not in swn, were markedly reduced compared with WT; and the mark was undetectable in the clf swn double mutant. Further, we profiled the transcriptomes in clf, swn, and clf swn, and compared that with WT. Thus this work provides a useful resource for the plant epigenetics community for dissecting the functions of PRC2 in plant growth and development.

Dysfunctional mitochondria regulate the size of root apical meristem and leaf development in Arabidopsis.

Mitochondria play an important role in maintaining metabolic and energy homeostasis in the plant cell. Thus, perturbation of mitochondrial structure and function will affect plant growth and development. Arabidopsis slow growth3 (slo3) is defective in At3g61360 that encodes a pentatricopeptide repeat (PPR) protein. Analysis of slo3 mitochondrial RNA metabolism revealed that the splicing of nad7 intron 2 is impaired, which leads to a dramatic reduction in complex I activity. So the SLO3 PPR protein is a splicing factor that is required for the removal of nad7 intron 2 in Arabidopsis. The slo3 mutant plants have obvious phenotypes with severe growth retardation and delayed development. The size of root apical meristem (RAM) is reduced and the production of meristem cells is decreased in slo3. Furthermore, the rosette leaves of slo3 are curled or crinkled, which may be derived from uneven growth of the leaf surface. The underlying mechanisms by which dysfunctional mitochondria affect these growth and developmental phenotypes have yet to be established. Nonetheless, plant hormone auxin is known to play an important role in orchestrating the development of RAM and leaf shape. It is possible that dysfunctional mitochondria may interact with auxin signaling pathways to regulate the boundary of RAM and the cell division arrest front during leaf growth in Arabidopsis.