Social and emotional alterations in mice lacking the short dystrophin-gene product, Dp71.

BACKGROUND: The Duchenne and Becker muscular dystrophies (DMD, BMD) are neuromuscular disorders commonly associated with diverse cognitive and behavioral comorbidities. Genotype-phenotype studies suggest that severity and risk of central defects in DMD patients increase with cumulative loss of different dystrophins produced in CNS from independent promoters of the DMD gene. Mutations affecting all dystrophins are nevertheless rare and therefore the clinical evidence on the contribution of the shortest Dp71 isoform to cognitive and behavioral dysfunctions is limited. In this study, we evaluated social, emotional and locomotor functions, and fear-related learning in the Dp71-null mouse model specifically lacking this short dystrophin. RESULTS: We demonstrate the presence of abnormal social behavior and ultrasonic vocalization in Dp71-null mice, accompanied by slight changes in exploratory activity and anxiety-related behaviors, in the absence of myopathy and alterations of learning and memory of aversive cue-outcome associations. CONCLUSIONS: These results support the hypothesis that distal DMD gene mutations affecting Dp71 may contribute to the emergence of social and emotional problems that may relate to the autistic traits and executive dysfunctions reported in DMD. The present alterations in Dp71-null mice may possibly add to the subtle social behavior problems previously associated with the loss of the Dp427 dystrophin, in line with the current hypothesis that risk and severity of behavioral problems in patients increase with cumulative loss of several brain dystrophin isoforms.

Asymmetric Myocardial Involvement as an Early Indicator of Cardiac Dysfunction in Pediatric Dystrophinopathies: A Study on Cardiac Magnetic Resonance (CMR) Parametric Mappings.

Dystrophinopathies, such as Duchenne and Becker muscular dystrophy, frequently lead to cardiomyopathy, being its primary cause of mortality. Detecting cardiac dysfunction early is crucial, but current imaging methods lack insight into microstructural remodeling. This study aims to assess the potential of cardiac magnetic resonance (CMR) parametric mappings for early detection of myocardial involvement in dystrophinopathies and explores whether distinct involvement patterns may indicate impending dysfunction. In this prospective study, 23 dystrophinopathy patients underwent CMR with tissue mappings. To establish a basis for comparison, a control group of 173 subjects was analyzed. CMR protocols included SSFP, T2-weighted and T1-weighted sequences pre and post gadolinium, and tissue mappings for native T1 (nT1), extracellular volume (ECV), and T2 relaxation times. The difference between the left ventricular posterior wall and the interventricular septum was calculated to reveal asymmetric myocardial involvement. Significant differences in LV ejection fraction (LVEF), myocardial mass, and late gadolinium enhancement confirmed abnormalities in patients. Tissue mappings: nT1 (p < 0.001) and ECV (p = 0.002), but not T2, displayed substantial variations, suggesting sensitivity to myocardial involvement. Asymmetric myocardial involvement in nT1 (p = 0.01) and ECV (p = 0.012) between septal and LV posterior wall regions was significant. While higher mapping values didn't correlate with dysfunction, asymmetric involvement in nT1 (ρ=-0.472, p = 0.023) and ECV (ρ=-0.460, p = 0.049) exhibited a significant negative correlation with LVEF. CMR mappings show promise in early myocardial damage detection in dystrophinopathies. Although mapping values may not directly correspond to dysfunction, the negative correlation between asymmetric involvement in nT1 and ECV with LVEF suggests their potential as early biomarkers. Larger, longitudinal studies are needed for a comprehensive understanding and improved risk stratification in dystrophinopathies.

Integrating Whole-Genome Sequencing in Clinical Genetics: A Novel Disruptive Structural Rearrangement Identified in the Dystrophin Gene (DMD).

