Exploring the molecular mechanism of coloration differences in two Meconopsis wilsonii subspecies: australis and orientalis.

Flower color diversity is a key taxonomic trait in Meconopsis species, enhancing their appeal as ornamental flowers. However, knowledge of the molecular mechanisms of flower color formation in Meconopsis species is still limited. M. wilsonii subsp. australis (Australis) and M. wilsonii subsp. orientalis (Orientalis) have a developmental stage presenting red-purple flowers, while Orientalis also presents blue coloration at the full-bloom period, making them an important model for exploring the mechanism of blue flower formation in M. wilsonii. In this study, we collected petals from Australis and Orientalis at different developmental stages to compare the coloration differences between the two species and detect the molecular mechanisms of blue color in Orientalis. We identified that cyanidin was the main anthocyanin in the flowers of both species, and the blue color in Orientalis primarily arises from anthocyanins (Cyanidin-3-O-sambubioside). RNA sequencing analysis was performed to detect the gene expression in the anthocyanin biosynthesis pathway, and the results suggested that gene regulation for anthocyanin biosynthesis may not be the direct reason for blue color formation in Orientalis. In addition, the growth solid of Orientalis was rich in Fe and Mg ions, and a large amount of Fe and Mg ions accumulated in the petals of Orientalis. Combined with the gene functional enrichment results, we found that the purple and red-purple colors of these two species were presented by different glycosylation levels of cyanidin, while the violet color of Orientalis might be the results of metalloanthocyanins by Fe and Mg ions, which also relieved the toxicity caused by the high content of Fe and Mg ions in its cells. The environmental adaptation-related genes were highly expressed of in both species, such as adaptation to desiccation, water deprivation, freezing, etc. Our results revealed the coloration differences between Australis and Orientalis and described the molecular mechanisms of blue coloration in Orientalis. The data in our analysis could enrich the genetic resources for M. wilsonii for further studies.

As next-generation probiotics: acetic acid bacteria isolated from Kombucha beverages produced with Anatolian hawthorn leaves.

This research examined acetic acid bacteria (AAB) isolated from Kombucha beverages produced with Anatolian hawthorn (Crataegus orientalis) as next-generation probiotics. Eighty-six AAB were isolated from the samples and investigated in terms of biosafety, viability in vitro gastrointestinal conditions, technological and bioactive properties, and also in vitro adhesion abilities. Seventy-six isolates demonstrating γ-hemolysis exhibited resistance to erythromycin and ampicillin. Besides, these isolates survived at low pH and in the presence of bile salts. However, the majority of AAB isolates showed tolerance to phenol, pepsin, and pancreatin. Also, twenty-one isolates showed protease enzyme activity, while eight isolates had amylase enzyme activity. Despite most of the isolates showed viability at 1.5% salt, only 19 isolates survived at 10% salt. Most AAB isolates exhibited inhibition zones ranging from 8 to 26 mm against test bacteria, their antioxidant activities were above 80%. Additionally, some isolates exhibited auto-aggregation ability ranging from 0.66 to 23.62% and co-aggregation ability ranging from 1.18 to 71.32%, while hydrophobicity ranged from 1.32 to 69.87% toward xylene. Finally, the indigenous 76 AAB isolates that had remarkable probiotic properties were characterized based on 16S rRNA gene sequencing, and the isolates belonged to Komagateibacter sp. (64.47%), Komagateibacter saccharivorans (15.79%), K. rhaeticus (11.84%), and Gluconobacter sp. (7.90%). As a result, the isolates identified as Gluconobacter sp. A21, Komagataeibacter sp. A139, Gluconobacter sp. A141, and Komagataeibacter sp. A146, which showed high viability under gastrointestinal conditions, safe and acceptable in terms of technological, bioactive, and adhesion properties and could be evaluated as next-generation probiotics.

Evaluation of the temperature adaptation of three rubber tree pest mites based on their two-sex life table.

