Detection of Satellite DNA Beta in Tomato Plants with Tomato Yellow Leaf Curl Disease in Jordan.

In Jordan, as well as many countries in the region, tomato production is threatened by begomoviruses belonging to the tomato yellow leaf curl virus complex (1). In 2013, an experiment was conducted at Homret Al-Sahen, Jordan (GPS coordinates 32°05'06″ N, 35°38'52″ E), to evaluate different tomato breeding lines for resistance against viruses causing tomato yellow leaf curl disease (TYLCD). Disease symptoms, typical of those caused by TYLCV complex, were observed in many susceptible lines. However, some lines exhibited unusual symptoms including severe leaf curling and stunting. To identify the causal agent of these symptoms, total nucleic acids were extracted from 21 symptomatic plants and used as templates in PCR analysis using nine primers, previously described to detect Tomato yellow leaf curl virus, Tomato yellow leaf curl Sardinia virus, and two recombinants between TYLCV and TYLCSV (3). In addition, the universal primer pair ß01/ß02 (2) was used to investigate the association of satDNA ß with the disease. The PCR products characteristic of TYLCV (664 bp) could be amplified from five plants indicating single infection, while double infection with TYLCV and satDNA ß (1,320 bp) was detected in seven plants. Mixed infection with TYLCV, TYLCSV (628 bp), and satDNA ß was detected in another seven symptomatic plants and only one plant was infected with TYLCV and TYLCSV. A single plant had mixed infection with TYLCV, TYLCSV, and RecA (a recombinant between TYLCV/TYLCSV) (538 bp) (3). Amplicons obtained from two plants using ß01/ß02 primers were directly sequenced as 1,320-bp PCR products. Both sequences were found identical and, therefore, this sequence was deposited in the GenBank under the accession number KJ396939. Phylogenetic analysis revealed that this satDNA ß sequence had the highest nucleotide (95%) identity with Okra leaf curl virus (OkLCV) satDNA 3 (AF397217) and OkLCV satDNA 10 (AF397215). The contribution of the satDNA ß in the modulation of the TYLCD symptoms will be further investigated. Few years ago, another satDNA (Tomß01-Om) was reported in Oman to be associated with TYLCD (4). However, to the best of our knowledge, this is the first report on the detection of satDNA ß in tomato plants infected with viruses causing TYLCD in Jordan. The increasing diversity of begomoviruses causing TYLCD in the region is of great concern due to the possible emergence of more virulent viruses and subsequent increased losses to tomato production. References: (1) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (2) R. W. Briddon and J. Stanley. Virology 344:198, 2006. (3) S. Davino et al. Virus Res. 143:15, 2009. (4) A. J. Khan et al. Virus Gene 36:169, 2008.

First Report of Recombinant Potato virus Y Strains Infecting Potato in Jordan.

Potato (Solanum tuberosum L.) is an important vegetable crop in Jordan, occupying second position after olives. In 2012, potatoes were planted on about 6,000 ha with a production of about 141,000 t (2). Potato virus Y (PVY) is a serious problem for potato production worldwide. Recombinant strains of the virus were reported to cause tuber necrotic ringspot disease (PTNRD) in many potato-growing regions of the world. In the last few years, a new recombinant PVYNTN-NW that belongs to PVYZ (3) has been reported in the neighboring Syria. It included three recombination patterns, SYR-I, SYR-II, and SYR-III, and caused severe PTNRD (1). Since PVY is easily transmitted from one region to another by aphid vectors and infected potato seeds, this study was initiated to investigate the possible occurrence of PVY strains in Jordan. In October 2013, 33 leaf samples were collected from symptomatic potato plants cv. Spunta from Wadi Rum, Jordan (GPS coordinates 29°31'37.76″ N, 35°42'48.75″ E), the largest potato-producing area in Jordan. Sampled plants displayed leaf mottling and yellowing, symptoms similar to those caused by PVY. All samples were tested for PVY by DAS-ELISA using the ELISA kit (monoclonal cocktail) developed by BIOREBA (Reinach, Switzerland) to detect all PVY isolates. Twenty-nine samples were found positive for PVY by ELISA. To confirm virus infection, total RNA was extracted from all ELISA-positive samples and used as template in uniplex RT-PCR using strain-specific primers (1). The band pattern of PCR amplicons showed that 12 samples were infected with PVYNTN-NW genotype SYR-III and produced bands of 1,085, 441, and 278 bp. One sample was infected with PVYNTN (A) and produced bands of 1,307, 633, and 441 bp, and one other sample was infected with PVYNTN-NW genotype SYR-II and produced bands of 1,085 and 441 bp. Mixed infection with PVYNTN-NW genotype SYR-III and PVYNTN (B) was also detected in one sample producing bands of 278, 441, 1,085, and 1,307 bp. To confirm infection with the recombinant strains, PCR fragments of 278 bp amplified from three samples and 1,085 bp obtained from another three samples were directly sequenced and sequences were deposited in GenBank under accession numbers KJ159968, KJ159969, and KJ159970 for the 278-bp fragment and KJ159974, KJ159975, and KJ159976 for the 1,085-bp fragment. Sequence comparison with other PVY strains available in the NCBI database showed that the 278-bp fragment had the highest nucleotide sequence identity (100%) with PVY isolates SYR-III-A26 (AB461467) and SYR-III-2-4 (AB461457) from Syria. BLAST searches also showed that the 1,085-bp fragment shared 99% nucleotide identities with PVY isolates SYR-II-L3 (AB461482) and SYR-II-Be4 (AB461474) from Aleppo, Syria. To our knowledge, this is the first report of PVY recombinants in Jordan, and the first report of PVYNTN-NW recombinants infecting potato crop outside Syria. Since Europe is the main supplier of potato seeds for farmers in Jordan and Syria, the introduction of PVYNTN-NW to the region could have happened through infected potato seeds. Results of this study create new challenges for potato growers in Jordan as well as other countries in the region. References: (1) M. Chikh Ali et al. J. Virol. Methods 165:15, 2010. (2) FAO. http://faostat.fao.org/ (3) A. V. Karasev and S. M. Gray. Ann. Rev. Phytopathol. 51:571, 2013.