While in most patients the identification of genetic alterations causing dystrophinopathies is a relatively straightforward task, a significant number require genomic and transcriptomic approaches that go beyond a routine diagnostic set-up. In this work, we present a Becker Muscular Dystrophy patient with elevated creatinine kinase levels, progressive muscle weakness, mild intellectual disability and a muscle biopsy showing dystrophic features and irregular dystrophin labelling. Routine molecular techniques (Southern-blot analysis, multiplex PCR, MLPA and genomic DNA sequencing) failed to detect a defect in the DMD gene. Muscle DMD transcript analysis (RT-PCR and cDNA-MLPA) showed the absence of exons 75 to 79, seen to be present at the genomic level. These results prompted the application of low-coverage linked-read whole-genome sequencing (WGS), revealing a possible rearrangement involving DMD intron 74 and a region located upstream of the PRDX4 gene. Breakpoint PCR and Sanger sequencing confirmed the presence of a ~8 Mb genomic inversion. Aberrant DMD transcripts were subsequently identified, some of which contained segments from the region upstream of PRDX4. Besides expanding the mutational spectrum of the disorder, this study reinforces the importance of transcript analysis in the diagnosis of dystrophinopathies and shows how WGS has a legitimate role in clinical laboratory genetics.

Multiomic Approaches to Uncover the Complexities of Dystrophin-Associated Cardiomyopathy.

Despite major progress in treating skeletal muscle disease associated with dystrophinopathies, cardiomyopathy is emerging as a major cause of death in people carrying dystrophin gene mutations that remain without a targeted cure even with new treatment directions and advances in modelling abilities. The reasons for the stunted progress in ameliorating dystrophin-associated cardiomyopathy (DAC) can be explained by the difficulties in detecting pathophysiological mechanisms which can also be efficiently targeted within the heart in the widest patient population. New perspectives are clearly required to effectively address the unanswered questions concerning the identification of authentic and effectual readouts of DAC occurrence and severity. A potential way forward to achieve further therapy breakthroughs lies in combining multiomic analysis with advanced preclinical precision models. This review presents the fundamental discoveries made using relevant models of DAC and how omics approaches have been incorporated to date.

From Mice to Humans: An Overview of the Potentials and Limitations of Current Transgenic Mouse Models of Major Muscular Dystrophies and Congenital Myopathies.

Muscular dystrophies are a group of more than 160 different human neuromuscular disorders characterized by a progressive deterioration of muscle mass and strength. The causes, symptoms, age of onset, severity, and progression vary depending on the exact time point of diagnosis and the entity. Congenital myopathies are rare muscle diseases mostly present at birth that result from genetic defects. There are no known cures for congenital myopathies; however, recent advances in gene therapy are promising tools in providing treatment. This review gives an overview of the mouse models used to investigate the most common muscular dystrophies and congenital myopathies with emphasis on their potentials and limitations in respect to human applications.

Adiponectin and Its Mimics on Skeletal Muscle: Insulin Sensitizers, Fat Burners, Exercise Mimickers, Muscling Pills or Everything Together?

Adiponectin (ApN) is a hormone abundantly secreted by adipocytes and it is known to be tightly linked to the metabolic syndrome. It promotes insulin-sensitizing, fat-burning, and anti-atherosclerotic actions, thereby effectively counteracting several metabolic disorders, including type 2 diabetes, obesity, and cardiovascular diseases. ApN is also known today to possess powerful anti-inflammatory/oxidative and pro-myogenic effects on skeletal muscles exposed to acute or chronic inflammation and injury, mainly through AdipoR1 (ApN specific muscle receptor) and AMP-activated protein kinase (AMPK) pathway, but also via T-cadherin. In this review, we will report all the beneficial and protective properties that ApN can exert, specifically on the skeletal muscle as a target tissue. We will highlight its effects and mechanisms of action, first in healthy skeletal muscle including exercised muscle, and second in diseased muscle from a variety of pathological conditions. In the end, we will go over some of AdipoRs agonists that can be easily produced and administered, and which can greatly mimic ApN. These interesting and newly identified molecules could pave the way towards future therapeutic approaches to potentially prevent or combat not only skeletal muscle disorders but also a plethora of other diseases with sterile inflammation or metabolic dysfunction.