To determine the optimal temperature range for the development and reproduction of three spider mites (Eotetranychus sexmaculatus, Eotetranychus orientalis, and Oligonychus biharensis), this study investigated their developmental period, survival rate, lifespan, and reproduction under five temperatures, 21, 24, 27, 30, and 33°C, to predict and control in the field. With the gathered data, a two-sex life table was constructed for each of them. The results revealed that as the temperature increased, both O. biharensis and E. orientalis displayed a gradual reduction in their generation period. Furthermore, an inverse relationship was observed between lifespan and temperature for all three spider mite species. When examining the survival rates at varying temperatures, E. sexmaculatus exhibited the highest rate (98%) at 33°C, while E. orientalis and O. biharensis demonstrated their highest survival rates at 24°C, reaching 90% and 100% respectively. Regarding reproduction, O. biharensis displayed the highest oviposition rates at 30°C with an average of 17.45 eggs per individual. Conversely, E. sexmaculatus and E. orientalis exhibited the highest oviposition rates at 33°C, averaging at 15.22 and 21.38 eggs per individual respectively. Significantly higher intrinsic growth rates were observed for O. biharensis and E. orientalis at 33°C, with rates of 0.22 and 0.26 respectively. In contrast, E. sexmaculatus demonstrated the highest intrinsic growth rate at 27°C. The temperature of 27°C was more suitable for the growth of the E. sexmaculatus, while 33°C was the optimal temperature for the E. orientalis and O. biharensis. The current findings provide valuable guidance for the control and prevention of these three spider mites.

The arrangement of dual-species biofilms of Candida albicans and Issatchenkia orientalis can be modified by the medium: effect of Voriconazole.

Both Candida albicans and Issatchenkia orientalis have been isolated from different types of infections over the years. They have the ability to form communities of microorganisms known as biofilms. It has been demonstrated that the medium employed in studies may affect the biofilm development. The aim of this study was to investigate the arrangement of dual-species biofilms of C. albicans and I. orientalis cultivated on either RPMI-1640 or Sabouraud Dextrose Broth (SDB), as well as the inhibitory effect of Voriconazole (VRC). For the experiments performed, ATCC strains were used, and yeast-mixed suspensions were inoculated in 96-well plates with either RPMI-1640 or SDB, in the presence or absence of VRC. The results were observed by counting the number of CFU obtained from scraping off the biofilms produced and plating the content on CHROMagar Candida medium. It was observed that for all conditions tested the medium chosen affected the arrangement of dual-species biofilms: when RPMI-1640 was used, there was a prevalence of C. albicans, while the opposite was noted when SDB was used. It could be suggested that the medium and environment could regulate interactions between both yeast species, including the response to different antifungal drugs.

Exploring Astrodaucus orientalis (L.) Drude: Phytochemical Analysis and its Biological Potential Against Alzheimer's and Diabetes.

In current study antioxidant, antidiabetic, antimicrobial, anticholinesterase, and human carbonic anhydrase I, and II (hCA I and II) isoenzymes inhibition activities of Astrodaucus orientalis different parts were investigated. Achetylcholinesterse (AChE) and butyrylcholinesterse (BChE) inhibitory activities of octyl acetate were determined via molecular docking. Quantitative assessment of specific secondary metabolites was conducted using LC-MS/MS. An examination of chemical composition of essential oils was carried out by GC-MS/MS. A thorough exploration of plant's anatomical characteristics was undertaken. The highest phenolics level and DPPH antioxidant capacity were seen in root and fruit. Fruit essential oil demonstrated the highest AChE inhibition (44.13±3.61 %), while root dichloromethane sub-extract had the best inhibition towards BChE (86.13±2.58 %). Cytosolic hCA I, and II isoenzymes were influentially inhibited by root oil with 1.974 and 2.207 µM IC50 values, respectively. The most effective extracts were found to be root all extract/sub-extracts (except water) against C. tropicalis and C. krusei strains with MIC value 160>µg/mL. Sabinene (29.4 %), α-pinene (20.2 %); octyl acetate (54.3 %); myrcene (28.0 %); octyl octanoate (71.3 %) were found principal components of aerial parts, roots, flowers, and fruits, respectively. Flower essential oil, fruit dicloromethane and ethyl acetate exhibited potent α-glucosidase inhibitory activity with 900, 40, and 937 µg/mL IC50 values, respectively.

In vitro Genotoxicity and In silico Docking Analyses of the Essential Oils of Thuja orientalis.

