White yam (Dioscorea rotundata) plants exhibiting virus-like symptoms are co-infected with a new potyvirus and a new crinivirus in Ethiopia.

White yam (Dioscorea rotundata) plants collected from farmers' fields and planted at the Areka Agricultural Research Center, Southern Ethiopia, displayed mosaic, mottling, and chlorosis symptoms. To determine the presence of viral pathogens, an investigation for virome characterization was conducted by Illumina high-throughput sequencing. The bioinformatics analysis allowed the assembly of five viral genomes, which according to the ICTV criteria were assigned to a novel potyvirus (3 genome sequences) and a novel crinivirus (2 genome sequences). The potyvirus showed ~ 66% nucleotide (nt) identity in the polyprotein sequence to yam mosaic virus (NC004752), clearly below the demarcation criteria of 76% identity. For the crinivirus, the RNA 1 and RNA 2 shared the highest sequence identity to lettuce chlorosis virus, and alignment of the aa sequence of the RdRp, CP and HSP70h (~ 49%, 45% and 76% identity), considered for the demarcation criteria, revealed the finding of a novel virus species. The names Ethiopian yam virus (EYV) and Yam virus 1 (YV-1) are proposed for the two tentative new virus species.

Leucine 127 of Cucurbit Chlorotic Yellows Virus P22 Is Crucial for Its RNA Silencing Suppression Activity and Pathogenicity.

Plant viruses produce particular suppressors to antagonize the host defense response of RNA silencing to establish infection. Cucurbit chlorotic yellows virus (CCYV), a member of the genus Crinivirus of the family Closteroviridae, severely damages the production of economically essential cucurbits worldwide. Here, we used the attenuated zucchini yellow mosaic virus (ZYMV) vector ZAC to express individual coding sequences, including CP, CPm, P25, and P22, of a Taiwan CCYV isolate (CCYV-TW) to identify their possible roles as pathogenicity determinants. ZAC is an HC-Pro function mutant that lacks the ability of local lesion induction on Chenopodium quinoa leaves and induces mild mottling followed by recovery on its natural host zucchini squash plants. Only the recombinant expressing CCYV-TW P22 complemented the effect of ZAC HC-Pro dysfunction, causing more severe symptoms on zucchini squash plants and restoring lesion formation on C. quinoa leaves, with lesions forming faster than those generated by the wild-type ZYMV. This suggests that CCYV-TW P22 is a virulence enhancer. Sequence analysis of criniviral P22s revealed the presence of four conserved leucine residues (L10, L17, L84, and L127) and one conserved lysine residue (K185). The five P22 residues conserved among the CCYV isolates and the P22 orthologs of two other criniviruses were each substituted with alanine in CCYV-TW P22 to investigate its ability to suppress RNA silencing and pathogenicity. The results provide new insights into CCYV-P22, showing that the L127 residue of P22 is indispensable for maintaining its stability in RNA silencing suppression and essential for virulence enhancement.

Crinivirus Tomato Chlorosis Virus Compromises the Control of Tomato Yellow Leaf Curl Virus in Tomato Plants by the Ty-1 Gene.