Autism spectrum disorders are prevalent among patients with dystrophinopathies.

Recent studies have reported a higher prevalence of autism spectrum disorders among patients with dystrophinopathies. The aim of this study was to investigate the prevalence of autism spectrum disorder (ASD) among those with dystrophinopathies. The possible role of dystrophin isoforms in patients was also explored. Fifty-six patients recruited from Toneyama National Hospital were included in this study (mean age = 12.9 years, SD = 5.2 years). Autistic symptoms were evaluated using the Pervasive Developmental Disorders/Autism Spectrum Disorders Rating Scale (PARS), a clinician rating scale. Eleven patients (19.6%; 95% confidence interval 10.2-32.4) met the criteria for ASD based on their PARS scores. Patients were separated into two groups based on the cumulative loss of dystrophin isoforms predicted from the mutation location. The prevalence of ASD was examined between these groups. Infantile and current autistic symptoms did not differ between the groups, except on one subscale of the PARS. This study revealed that there was a high prevalence of ASD in patients with dystrophinopathies.

Voltage-Dependent Sarcolemmal Ion Channel Abnormalities in the Dystrophin-Deficient Heart.

Mutations in the gene encoding for the intracellular protein dystrophin cause severe forms of muscular dystrophy. These so-called dystrophinopathies are characterized by skeletal muscle weakness and degeneration. Dystrophin deficiency also gives rise to considerable complications in the heart, including cardiomyopathy development and arrhythmias. The current understanding of the pathomechanisms in the dystrophic heart is limited, but there is growing evidence that dysfunctional voltage-dependent ion channels in dystrophin-deficient cardiomyocytes play a significant role. Herein, we summarize the current knowledge about abnormalities in voltage-dependent sarcolemmal ion channel properties in the dystrophic heart, and discuss the potentially underlying mechanisms, as well as their pathophysiological relevance.

Clinical and genetic interpretation of uncertain DMD missense variants: evidence from mRNA and protein studies.

BACKGROUND: Pathogenic missense variants in the dystrophin (DMD) gene are rarely reported in dystrophinopathies. Most DMD missense variants are of uncertain significance and their pathogenicity interpretation remains complicated. We aimed to investigate whether DMD missense variants would cause aberrant splicing and re-interpret their pathogenicity based on mRNA and protein studies. METHODS: Nine unrelated patients who had an elevated serum creatine kinase level with or without muscle weakness were enrolled. They underwent a detailed clinical, imaging, and pathological assessment. Routine genetic testing and muscle-derived mRNA and protein studies of dystrophin and sarcoglycan genes were performed in them. RESULTS: Three of the 9 patients presented with a Duchenne muscular dystrophy (DMD) phenotype and the remaining 6 patients had a suspected diagnosis of Becker muscular dystrophy (BMD) or sarcoglycanopathy based on their clinical and pathological characteristics. Routine genetic testing detected only 9 predicted DMD missense variants in them, of which 6 were novel and interpreted as uncertain significance. Muscle-derived mRNA studies of sarcoglycan genes didn't reveal any aberrant transcripts in them. Dystrophin mRNA studies confirmed that 3 predicted DMD missense variants (c.2380G > C, c.4977C > G, and c.5444A > G) were in fact splicing and frameshift variants due to aberrant splicing. The 9 DMD variants were re-interpreted as pathogenic or likely pathogenic based on mRNA and protein studies. Therefore, 3 patients with DMD splicing variants and 6 patients with confirmed DMD missense variants were diagnosed with DMD and BMD, respectively. CONCLUSION: Our study highlights the importance of muscle biopsy and aberrant splicing for clinical and genetic interpretation of uncertain DMD missense variants.