Two main objectives were pursued to assess the reliability of Thuja orientalis essential oils (TOEO). The first objective was to extract TOEO, analyze them by GC-MS, and determine their in vitro genotoxicity against selected plants using the RAPD-PCR method. The second objective was to evaluate the in-silico toxicity of TOEO. The binding sites and energies of each content was calculated against B-DNA. In-silico analyses were performed using a simulation program, AutoDock Vina, and Toxicity Estimation Software Tools. 3-carene, cedrol, and 2-pinene were identified as the predominant components. In vitro studies showed that the TOEO had a more significant impact on reducing genomic stability in wheat compared to the amaranth. The lowest stability was determined as 39.78 % in wheat and 53.58 % in amaranth. Cedrol (-5,7 kcal/mol) and selinene (-5,6 kcal/mol) exhibited the highest binding affinity. The toxicity test indicated that components other than cyclohexene may have toxic effects, none of them were predicted to be mutagenic, and LD50 (mol/kg) values could vary between 1.33 and 1.55.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Five anti-inflammatory compounds from the resins of Liquidambar orientalis.

Five undescribed compounds, including a triterpenoid (1), three phenylpropanoids [(±)-2 and 4], and an aromatic compound (3), as well as six known analogues (5-10), were isolated from the resins of Liquidambar orientalis Mill. Their structures, including absolute configurations, were determined by using spectroscopic and computational methods, and the five new compounds displayed anti-inflammatory activities in LPS-induced RAW264.7 cells.

Effects of triploidization on light sensitivity in larval stage of Pacific bluefin tuna Thunnus orientalis.

Triploidization influences various biological characteristics of fish, which is associated with reductions in the number of multiple cell types in different tissues/organs. Our behavioral analyses revealed that triploid Pacific bluefin tuna (Thunnus orientalis) larvae exhibit lower sensitivity to light compared to diploids. Furthermore, histological analyses revealed a reduction in the number of ganglion cells and an increase in their size in the retinas of triploid T. orientalis larvae. Our findings provide the first evidence indicating that triploidization reduces sensory perception during the larval stage of fish.

Antioxidant Properties of Platycladus orientalis Flavonoids for Treating UV-Induced Damage in Androgenetic Alopecia Hair.

BACKGROUND: Androgenetic alopecia (AGA) causes thinning hair, but poor hair quality in balding areas and damage from UV radiation have been overlooked. Plant extracts like Platycladus orientalis flavonoids (POFs) may improve hair quality in AGA. This study examines POFs' effectiveness in treating AGA-affected hair and repairing UV-induced damage. METHODS: Hair samples were analyzed using scanning electron microscopy (SEM) to examine surface characteristics, electron paramagnetic resonance (EPR) spectroscopy to measure free radicals in the hair, and spectrophotometry to assess changes in hair properties. RESULTS: POFs effectively removed hydroxyl radicals from keratinocytes and had antioxidant properties. They also reduced UV-induced damage to AGA hair by mitigating the production of melanin free radicals. Following POF treatment, the reduction in peroxidized lipid loss in AGA hair was notable at 59.72%, thereby effectively delaying the progression of hair color change. Moreover, protein loss decreased by 191.1 µ/g and tryptophan loss by 15.03%, ultimately enhancing hair's tensile strength. CONCLUSION: compared to healthy hair, hair damaged by AGA shows more pronounced signs of damage when exposed to UV radiation. POFs help protect balding hair by reducing oxidative damage and slowing down melanin degradation.

Changes in carbon stocks according to stand development stages in oriental beech forests in the Marmara Region of Türkiye.