Tomato yellow leaf curl disease (TYLCD) causes severe damage to tomato crops in warm regions of the world, and is associated with infections of several whitefly (Bemisia tabaci)-transmitted single-stranded (ss)DNA begomoviruses (genus Begomovirus, family Geminiviridae). The most widespread begomovirus isolates associated with TYLCD are those of the type strain of the Tomato yellow leaf curl virus species, known as Israel (TYLCV-IL). The Ty-1 gene is widely used in commercial tomato cultivars to control TYLCV-IL damage, providing resistance to the virus by restricting viral accumulation and tolerance to TYLCD by inhibiting disease symptoms. However, several reports suggest that TYLCV-IL-like isolates are adapting to the Ty-1 gene and are causes of concern for possibly overcoming the provided control. This is the case with TYLCV-IL IS76-like recombinants that have a small genome fragment acquired by genetic exchange from an isolate of Tomato yellow leaf curl Sardinia virus, another begomovirus species associated with TYLCD. Here we show that TYLCV-IL IS76-like isolates partially break down the TYLCD-tolerance provided by the Ty-1 gene and that virulence differences might exist between isolates. Interestingly, we demonstrate that mixed infections with an isolate of the crinivirus (genus Crinivirus, family Closteroviridae) species Tomato chlorosis virus (ToCV), an ssRNA virus also transmitted by B. tabaci and emerging worldwide in tomato crops, boosts the breakdown of the TYLCD-tolerance provided by the Ty-1 gene either with TYLCV-IL IS76-like or canonical TYLCV-IL isolates. Moreover, we demonstrate the incorporation of the Ty-2 gene in Ty-1-commercial tomatoes to restrict (no virus or virus traces, no symptoms) systemic infections of recombinant TYLCV-IL IS76-like and canonical TYLCV-IL isolates, even in the presence of ToCV infections, which provides more robust and durable control of TYLCD.

Molecular insights on potato yellow vein crinivirus infections in the highlands of Colombia.

Potato yellow vein virus (PYVV) was detected in potatoes grown in the Central highlands, north of Bogotá (~3000 m altitude), Colombia. At this altitude viral whitefly vectors are largely absent, but infection persists because of the use of uncertified tubers. Plants with typical PYVV-induced yellowing symptoms, as well as with atypical yellowing or non-symptomatic symptoms were sampled at three separate geographical locations. PYVV presence was assessed by RT-PCR, and several plants were subjected to high-throughput sequencing (HTS) of their small RNA (sRNA) populations. Complete or almost complete sequences of four PYVV isolates were thus reconstructed, all from symptomatic plants. Three viral isolates infected plants singly, while the fourth co-infected the plant together with a potyvirus. Relative proportions of sRNAs to each of the three crinivirus genomic RNAs were found to remain comparable among the four infections. Genomic regions were identified as hotspots of sRNA formation, or as regions that poorly induced sRNAs. Furthermore, PYVV titres in the mixed versus single infections remained comparable, indicating an absence of synergistic/antagonistic effects of the potyvirus on the accumulation of PYVV. Daughter plants raised in the greenhouse from tubers of the infected, field-sampled plants displayed mild PYVV infection symptoms that disappeared with time, demonstrating the occurrence of recovery and asymptomatic infection phenotypes in this pathosystem.

Plasticity of the lettuce infectious yellows virus minor coat protein (CPm) in mediating the foregut retention and transmission of a chimeric CPm mutant by whitefly vectors.

Transmission of the crinivirus, lettuce infectious yellows virus (LIYV), is determined by a minor coat protein (CPm)-mediated virion retention mechanism located in the foregut of its whitefly vector. To better understand the functions of LIYV CPm, chimeric CPm mutants engineered with different lengths of the LIYV CPm amino acid sequence and that of the crinivirus, lettuce chlorosis virus (LCV), were constructed based on bioinformatics and sequence alignment data. The 485 amino acid-long chimeric CPm of LIYV mutant, CPmP-1, contains 60 % (from position 3 to 294) of LCV CPm amino acids. The chimeric CPm of mutants CPmP-2, CPmP-3 and CPmP-4 contains 46 (position 3 to 208), 51 (position 3 to 238) and 41 % (position 261 to 442) of LCV CPm amino acids, respectively. All four mutants moved systemically, expressed the chimeric CPm and formed virus particles. However, following acquisition feeding of the virus preparations, only CPmP-1 was retained in the foreguts of a significant number of vectors and transmitted. In immuno-gold labelling transmission electron microscopy (IGL-TEM) analysis, CPmP-1 particles were distinctly labelled by antibodies directed against the LCV but not LIYV CPm. In contrast, CPmP-4 particles were not labelled by antibodies directed against the LCV or LIYV CPm, while CPmP-2 and -3 particles were weakly labelled by anti-LIYV CPm but not anti-LCV CPm antibodies. The unique antibody recognition and binding pattern of CPmP-1 was also displayed in the foreguts of whitefly vectors that fed on CPmP-1 virions. These results are consistent with the hypothesis that the chimeric CPm of CPmP-1 is incorporated into functional virions, with the LCV CPm region being potentially exposed on the surface and accessible to anti-LCV CPm antibodies.