Social cognition in DMD and BMD dystrophinopathies: A cross-sectional preliminary study.

Objective: The dystrophinopathies called Duchenne and Becker muscular dystrophies (DMD/BMD) are rare, progressive, incurable, and life-limiting paediatric-onset neuromuscular diseases. These diseases have long been associated with specific neuropsychological deficits. However, the performance of these patients in the social cognition domain has not been properly investigated. Thus, the main objective of this study was to compare the performance on social cognition between DMD/BMD patients and healthy age-matched boys. Method: This cross-sectional study included 20 DMD/BMD children and adolescents and 20 healthy controls. The protocol included the Social Perception Domain of the NEPSY-II, the Reading the Mind in the Eyes Test - Child and Happé's Strange Stories test. General intelligence was controlled to eliminate the possible influence of covariables. All the assessments were performed remotely. Results: Most social cognition tasks were worse in patients with DMD/BMD than in matched healthy controls. These differences remained even after controlling for the general intelligence variable, with the exception of Total Disgust Errors (F = 1.462, p = .234, η2p= .038) and Verbal task (F = 1.820, p = .185, η2p= .047) scores from the NEPSY-II. Conclusions: This is the first study to demonstrate that the neuropsychological domain of social cognition is impaired in DMD/BMD patients, independent of the level of general intelligence. Screening assessments in DMD/BMD patients should be promoted to allow social cognition difficulties to be detected at an early stage to enhance patients' quality of life and social development.

Self- and Caregiver-Reported Participation, Quality of Life, and Related Mood and Behavior Challenges in People Living With Dystrophinopathies.

BACKGROUND: Previous studies of quality of life (QOL), mood, and behavior in muscular dystrophy focus on caregiver perceptions. This cross-sectional study aims to determine the prevalence of clinically significant mood and behavior problems by both patient and caregiver report and assess relationship between mood/behavior and QOL. METHODS: Forty-one patients with dystrophinopathies (Duchenne muscular dystrophy [DMD] and Becker muscular dystrophy [BMD]) were recruited through the University of Virginia Neuromuscular Clinic. Each patient and caregiver dyad completed questionnaires, including the Behavior Assessment System for Children, 2nd Edition (BASC-2); the Pediatric Quality of Life Inventory for DMD (PedsQL-DMD); Children's Depression Inventory, 2nd Edition; and Screen for Child Anxiety Related Disorders. RESULTS: Persons with dystrophinopathies rated most of their behavior and adaptive skills similarly to the general population. Sixty-four percent of parent assessments rated clinically significant problems on the BASC-2. Worse BASC-2 scores for self- and parent assessments correlated with lower (worse) scores in the Worry and Communication PedsQL domains. Patient-reported QOL scores were higher than parent-reported scores in each domain except Worry. CONCLUSIONS: Individuals with DMD/BMD rate their adaptive skills, behavioral symptoms, externalizing and internalizing problems, and school problems more positively than parents/caregivers. Obtaining self-report data is a worthwhile endeavor that can add value to intervention planning, with the ultimate goal of optimizing QOL.

A novel deep intronic variant in the DMD gene causes Duchenne muscular dystrophy by pseudoexon activation encoding a nonsense codon.

Dystrophinopathies are a group of neuromuscular disorders, inherited in an X-linked recessive manner, caused by pathogenic variants in the DMD gene. Copy number variation detection and next generation sequencing allow the detection of around 99 % of the pathogenic variants. However, some patients require mRNA studies from muscle biopsies to identify deep intronic pathogenic variants. Here, we report a child suspected of having Duchenne muscular dystrophy, with a muscle biopsy showing dystrophin deficiency, and negative molecular testing for deletions, duplications, and small variants. mRNA analysis from muscle biopsy revealed a pseudoexon activation that introduce a premature stop codon into the reading frame. gDNA sequencing allowed to identified a novel variant, c.832-186 T>G, which creates a cryptic donor splice site, recognizing the underlying mechanism causing the pseudoexon insertion. This case highlights the usefulness of the mRNA analysis from muscle biopsy when routine genetic testing is negative and clinical suspicion of dystrophinopathies remains the main clinical diagnosis suspicion.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Draft Guidance for Industry Duchenne Muscular Dystrophy, Becker Muscular Dystrophy, and Related Dystrophinopathies - Developing Potential Treatments for the Entire Spectrum of Disease.