This study was conducted to determine the changes in carbon stocks of oriental beech (Fagus orientalis) according to stand development stage in the Marmara Region of Türkiye. For this purpose, sample plots were taken from a total of 32 areas encompassing four stand development stages (young, middle age, mature and overmature stand). The diameter at breast height and height of all trees in the sample plots were measured, and only three dominant trees's ages per plot were determined. Aboveground carbon stock was calculated using equations developed for beech forests, while the coefficients in the Agriculture, Forestry and Other Land Use guide were used to determine belowground carbon stocks. A soil pit was dug in each plot and soil samples were taken at different depths (0-10, 10-30, 30-60, 60-100 cm). In addition, litters were sampled from four different 25 × 25 cm sections in each plot, and then the physical and chemical properties of the soil and litters were analysed. The variations in carbon stocks in above- and below-ground tree mass, litter and soil, and in ecosystem carbon stocks according to development stage were examined by analysis of variance and Duncan test, and the relationships between the carbon stocks were investigated by correlation analysis. Aboveground (AG) and belowground (BG) tree, soil and ecosystem carbon stocks showed significant differences between the four stand development stages (P < 0.05), but not the litter carbon stocks (P > 0.05). AG and BG tree and ecosystem carbon stocks increased with progressive stand development stages, while the soil carbon stock was the highest at the young stage. These findings will contribute to the preparation of forest management plans and the national greenhouse gas inventory.

A rare non-canonical splice site in Trema orientalis SYMRK does not affect its dual symbiotic functioning in endomycorrhiza and rhizobium nodulation.

BACKGROUND: Nitrogen-fixing nodules occur in ten related taxonomic lineages interspersed with lineages of non-nodulating plant species. Nodules result from an endosymbiosis between plants and diazotrophic bacteria; rhizobia in the case of legumes and Parasponia and Frankia in the case of actinorhizal species. Nodulating plants share a conserved set of symbiosis genes, whereas related non-nodulating sister species show pseudogenization of several key nodulation-specific genes. Signalling and cellular mechanisms critical for nodulation have been co-opted from the more ancient plant-fungal arbuscular endomycorrhizal symbiosis. Studies in legumes and actinorhizal plants uncovered a key component in symbiotic signalling, the LRR-type SYMBIOSIS RECEPTOR KINASE (SYMRK). SYMRK is essential for nodulation and arbuscular endomycorrhizal symbiosis. To our surprise, however, despite its arbuscular endomycorrhizal symbiosis capacities, we observed a seemingly critical mutation in a donor splice site in the SYMRK gene of Trema orientalis, the non-nodulating sister species of Parasponia. This led us to investigate the symbiotic functioning of SYMRK in the Trema-Parasponia lineage and to address the question of to what extent a single nucleotide polymorphism in a donor splice site affects the symbiotic functioning of SYMRK. RESULTS: We show that SYMRK is essential for nodulation and endomycorrhization in Parasponia andersonii. Subsequently, it is revealed that the 5'-intron donor splice site of SYMRK intron 12 is variable and, in most dicotyledon species, doesn't contain the canonical dinucleotide 'GT' signature but the much less common motif 'GC'. Strikingly, in T. orientalis, this motif is converted into a rare non-canonical 5'-intron donor splice site 'GA'. This SYMRK allele, however, is fully functional and spreads in the T. orientalis population of Malaysian Borneo. A further investigation into the occurrence of the non-canonical GA-AG splice sites confirmed that these are extremely rare. CONCLUSION: SYMRK functioning is highly conserved in legumes, actinorhizal plants, and Parasponia. The gene possesses a non-common 5'-intron GC donor splice site in intron 12, which is converted into a GA in T. orientalis accessions of Malaysian Borneo. The discovery of this functional GA-AG splice site in SYMRK highlights a gap in our understanding of splice donor sites.

Carbonized Platycladus orientalis Derived Carbon Dots Accelerate Hemostasis through Activation of Platelets and Coagulation Pathways.

Achieving rapid and effective hemostasis remains a multidisciplinary challenge. Here, distinctive functional carbon dots derived from carbonized Platycladus orientalis (CPO-CDs) are developed using one-step hydrothermal method. The negatively charged surface of CPO-CDs retains partial functional groups from CPO precursor, exhibiting excellent water solubility and high biocompatibility. Both rat liver injury model and tail amputation model have confirmed the rapid and effective hemostatic performance of CPO-CDs on exogenous hemorrhage. Further, on endogenous blood-heat hemorrhage syndrome rat model, CPO-CDs could inhibit hemorrhage and alleviate inflammation response. Interestingly, the excellent hemostasis performance of CPO-CDs is ascribed to activate exogenous coagulation pathway and common coagulation pathway. More importantly, metabolomics of rat plasma suggests that the hemostasis effect of CPO-CDs is closely related to platelet functions. Therefore, the designed in vitro experiments are performed and it is discovered that CPO-CDs significantly promote platelets adhesion, activation, and aggregation. Further, the underlying mechanism investigation suggests that Src/Syk signal pathway plays a key role in platelets activation triggered by CPO-CDs. Overall, CPO-CDs with rapid and excellent hemostatic performance are discovered for the first time, which could be an excellent candidate for the treatment of hemorrhagic diseases.