Tomato chlorosis virus-encoded p22 suppresses auxin signalling to promote infection via interference with SKP1-Cullin-F-boxTIR1 complex assembly.

Phytohormone auxin plays a fundamental role in plant growth and defense against pathogens. However, how auxin signalling is regulated during virus infection in plants remains largely unknown. Auxin/indole-3-acetic acid (Aux/IAA) is the repressor of auxin signalling and can be recognized by an F-box protein transport inhibitor response 1 (TIR1). Ubiquitination and degradation of Aux/IAA by SKP1-Cullin-F-boxTIR1 (SCFTIR1 ) complex can trigger auxin signalling. Here, with an emerging important plant virus worldwide, we showed that tomato chlorosis virus (ToCV) infection or stable transgenic overexpression of its p22 protein does not alter auxin accumulation level but significantly decreases the expression of auxin signalling-responsive genes, suggesting that p22 can attenuate host auxin signalling. Further, p22 could bind the C-terminal of SKP1.1 and compete with TIR1 to interfere with the SCFTIR1 complex assembly, leading to a suppression of Aux/IAA degradation. Silencing and over-expression assays suggested that both NbSKP1.1 and NbTIR1 suppress ToCV accumulation and disease symptoms. Altogether, ToCV p22 disrupts the auxin signalling through destabilizing SCFTIR1 by interacting with the C-terminal of NbSKP1.1 to promote ToCV infection. Our findings uncovered a previously unknown molecular mechanism employed by a plant virus to manipulate SCF complex-mediated ubiquitin pathway and to reprogram auxin signalling for efficient infection.

First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA.

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California.

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

Natural Infection Rate of Known Tomato chlorosis virus-Susceptible Hosts and the Influence of the Host Plant on the Virus Relationship With Bemisia tabaci MEAM1.

Tomato chlorosis virus (ToCV; genus Crinivirus, family Closteroviridae) was identified in tomato crops in São Paulo State, Brazil, in 2006. Management strategies to control external sources of inoculum are necessary, because chemical control of the whitefly vector Bemisia tabaci Middle East-Asia Minor 1 (MEAM1) has not efficiently prevented virus infections and no commercial tomato varieties or hybrids are resistant to this crinivirus. We first evaluated the natural infection rate of some known wild and cultivated ToCV-susceptible hosts and their attractiveness for B. tabaci MEAM1 oviposition. Physalis angulata was the most susceptible to natural infection in all six exposures in 2018 and 2019. No plants of Capsicum annuum 'Dahra' or Chenopodium album became infected. Solanum melongena 'Napoli' had only two infected plants of 60 exposed. Capsicum annuum and Chenopodium album were the least preferred, and Nicotiana tabacum and S. melongena were the most preferred for whitefly oviposition. In addition, from 2016 to 2019, we surveyed different tomato crops and the surrounding vegetation to identify ToCV in weeds and cultivated plants in the region of Sumaré, São Paulo State. Only S. americanum, vila vila (S. sisymbriifolium), and Chenopodium album were found naturally infected, with incidences of 18, 20, and 1.4%, respectively. Finally, we estimated the ToCV titer (U.S. and Brazilian isolates ToCV-FL and ToCV-SP, respectively) by quantitative reverse transcription PCR in different ToCV-susceptible host plants and evaluated the relationship between virus acquisition and transmission by B. tabaci MEAM1. The results clearly showed significant differences in ToCV concentrations in the tissues of ToCV-susceptible host plants, which appeared to be influenced by the virus isolate. The concentration of the virus in plant tissues, in turn, directly influenced the ToCV-B. tabaci MEAM1 relationship and subsequent transmission to tomato plants. To minimize or prevent damage from tomato yellowing disease through management of external sources of ToCV, it is necessary to correctly identify potentially important ToCV-susceptible hosts in the vicinity of new plantings.