Background: Duchenne muscular dystrophy (DMD) and related dystrophinopathies are neuromuscular conditions with great unmet medical needs that require the development of effective medical treatments. Objective: To aid sponsors in clinical development of drugs and therapeutic biological products for treating DMD across the disease spectrum by integrating advancements, patient registries, natural history studies, and more into a comprehensive guidance. Methods: This guidance emerged from collaboration between the FDA, the Duchenne community, and industry stakeholders. It entailed a structured approach, involving multiple committees and boards. From its inception in 2014, the guidance underwent revisions incorporating insights from gene therapy studies, cardiac function research, and innovative clinical trial designs. Results: The guidance provides a deeper understanding of DMD and its variants, focusing on patient engagement, diagnostic criteria, natural history, biomarkers, and clinical trials. It underscores patient-focused drug development, the significance of dystrophin as a biomarker, and the pivotal role of magnetic resonance imaging in assessing disease progression. Additionally, the guidance addresses cardiomyopathy's prominence in DMD and the burgeoning field of gene therapy. Conclusions: The updated guidance offers a comprehensive understanding of DMD, emphasizing patient-centric approaches, innovative trial designs, and the importance of biomarkers. The focus on cardiomyopathy and gene therapy signifies the evolving realm of DMD research. It acts as a crucial roadmap for sponsors, potentially leading to improved treatments for DMD.

Association between loss of dp140 and cognitive impairment in duchenne and becker dystrophies.

The presence of variable degrees of non progressive cognitive impairment is recognized as a clinical feature of patients with Duchenne and Becker muscular dystrophies (DMD and BMD), but its pathogenesis still remains a matter of debate. A number of findings have proved that rearrangements located in the second part of the dystrophin ( DMD ) gene seem to be preferentially associated with cognitive impairment. Dp140 is a distal dystrophin isoform, mainly expressed during fetal brain development, whose role for neuropsychological functioning was suggested. The aims of the current study were to explore the possible association between cognitive impairment and DNA mutations affecting the regulatory regions of Dp140, as well as to compare the neuropsychological functioning of patients affected with DMD and Intermediate muscular dystrophy (IMD) with those affected by Becker muscular dystrophy (BMD). Fiftythree patients genetically diagnosed with DMD, IMD and BMD, subdivided according to sites of mutations along the DMD gene, underwent a neuropsychological assessment, evaluating their general cognitive abilities, verbal memory, attention and executive functions. Twenty patients with mutations, terminating in exon 44 or starting at exon 45 were tested by polymerase chain reaction (PCR) amplification of microsatellites STR44, SK12, SK21 and P20 DXS269, in order to evaluate the integrity of the Dp140 promoter region. According to our statistical results, there was not a significant difference in terms of general intelligence between the allelic forms of the disease, a higher frequency of mental retardation was observed in DMD patients. The patients with BMD had better results on tests, measuring long-term verbal learning memory and executive functions. We found that patients lacking Dp140 performed more poorly on all neuropsychological tests compared to those with preserved Dp140. Overall, our findings suggest that the loss of Dp140 is associated with a higher risk of intellectual impairment among patients with dystrophinopathies and highlights the possible role of this distal isoform in normal cognitive development.

Clinical, muscle imaging, and genetic characteristics of dystrophinopathies with deep-intronic DMD variants.