First Report on the Association of Squash leaf curl virus and Watermelon chlorotic stunt virus with Tomato Yellow Leaf Curl Disease.

Tomato (Solanum lycopersicum Mill.) is one of the most economically important vegetable crops in Jordan. Tomato cultivation in many countries in the Mediterranean basin is affected by several virus species belonging to Tomato yellow leaf curl virus complex (3). In March 2011, a field experiment was conducted at Horet Al-Sahen region to screen tomato breeding lines for resistance against TYLCD. Unexpectedly, severe TYLCD symptoms, including leaf curling, yellowing, and severe stunting were observed on some plants belonging to the F5 generation of a breeding line that was supposed to be resistant to the virus. One symptomatic plant was transferred into the greenhouse and used for whitefly transmission. The virus isolate was maintained on a susceptible tomato landrace by serial transmission using biotype B of the whitely vector (Bemisia tabaci). To confirm begomovirus infections, total nucleic acids were extracted from leaf tissues as previously described (4) and viral DNA genomes were amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). RCA products were then subjected to restriction digestion with different enzymes. Two DNA fragments of 1,035 bp and 1,760 bp were the products of EcoRl-digestion. Following sequencing, BLASTn analysis showed that the small fragment (1,035 bp) (GenBank Accession No. JX444576) corresponding to nts 2,408 to 2,690 of Watermelon chlorotic stunt virus from Jordan (WmCSV-[JO]) (EU561237) had approximately 99% nt identity with WmCSV-[JO] and other isolates from Israel (EF201809) and Iran (AJ245652), while the second fragment (1,760 bp) which corresponds to nts 117 to 1,877 of TYLCV genome had 98% nt identities with the Mexican isolate of TYLCV (FJ609655). Two pairs of primers (TYLCV29F1: TATGGCAATCGGTGTATC/TYLCV29R1: GTGTCCAGGTATAAGTAAG) and (TYLCV29F2: GAGAGCCCAATTTTTCAAG/TYLCV29R2: GGGAATATCTAGACGAAGAA) were used to amplify full TYLCV genome. Sequence analysis showed that TYLCV (JX444575) had the highest (98%) nt identity with the Mexican isolate of TYLCV (FJ609655). Because Squash leaf curl virus and WmCSV were recently reported in Jordan (1,2), we further investigated whether SLCV was also involved in the disease; therefore, two pairs of SLCV-specific primers (SLCVF-Sal (TATAGTCGACGTTGAACCGGATTTGAATG)/SLCVR-Sal (TATAGTCGACCTGAGGAGAGCACTAAATC) (DNA-A) and SLCVF-Hindlll (ATTAAAGCTTAGTGGTTATGCAAGGCG)/SLCVR-Hindlll (ATTAAAGCTTGGCTGCACCATATGAACG) (DNA-B) were used in PCR using RCA products as template. The expected sizes of DNA-A (2,639 bp) (JX444577) and DNA-B (2,607 bp) (JX444574) could successfully be amplified from the original symptomatic plant. Phylogenetic analysis showed that DNA-A was closely related to SLCV isolates from Lebanon (HM368373) and Egypt (DQ285019) with 99% nt identity, while DNA-B had highest nt identity (99%) with the Israeli isolate of SLCV (HQ184437). To our knowledge, this is the first report on the association of SLCV and WmCSV with TYLCD. Further studies will be carried out to investigate whether tomato can act as an inoculum source for these two viruses. References: (1) A. Al-Musa et al. J. Phytopath. 156:311, 2008 (2) A. Al-Musa et al. Virus Genes 43:79, 2011. (3) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (4) J. L. Potter et al. Plant Dis, 87:1205, 2003.