Interplay of Cucurbit Yellow Stunting Disorder Virus With Cucurbit Chlorotic Yellows Virus and Transmission Dynamics by Bemisia tabaci MED.

Cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) are two closely related criniviruses that often coinfect cucurbits and are associated with cucurbit yellows disease. Both viruses are distributed worldwide and are transmitted in a semipersistent manner by the whitefly vectors Bemisia tabaci MED or MEAM1. The major goal of this study was to provide insight into the interaction of CCYV and CYSDV in cucumber and to study the effect on transmission by B. tabaci MED. The titers of both viruses were estimated in single- and dually infected cucumber plants via reverse transcription PCR assays. In mixed infections, the accumulation of both viruses was significantly decreased. When B. tabaci MED adults were placed on cucumber infected with both viruses, their simultaneous transmission efficiency was significantly higher, whereas transmission efficiency of each individual virus was low. Moreover, nonviruliferous whiteflies preferentially settled on crinivirus-infected cucumber plants, whereas viruliferous whiteflies were attracted by healthy cucumber plants. Finally, the titer of both viruses was calculated in five commercial cucumber hybrids, followed by subsequent transmission experiments. Our results show that although the titers of CYSDV and CCYV were significantly lower in mixed infections in cucumbers, their simultaneous transmission increased.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

First report of Cucurbit chlorotic yellows virus infecting cantaloupe (Cucumis melo L.) in Texas.

Texas is a major producer of cucurbits such as cantaloupe (Cucumis melo L.), but outbreaks of virus-like diseases often adversely affect yields. Little is known about the identity of the causal or associated viruses. During studies conducted in fall 2020 to explore the virome of cucurbit fields in Texas, a commercial cantaloupe field (~4.1 ha) in Cameron County was observed with virus-like symptoms of interveinal chlorotic mottle and foliar chlorosis and disease incidence was estimated at 100%. Virus-like symptoms including mosaic and leaf curl were also observed in six additional fields across five south and central Texas counties of Atascosa, Hidalgo, Fort Bend, Frio, and Wharton. Forty-six plants, which included 32 symptomatic and 14 non-symptomatic, were sampled from these fields for virus diagnosis and each sample was subjected to total nucleic acid extraction according to Dellaporta et. al. (1983). Initially, equal amounts of nucleic acids from 14 symptomatic plants (two/field) were pooled into one composite sample for preliminary diagnosis by high throughput sequencing (HTS). The cDNA library obtained from the composite sample with a TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina) was sequenced on the Illumina NextSeq 500 platform, generating ~26.3 M single-end HTS reads (75 nucleotides [nt] each). Analyses of the reads according to Al Rwahnih et al. (2018) revealed several virus-like contigs; among them 23 contigs (206 to 741 nt) shared 98 to 100% nt identities to isolates of cucurbit chlorotic yellows virus (CCYV), genus Crinivirus, family Closteroviridae. Three pairs of CCYV-specific primers were designed from the HTS contigs with primers CCYV-v1330: 5'-AGTCCCTTACCCTGAGATGAA/CCYV-c2369: 5'-CGGAGCATTCGACAACTGAATA targeting ~1 kb fragment of the ORF1a (RNA1), primers CCYV-v4881: 5'-ATAAGGCGGCGACCTAATC/CCYV-c5736: 5'-GATCACTTGACCATCTCCTTCT targeting a ~0.9 kb fragment encompassing the coat protein (CP) cistron of CCYV (RNA2), and primers CCYV-v6362: 5'-CACCTCTTCCAGAACCAGTTAAA/CCYV-c7423: 5'-TGGGAACAACTTATTTCTCCTAGC targeting ~1 kb spanning partial minor coat protein (CPm) and p26 sequences (RNA2). Total nucleic acid extracts of each of the 46 samples from the seven fields were tested by two-step reverse transcription polymerase chain reaction using all three CCYV-specific primer pairs and they yielded amplicons of expected sizes from all five symptomatic cantaloupe samples from the Cameron County field and one additional symptomatic butternut squash sample from a field in Hidalgo County. The DNA bands from three randomly chosen cantaloupe samples were cloned and sequenced as previously described (Oke et al. 2020). In pairwise comparisons, the obtained 1,040 nt ORF1a (MW584332-334), 753 nt complete CP (MW584335-337), and 1,062 nt CPm/p26 (MW584338-340) gene specific sequences from the three samples shared 100% nt identity with each other, and 99-100% nt identities with corresponding RNA1 (AB523788) and RNA2 (AB523788) sequences of the exemplar isolate of CCYV. This is the first report of CCYV in Texas, thus expanding the current geographical range of the virus in the U.S. that includes California (Wintermantel et al. 2019) and Georgia (Kavalappara et al. 2021). The abundance of whiteflies of the Bemisia tabaci species complex in south Texas and other major U.S. cucurbit production areas presents additional challenges to virus disease management.