BACKGROUND: Phenotypic heterogeneity within or between families with a same deep-intronic splice-altering variant in the DMD gene has never been systematically analyzed. This study aimed to determine the phenotypic and genetic characteristics of patients with deep-intronic DMD variants. METHODS: Of 1338 male patients with a suspected dystrophinopathy, 38 were confirmed to have atypical pathogenic DMD variants via our comprehensive genetic testing approach. Of the 38 patients, 30 patients from 22 unrelated families with deep-intronic DMD variants underwent a detailed clinical and imaging assessment. RESULTS: Nineteen different deep-intronic DMD variants were identified in the 30 patients, including 15 with Duchenne muscular dystrophy (DMD), 14 with Becker muscular dystrophy (BMD), and one with X-linked dilated cardiomyopathy. Of the 19 variants, 15 were single-nucleotide variants, 2 were structural variants (SVs), and 2 were pure-intronic large-scale SVs causing aberrant inclusion of other protein-coding genes sequences into the mature DMD transcripts. The trefoil with single fruit sign was observed in 18 patients and the concentric fatty infiltration pattern was observed in 2 patients. Remarkable phenotypic heterogeneity was observed not only in skeletal but also cardiac muscle involvement in 2 families harboring a same deep-intronic variant. Different skeletal muscle involvement between families with a same variant was observed in 4 families. High inter-individual phenotypic heterogeneity was observed within two BMD families and one DMD family. CONCLUSIONS: Our study first highlights the variable phenotypic expressivity of deep-intronic DMD variants and demonstrates a new class of deep-intronic DMD variants, i.e., pure-intronic SVs involving other protein-coding genes.

Advances in Dystrophinopathy Diagnosis and Therapy.

Dystrophinopathies are x-linked muscular disorders which emerge from mutations in the Dystrophin gene, including Duchenne and Becker muscular dystrophy, and dilated cardiomyopathy. However, Duchenne muscular dystrophy interconnects with bone loss and osteoporosis, which are exacerbated by glucocorticoids therapy. Procedures for diagnosing dystrophinopathies include creatine kinase assay, haplotype analysis, Southern blot analysis, immunological analysis, multiplex PCR, multiplex ligation-dependent probe amplification, Sanger DNA sequencing, and next generation DNA sequencing. Pharmacological therapy for dystrophinopathies comprises glucocorticoids (prednisone, prednisolone, and deflazacort), vamorolone, and ataluren. However, angiotensin-converting enzyme (ACE) inhibitors, angiotensin receptor blockers (ARBs), and ß-blockers are the first-line to prevent dilated cardiomyopathy in dystrophinopathy patients. Duchenne muscular dystrophy gene therapy strategies involve gene transfer, exon skipping, exon reframing, and CRISPR gene editing. Eteplirsen, an antisense-oligonucleotide drug for skipping exon 51 from the Dystrophin gene, is available on the market, which may help up to 14% of Duchenne muscular dystrophy patients. There are various FDA-approved exon skipping drugs including ExonDys-51 for exon 51, VyonDys-53 and Viltolarsen for exon 53 and AmonDys-45 for exon 45 skipping. Other antisense oligonucleotide drugs in the pipeline include casimersen for exon 45, suvodirsen for exon 51, and golodirsen for exon 53 skipping. Advances in the diagnosis and therapy of dystrophinopathies offer new perspectives for their early discovery and care.

Wechsler Scale Intelligence Testing in Males with Dystrophinopathies: A Review and Meta-Analysis.