A landing pad system for multicopy gene integration in Issatchenkia orientalis.

The robust nature of the non-conventional yeast Issatchenkia orientalis allows it to grow under highly acidic conditions and therefore, has gained increasing interest in producing organic acids using a variety of carbon sources. Recently, the development of a genetic toolbox for I. orientalis, including an episomal plasmid, characterization of multiple promoters and terminators, and CRISPR-Cas9 tools, has eased the metabolic engineering efforts in I. orientalis. However, multiplex engineering is still hampered by the lack of efficient multicopy integration tools. To facilitate the construction of large, complex metabolic pathways by multiplex CRISPR-Cas9-mediated genome editing, we developed a bioinformatics pipeline to identify and prioritize genome-wide intergenic loci and characterized 47 gRNAs located in 21 intergenic regions. These loci are screened for guide RNA cutting efficiency, integration efficiency of a gene cassette, the resulting cellular fitness, and GFP expression level. We further developed a landing pad system using components from these well-characterized loci, which can aid in the integration of multiple genes using single guide RNA and multiple repair templates of the user's choice. We have demonstrated the use of the landing pad for simultaneous integrations of 2, 3, 4, or 5 genes to the target loci with efficiencies greater than 80%. As a proof of concept, we showed how the production of 5-aminolevulinic acid can be improved by integrating five copies of genes at multiple sites in one step. We have further demonstrated the efficiency of this tool by constructing a metabolic pathway for succinic acid production by integrating five gene expression cassettes using a single guide RNA along with five different repair templates, leading to the production of 9 g/L of succinic acid in batch fermentations. This study demonstrates the effectiveness of a single gRNA-mediated CRISPR platform to build complex metabolic pathways in a non-conventional yeast. This landing pad system will be a valuable tool for the metabolic engineering of I. orientalis.

Mechanisms underlying the formation of complex color patterns on Nigella orientalis (Ranunculaceae) petals.

Complex color patterns on petals are widespread in flowering plants, yet the mechanisms underlying their formation remain largely unclear. Here, by conducting detailed morphological, anatomical, biochemical, optical, transcriptomic, and functional studies, we investigated the cellular bases, chromogenic substances, reflectance spectra, developmental processes, and underlying mechanisms of complex color pattern formation on Nigella orientalis petals. We found that the complexity of the N. orientalis petals in color pattern is reflected at multiple levels, with the amount and arrangement of different pigmented cells being the key. We also found that biosynthesis of the chromogenic substances of different colors is sequential, so that one color/pattern is superimposed on another. Expression and functional studies further revealed that a pair of R2R3-MYB genes function cooperatively to specify the formation of the eyebrow-like horizontal stripe and the Mohawk haircut-like splatters. Specifically, while NiorMYB113-1 functions to draw a large splatter region, NiorMYB113-2 functions to suppress the production of anthocyanins from the region where a gap will form, thereby forming the highly specialized pattern. Our results provide a detailed portrait for the spatiotemporal dynamics of the coloration of N. orientalis petals and help better understand the mechanisms underlying complex color pattern formation in plants.

Multiple behaviors for turning performance of Pacific bluefin tuna (Thunnus orientalis).

Tuna are known for exceptional swimming speeds, which are possible because of their thunniform lift-based propulsion, large muscle mass and rigid fusiform body. A rigid body should restrict maneuverability with regard to turn radius and turn rate. To test if turning maneuvers by the Pacific bluefin tuna (Thunnus orientalis) are constrained by rigidity, captive animals were videorecorded overhead as the animals routinely swam around a large circular tank or during feeding bouts. Turning performance was classified into three different types: (1) glide turns, where the tuna uses the caudal fin as a rudder; (2) powered turns, where the animal uses continuous near symmetrical strokes of the caudal fin through the turn; and (3) ratchet turns, where the overall global turn is completed by a series of small local turns by asymmetrical stokes of the caudal fin. Individual points of the rostrum, peduncle and tip of the caudal fin were tracked and analyzed. Frame-by-frame analysis showed that the ratchet turn had the fastest turn rate for all points with a maximum of 302 deg s-1. During the ratchet turn, the rostrum exhibited a minimum global 0.38 body length turn radius. The local turn radii were only 18.6% of the global ratchet turn. The minimum turn radii ranged from 0.4 to 1.7 body lengths. Compared with the performance of other swimmers, the increased flexion of the peduncle and tail and the mechanics of turning behaviors used by tuna overcomes any constraints to turning performance from the rigidity of the anterior body morphology.