First Report of Cucurbit chlorotic yellows virus infecting Cucumber Plants in Spain.

During the winter 2018, symptoms of leaf chlorotic spots (Figure 1) followed by symptoms of leaf interveinal chlorosis (Figure 2) and severe chlorosis in basal leaves were observed in cucumber cv Laredo (Cucumis sativus) plants in three separated greenhouses, sited in distinct locations in southern Spain. In all cases, Bemisia tabaci populations were observed on infected plants. The symptomology observed was similar to that caused by whitefly transmitted Cucurbit yellow stunting disorder virus (CYSDV, genus Crinivirus, family Closteroviridae), which is usually found infecting cucumber plants in this geographical area (1). Samples from four different cucumber plants of distinct greenhouses were collected and tested for the presence of CYSDV. Total RNA was extracted from the samples using the NucleoSpin RNA Plant kit (Macherey-Nagel, Germany). Molecular detection of CYSDV was performed using the multiplex and degenerate primer RT-PCR method (2), specific to the region of the highly conserved RNA-dependent RNA polymerase (RdRp) gene of criniviruses, which also detects other criniviruses such as Lettuce infectious yellows virus (LIYV) and Beet pseudo-yellows virus (BPYV). Results indicated that the viral species CYSDV, LIYV and BPYV were not detected in the four cucurbit plant samples. In 2004, an emergent crinivirus (Cucurbit chlorotic yellows virus, CCYV), inducing symptoms similar to those caused by CYSDV, was described infecting cucurbits in Japan (3). Recently, CCYV was detected in 2011 in Greece (4) and in 2014 in Egypt (5) and Saudi Arabia (6). Therefore, the four RNA samples were tested for the presence of the CCYV by a RT-PCR method previously described (7). Specific primers were designed to amplify 336 nt of the capsid protein (CP) gene and 680 nt of the RdRp gene, located on CCYV genomic RNA 1 and RNA 2, respectively. In all cases, clear cDNA bands of both expected sizes were detected for each cucumber sample that were then purified and sequenced via Sanger technology. BLAST analysis of those sequences showed 99% identity with the nucleotide sequence of the CP and RpRd genes from the CCYV isolates from Greece (LT992911, LT992910), China (KY400633.1, KX118632) and Taiwan (JF502222). To our knowledge, this is the first report of CCYV infecting cucurbits in Spain. Probably CCYV has been spread throughout the Mediterranean basin, remaining undetected due to the yellowing symptom similarities between CYSDV and CCYV. Detection of the emergent virus CCYV in Spain represents a new threat for the horticultural area of southern Europe.

Impacts of Cucurbit Chlorotic Yellows Virus (CCYV) on Biological Characteristics of Its Vector Bemisia tabaci (Hemiptera: Aleyrodidae) MED Species.