BACKGROUND: Intelligence scores in males with Duchenne Muscular Dystrophy (DMD) and Becker Muscular Dystrophy (BMD) remain a major issue in clinical practice. We performed a literature review and meta-analysis to further delineate the intellectual functioning of dystrophinopathies. METHOD: Published, peer-reviewed articles assessing intelligence, using Wechsler Scales, of males with DMD or BMD were searched from 1960 to 2022. Meta-analysis with random-effects models was conducted, assessing weighted, mean effect sizes of full-scale IQ (FSIQ) scores relative to normative data (Mean = 100, Standard Deviation = 15). Post hoc we analysed differences between performance and verbal intelligence scores. RESULTS: 43 studies were included, reporting data on 1472 males with dystrophinopathies; with FSIQ scores available for 1234 DMD (k = 32) and 101 BMD (k = 7). DMD males score, on average, one standard deviation below average (FSIQ = 84.76) and significantly lower than BMD (FSIQ = 92.11). Compared to a previous meta-analysis published in 2001, we find, on average, significantly higher FSIQ scores in DMD. CONCLUSION: Males with Duchenne have, on average, significantly lower FSIQ scores than BMD males and the general population. Clinicians must consider lower intelligence in dystrophinopathies to ensure good clinical practice.

Reclassification of DMD Duplications as Benign: Recommendations for Cautious Interpretation of Variants Identified in Prenatal Screening.

Duplications are the main type of dystrophin gene (DMD) variants, which typically cause dystrophinopathies such as Duchenne muscular dystrophy and Becker muscular dystrophy. Maternally inherited exon duplication in DMD in fetuses is a relatively common finding of genetic screening in clinical practice. However, there is no standard strategy for interpretation of the pathogenicity of DMD duplications during prenatal screening, especially for male fetuses, in which maternally inherited pathogenic DMD variants more frequently cause dystrophinopathies. Here, we report three non-contiguous DMD duplications identified in a woman and her male fetus during prenatal screening. Multiplex ligation probe amplification and long-read sequencing were performed on the woman and her family members to verify the presence of DMD duplications. Structural rearrangements in the DMD gene were mapped by long-read sequencing, and the breakpoint junction sequences were validated using Sanger sequencing. The woman and her father carried three non-contiguous DMD duplications. Long-read and Sanger sequencing revealed that the woman's father carried an intact DMD copy and a complex structural rearrangement of the DMD gene. Therefore, we reclassified these three non-contiguous DMD duplications, one of which is listed as pathogenic, as benign. We postulate that breakpoint analysis should be performed on identified DMD duplication variants, and the pathogenicity of the duplications found during prenatal screening should be interpreted cautiously for clinical prediction and genetic/reproductive counseling.

Ambulatory Duchenne muscular dystrophy children: cross-sectional correlation between function, quantitative muscle ultrasound and MRI.

Duchenne muscular dystrophy (DMD) is a progressive genetic muscle disease. Quantitative muscle ultrasound (US), muscle MRI, and functional tools are important to delineate characteristics of muscle involvement. We aimed to establish correlations between clinical/functional and above-named imaging tools respecting their diagnostic and prognostic role in DMD children. A cross-sectional retrospective study of 27 steroid-naive, ambulant male children/adolescents with genetically-confirmed DMD (mean age, 8.8 ± 3.3 years). Functional performance was assessed using motor function measure (MFM) which assess standing/transfer (D1), proximal (D2) and distal (D3) motor function, and six-minute walk test (6MWT). Imaging evaluation included quantitative muscle MRI which measured muscle fat content in a specific location of right rectus femoris by mDixon sequence. Quantitative muscle US measured right rectus femoris muscle brightness in standardized US image as an indicator of muscle fat content. We found a highly significant positive correlation between the mean MFM total score and 6MWT (R = 0.537, p = 0.007), and a highly significant negative correlation between fat content by muscle US and MFM total score (R = -0.603, p = 0.006) and its D1 subscore (R =-0.712, p = 0.001), and a significant negative correlation between fat content by US and 6MWT (R = -0.529, p = 0.02), and a significant positive correlation between muscle fat content by mDixon MRI and patient's age (R = 0.617, p = 0.01). Quantitative muscle US correlates significantly with clinical/functional assessment tools as MFM and 6MWT, and augments their role in disease-tracking of DMD. Quantitative muscle US has the potential to act as a substitute to functional assessment tools.