Genomic, spatial and morphometric data for discrimination of four species in the Mediterranean Tamus clade of yams (Dioscorea, Dioscoreaceae).

BACKGROUND AND AIMS: Among the numerous pantropical species of the yam genus, Dioscorea, only a small group occurs in the Mediterranean basin, including two narrow Pyrenean endemics (Borderea clade) and two Mediterranean-wide species (D. communis and D. orientalis, Tamus clade). However, several currently unrecognized species and infraspecific taxa have been described in the Tamus clade due to significant morphological variation associated with D. communis. Our overarching aim was to investigate taxon delimitation in the Tamus clade using an integrative approach combining phylogenomic, spatial and morphological data. METHODS: We analysed 76 herbarium samples using Hyb-Seq genomic capture to sequence 260 low-copy nuclear genes and plastomes, together with morphometric and environmental modelling approaches. KEY RESULTS: Phylogenomic reconstructions confirmed that the two previously accepted species of the Tamus clade, D. communis and D. orientalis, are monophyletic and form sister clades. Three subclades showing distinctive geographic patterns were identified within D. communis. These subclades were also identifiable from morphometric and climatic data, and introgression patterns were inferred between subclades in the eastern part of the distribution of D. communis. CONCLUSIONS: We propose a taxonomy that maintains D. orientalis, endemic to the eastern Mediterranean region, and splits D. communis sensu lato into three species: D. edulis, endemic to Macaronesia (Canary Islands and Madeira); D. cretica, endemic to the eastern Mediterranean region; and D. communis sensu stricto, widespread across western and central Europe. Introgression inferred between D. communis s.s. and D. cretica is likely to be explained by their relatively recent speciation at the end of the Miocene, disjunct isolation in eastern and western Mediterranean glacial refugia and a subsequent westward recolonization of D. communis s.s. Our study shows that the use of integrated genomic, spatial and morphological approaches allows a more robust definition of species boundaries and the identification of species that previous systematic studies failed to uncover.

Galbibacter pacificus sp. nov., isolated from surface seawater of the western Pacific Ocean and transfer of Joostella marina to the genus Galbibacter as Galbibacter orientalis nom. nov. and emended description of the genus Galbibacter.

Two Gram-stain-negative, non-motile, non-spore-forming, strictly aerobic and rod-shaped bacterial strains, CMA-7T and CAA-3, were isolated from surface seawater samples collected from the western Pacific Ocean. Phylogeny of 16S rRNA gene sequences indicated they were related to the genera Galbibacter and Joostella and shared 95.1, 90.9 and 90.8% sequence similarity with G. mesophilus Mok-17T, J. marina DSM 19592T and G. marinus ck-I2-15T, respectively. Phylogenomic analysis showed that the two strains, together with the members of the genera Galbibacter and Joostella, formed a monophyletic clade that could also be considered a monophyletic taxon. This distinctiveness was supported by amino acid identity and percentage of conserved proteins indices, phenotypic and chemotaxonomic characteristics and comparative genomics analysis. Digital DNA‒DNA hybridization values and average nucleotide identities between the two strains and their closest relatives were 18.0-20.8 % and 77.7-79.3 %, respectively. The principal fatty acids were iso-C15 : 0, iso-C17 : 0 3-OH, iso-C15 : 1 G, Summed Feature 3 (C16 : 1 ω7c/C16 : 1 ω6c or C16 : 1 ω6c/C16 : 1 ω7c), Summed Feature 9 (iso-C17 : 1 ω9c or C16 : 0 10-methyl), and C15 : 0 3-OH. The predominant respiratory quinone was MK-6. The polar lipids were phosphatidylethanolamine, aminolipid, aminophospholipid, phospholipid, phosphoglycolipid, glycolipid and unknown polar lipid. The genomic DNA G+C content of strains CMA-7T and CAA-3 was both 38.4 mol%. Genomic analysis indicated they have the potential to degrade cellulose and chitin. Based on the polyphasic evidence presented in this study, the two strains represent a novel species within the genus Galbibacter, for which the name Galbibacter pacificus sp. nov. is proposed. The type strain is CMA-7T (=MCCC M28999T = KCTC 92588T). Moreover, the transfer of Joostella marina to the genus Galbibacter as Galbibacter orientalis nom. nov. (type strain En5T = KCTC 12518T = DSM 19592T=CGMCC 1.6973T) is also proposed.