Plant viruses can change the phenotypes and defense pathways of the host plants and the performance of their vectors to facilitate their transmission. Cucurbit chlorotic yellows virus (CCYV) (Crinivirus), a newly reported virus occurring on cucurbit plants and many other plant species, is transmitted specifically by Bemisia tabaci MEAM1 (B biotype) and MED (Q biotype) cryptic species in a semipersistent manner. This study evaluated the impacts of CCYV on B. tabaci to better understand the plant-virus-vector interactions. By using CCYV-B. tabaci MED-cucumber as the model, we investigated whether or how a semipersistent plant virus impacts the biology of its whitefly vector. CCYV mRNAs were detectable in nymphs from first to fourth instars and adults of B. tabaci with different titers. Nymph instar durations and adult longevity of female whiteflies greatly extended on CCYV-infected plants, but nymph instar durations and adult longevity of male whiteflies were not significantly influenced. In addition, the body length and oviposition increased in adults feeding on CCYV-infected plants, but the hatching rates of eggs and survival rates of different stages were not affected. Most interestingly, the sex ratio (male:female) significantly reduced to 0.5:1 in whitefly populations on CCYV-infected plants, while the ratio remained about 1:1 on healthy plants. These results indicated that CCYV can significantly impact the biological characteristics of its vector B. tabaci. It is speculated that CCYV and B. tabaci have established a typical mutualist relationship mediated by host plants.

Storage Root Yield of Sweetpotato as Influenced by Sweetpotato leaf curl virus and Its Interaction With Sweetpotato feathery mottle virus and Sweetpotato chlorotic stunt virus in Kenya.

In this study, the effect of a Kenyan strain of Sweetpotato leaf curl virus (SPLCV) and its interactions with Sweetpotato feathery mottle virus (SPFMV) and Sweetpotato chlorotic stunt virus (SPCSV) on root yield was determined. Trials were performed during two seasons using varieties Kakamega and Ejumula and contrasting in their resistance to sweetpotato virus disease in a randomized complete block design with 16 treatments replicated three times. The treatments included plants graft inoculated with SPLCV, SPFMV, and SPCSV alone and in possible dual or triple combinations. Yield and yield-related parameters were evaluated at harvest. The results showed marked differences in the effect of SPLCV infection on the two varieties. Ejumula, which is highly susceptible to SPFMV and SPCSV, suffered no significant yield loss from SPLCV infection, whereas Kakamega, which is moderately resistant to SPFMV and SPCSV, suffered an average of 47% yield loss from SPLCV, despite only mild symptoms occurring in both varieties. These results highlight the variability in yield response to SPLCV between sweetpotato cultivars as well as a lack of correlation of SPLCV-related symptoms with yield reduction. In addition, they underline the lack of correlation between resistance to the RNA viruses SPCSV and SPFMV and the DNA virus SPLCV.[Formula: see text] Copyright © 2020 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

A Description of the Possible Etiology of the Cilantro Yellow Blotch Disease.

A virus-like disease characterized by foliar yellow blotch symptoms and resembling those described for cilantro yellow blotch disease in California was observed in a 4.05-ha cilantro (Coriandrum sativum) cv. Santo field in Hidalgo County, Texas during spring 2019. Disease incidence at harvest was estimated at ∼20%, and the affected plants were rendered unmarketable. Foliar systemic chlorosis symptoms were observed on sap-inoculated Nicotiana occidentalis plants (n = 3) using inocula from symptomatic cilantro. Total RNA aliquots from 11 randomly collected leaf tissue samples (symptomatic = 7, asymptomatic = 4) were pooled into a composite cilantro RNA sample which was analyzed by high throughput sequencing (HTS). Analyses of the obtained 15.7 million raw reads (76 nt each) yielded virus-specific contigs that mapped to the genomes of alfalfa mosaic virus (AMV), beet pseudoyellows virus (BPYV), and lettuce chlorosis virus (LCV). Virus-specific primers designed from the HTS-derived sequences were used to screen the samples in two-step RT-PCR assays, resulting in the detection of AMV+BPYV in 3 of 7 symptomatic cilantro samples, AMV+LCV in 4 of 7 symptomatic cilantro samples, and AMV alone in the 4 asymptomatic cilantro and sap-inoculated N. occidentalis samples. The results represent the first reports of the natural infection of cilantro by BPYV and LCV and implicate the mixed infection of a Crinivirus and AMV in cilantro yellow blotch disease.

Differences in gene expression in whitefly associated with CYSDV-infected and virus-free melon, and comparison with expression in whiteflies fed on ToCV- and TYLCV-infected tomato.

BACKGROUND: Cucurbit yellow stunting disorder virus (CYSDV; genus Crinivirus, Closteroviridae) is transmitted in a semipersistent manner by the whitefly, Bemisia tabaci, and is efficiently transmitted by the widely prevalent B. tabaci cryptic species, MEAM1. In this study, we compared transcriptome profiles of B. tabaci MEAM1, after 24 h, 72 h and 7 days of acquisition feeding on melon plants infected with CYSDV (CYSDV-whiteflies) with those fed on virus-free melon, using RNA-Seq technology. We also compared transcriptome profiles with whiteflies fed on tomato plants separately infected with Tomato chlorosis virus (ToCV), a crinivirus closely related to CYSDV, and Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus, which has a distinctly different mode of transmission and their respective virus-free controls, to find common gene expression changes among viruliferous whiteflies feeding on different host plants infected with distinct (TYLCV) and related (CYSDV and ToCV) viruses. RESULTS: A total of 275 differentially expressed genes (DEGs) were identified in CYSDV-whiteflies, with 3 DEGs at 24 h, 221 DEGs at 72 h, and 51 DEGs at 7 days of virus acquisition. Changes in genes encoding orphan genes (54 genes), phosphatidylethanolamine-binding proteins (PEBP) (20 genes), and AAA-ATPase domain containing proteins (10 genes) were associated with the 72 h time point. Several more orphan genes (20 genes) were differentially expressed at 7 days. A total of 59 common DEGs were found between CYSDV-whiteflies and ToCV-whiteflies, which included 20 orphan genes and 6 lysosomal genes. A comparison of DEGs across the three different virus-host systems revealed 14 common DEGs, among which, eight showed similar and significant up-regulation in CYSDV-whiteflies at 72 h and TYLCV-whiteflies at 24 h, while down-regulation of the same genes was observed in ToCV-whiteflies at 72 h. CONCLUSIONS: Dynamic gene expression changes occurred in CYSDV-whiteflies after 72 h feeding, with decreased gene expression changes associated with 7 days of CYSDV acquisition. Similarities in gene expression changes among CYSDV-whiteflies, ToCV-whiteflies and TYLCV-whiteflies suggest the possible involvement of common genes or pathways for virus acquisition and transmission by whiteflies, even for viruses with distinctly different modes of transmission.

Cucurbit chlorotic yellows virus p22 is a suppressor of local RNA silencing.

RNA silencing is a major antiviral mechanism in plants, which is counteracted by virus-encoded proteins with silencing suppression activity. ORFs encoding putative silencing suppressor proteins that share no structural or sequence homology have been identified in the genomes of four criniviruses. In this study, we investigated the RNA silencing suppression activity of several proteins encoded by the RNA1 (RdRp, p22) and RNA2 (CP, CPm and p26) of cucurbit chlorotic yellows virus (CCYV) using co-agroinfiltration assays on Nicotiana benthamiana plants. Our results indicate that p22 is a suppressor of local RNA silencing that does not interfere with cell-to-cell movement of the RNA silencing signal or with systemic silencing. Furthermore, comparisons of the suppression activity of CCYV p22 with that of two other well-known crinivirus suppressors (CYSDV p25 and ToCV p22) revealed that CCYV p22 is a weaker suppressor of local RNA silencing than the other two proteins. Finally, a comparative sequence analysis of the p22 genes of seven Greek CCYV isolates was performed, revealing a high level of conservation. Taken together, our research advances our knowledge about plant-virus interactions of criniviruses, an emergent group of pathogens that threatens global agriculture.