Fructilactobacillus cliffordii sp. nov., Fructilactobacillus hinvesii sp. nov., Fructilactobacillus myrtifloralis sp. nov., Fructilactobacillus carniphilus sp. nov. and Fructobacillus americanaquae sp. nov., five novel lactic acid bacteria isolated from insects or flowers of Kangaroo Island, South Australia.

Six strains, KI11_D11T, KI4_B1, KI11_C11T, KI16_H9T, KI4_A6T and KI3_B9T, were isolated from insects and flowers on Kangaroo Island, South Australia. On the basis of 16S rRNA gene phylogeny, strains KI11_D11T, KI4_B1, KI11_C11T, KI16_H9T, KI4_A6T were found to be closely related to Fructilactobacillus ixorae Ru20-1T. Due to the lack of a whole genome sequence for this species, whole genome sequencing of Fructilactobacillus ixorae Ru20-1T was undertaken. KI3_B9T was found to be closely related to Fructobacillus tropaeoli F214-1T. Utilizing core gene phylogenetics and whole genome analyses, such as determination of AAI, ANI and dDDH, we propose that these six isolates represent five novel species with the names Fructilactobacillus cliffordii (KI11_D11T= LMG 32130T = NBRC 114988T), Fructilactobacillus hinvesii (KI11_C11T = LMG 32129T = NBRC 114987T), Fructilactobacillus myrtifloralis (KI16_H9T= LMG 32131T = NBRC 114989T) Fructilactobacillus carniphilus (KI4_A6T = LMG 32127T = NBRC 114985T) and Fructobacillus americanaquae (KI3_B9T = LMG 32124T = NBRC 114983T). Chemotaxonomic analyses detected no fructophilic characters for these strains of member of the genus Fructilactobacillus. KI3_B9T was found to be obligately fructophilic, similarly to its phylogenetic neighbours in the genus Fructobacillus. This study represents the first isolation, to our knowledge, of novel species in the family Lactobacillaceae from the Australian wild.

Development of a bivalent mucoadhesive nanovaccine to prevent francisellosis and columnaris diseases in Nile tilapia (Oreochromis niloticus).

The occurrence of francisellosis caused by Francisella orientalis sp. nov. (Fo) and columnaris disease caused by Flavobacterium oreochromis (For) is negatively impacting Nile tilapia (Oreochromis niloticus) production, especially when high stocking densities are used. A new and innovative bivalent mucoadhesive nanovaccine was developed in this study for immersion vaccination of tilapia against francisellosis and columnaris disease. It was shown to have the potential to improve both innate and adaptive immunity in vaccinated Nile tilapia. It increased innate immune parameters, such as lysozyme activity, bactericidal activity, phagocytosis, phagocytic index, and total serum IgM antibody levels. Additionally, the vaccine was effective in elevating specific adaptive immune responses, including IgM antibody levels against Fo and For vaccine antigens and upregulating immune-related genes IgM, IgT, CD4+, MHCIIα, and TCRß in the head kidney, spleen, peripheral blood leukocytes, and gills of vaccinated fish. Furthermore, fish vaccinated with the mucoadhesive nanovaccine showed higher survival rates and relative percent survival after being challenged with either single or combined infections of Fo and For. This vaccine is anticipated to be beneficial for large-scale immersion vaccination of tilapia and may be a strategy for shortening vaccination times and increasing immune protection against francisellosis and columnaris diseases in tilapia aquaculture.