Expanding Knowledge of the Host Range of Tomato chlorosis virus and Host Plant Preference of Bemisia tabaci MEAM1.

The crinivirus Tomato chlorosis virus (ToCV) is often found infecting tomato crops in Brazil, with variable incidence, but associated with prevalence of its primary vector, Bemisia tabaci MEAM1. ToCV control is difficult because there are no resistant commercial tomato varieties or hybrids available and chemical spray for control of the whitefly vector has not been effective. The present study evaluated the partial host range of a Brazilian isolate of ToCV and the preference of B. tabaci MEAM1 for oviposition on those species identified as susceptible to the virus. Subsequently, transmission tests were performed using plants of each ToCV host species as sources of inoculum to elucidate the epidemiological importance of nontomato sources of inoculum for infection of tomato. Among 80 species experimentally inoculated, 25 were susceptible, including 6 previously not known to be hosts (Jaltomata procumbens, Physalis pruinosa, Solanum aculeatissimum, S. viarum, Beta vulgaris var. cicla, and Chenopodium quinoa). Preference of whitefly for oviposition and infection by ToCV under free-choice transmission tests varied among the susceptible species. When ToCV-infected tomato, eggplant, and C. quinoa were used separately as sources of inoculum for virus transmission to tomato plants, mean percentages of infected plants were 76.6, 3, and 0%, respectively. Average oviposition of Bemisia tabaci on these three hosts were 2.7, 10.6, and 0.0 eggs/cm2, respectively. Additional studies will be necessary to evaluate the importance of ToCV host plants under field conditions and their efficiency as sources of inoculum for virus acquisition and transmission to tomato crops.

Transcriptome analysis of the whitefly, Bemisia tabaci MEAM1 during feeding on tomato infected with the crinivirus, Tomato chlorosis virus, identifies a temporal shift in gene expression and differential regulation of novel orphan genes.

BACKGROUND: Whiteflies threaten agricultural crop production worldwide, are polyphagous in nature, and transmit hundreds of plant viruses. Little is known how whitefly gene expression is altered due to feeding on plants infected with a semipersistently transmitted virus. Tomato chlorosis virus (ToCV; genus Crinivirus, family Closteroviridae) is transmitted by the whitefly (Bemisia tabaci) in a semipersistent manner and infects several globally important agricultural and ornamental crops, including tomato. RESULTS: To determine changes in global gene regulation in whiteflies after feeding on tomato plants infected with a crinivirus (ToCV), comparative transcriptomic analysis was performed using RNA-Seq on whitefly (Bemisia tabaci MEAM1) populations after 24, 48, and 72 h acquisition access periods on either ToCV-infected or uninfected tomatoes. Significant differences in gene expression were detected between whiteflies fed on ToCV-infected tomato and those fed on uninfected tomato among the three feeding time periods: 447 up-regulated and 542 down-regulated at 24 h, 4 up-regulated and 7 down-regulated at 48 h, and 50 up-regulated and 160 down-regulated at 72 h. Analysis revealed differential regulation of genes associated with metabolic pathways, signal transduction, transport and catabolism, receptors, glucose transporters, α-glucosidases, and the uric acid pathway in whiteflies fed on ToCV-infected tomatoes, as well as an abundance of differentially regulated novel orphan genes. Results demonstrate for the first time, a specific and temporally regulated response by the whitefly to feeding on a host plant infected with a semipersistently transmitted virus, and advance the understanding of the whitefly vector-virus interactions that facilitate virus transmission. CONCLUSION: Whitefly transmission of semipersistent viruses is believed to require specific interactions between the virus and its vector that allow binding of virus particles to factors within whitefly mouthparts. Results provide a broader understanding of the potential mechanism of crinivirus transmission by whitefly, aid in discerning genes or loci in whitefly that influence virus interactions or transmission, and subsequently facilitate development of novel, genetics-based control methods against whitefly and whitefly-transmitted viruses.