Bifunctional G-Quadruplex Aptamer Targeting Nucleolin and Topoisomerase 1: Antiproliferative Activity and Synergistic Effect of Conjugated Drugs.

As a counterpart to antibody-drug conjugates (ADCs), aptamer-drug conjugates (ApDCs) have been considered a promising strategy for targeted therapy due to the various benefits of aptamers. However, an aptamer merely serves as a targeting ligand in ApDCs, whereas the antibody enables the unexpected therapeutic efficacy of ADCs through antibody-dependent cellular cytotoxicity (ADCC). In this study, we developed a tumor-specific aptamer with an effector function and used it to confirm the feasibility of more potent ApDCs. First, we designed a nucleolin (NCL)-binding G-quadruplex (GQ) library based on the ability of NCL to bind to telomeric sequences. We then identified a bifunctional GQ aptamer (BGA) inhibiting the catalytic activity of topoisomerase 1 (TOP1) by forming an irreversible cleavage complex. Our BGA specifically targeted NCL-positive MCF-7 cells, exhibiting antiproliferative activity, and this suggested that tumor-specific therapeutic aptamers can be developed by using a biased library to screen aptamer candidates for functional targets. Finally, we utilized DM1, which has a synergistic interaction with TOP1 inhibitors, as a conjugated drug. BGA-DM1 exerted an anticancer effect 20-fold stronger than free DM1 and even 10-fold stronger than AS1411 (NCL aptamer)-DM1, highlighting our approach to develop synergistic ApDCs. Therefore, we anticipate that our library might be utilized for the identification of aptamers with effector functions. Furthermore, by employing such aptamers and appropriate drugs, synergistic ApDCs can be developed for targeted cancer therapy in a manner distinct from how ADCs exhibit additional therapeutic efficacy.

Direct Detection of Low Abundance Genes of Single Point Mutation.

Cell-free DNA (cfDNA) analysis, specifically circulating tumor DNA (ctDNA) analysis, provides enormous opportunities for noninvasive early assessment of cancers. To date, PCR-based methods have led this field. However, the limited sensitivity/specificity of PCR-based methods necessitates the search for new methods. Here, we describe a direct approach to detect KRAS G12D mutated genes in clinical ctDNA samples with the utmost LOD and sensitivity/specificity. In this study, MutS protein was immobilized on the tip of an atomic force microscope (AFM), and the protein sensed the mismatched sites of the duplex formed between the capture probe on the surface and mutated DNA. A noteworthy LOD (3 copies, 0.006% allele frequency) was achieved, along with superb sensitivity/specificity (100%/100%). These observations demonstrate that force-based AFM, in combination with the protein found in nature and properly designed capture probes/blockers, represents an exciting new avenue for ctDNA analysis.

Fast Aptamer Generation Method Based on the Electrodynamic Microfluidic Channel and Evaluation of Aptamer Sensor Performance.

We demonstrate for the first time a fast aptamer generation method based on the screen-printed electrodynamic microfluidic channel device, where a specific aptamer selectively binds to a target protein on channel walls, following recovery and separation. A malaria protein as a model target, Plasmodium vivax lactate dehydrogenase (PvLDH) was covalently bonded to the conductive polymer layer formed on the carbon channel walls to react with the DNA library in a fluid. Then, the AC electric field was symmetrically applied on the channel walls for inducing the specific binding of the target protein to DNA library molecules. In this case, the partitioning efficiency between PvLDH and DNA library in the channel was attained to be 1.67 × 107 with the background of 5.56 × 10-6, which was confirmed using the quantitative polymerase chain reaction (qPCR). The selectively captured DNAs were isolated from the protein and separated in situ to give five aptamers with different sequences by one round cycle. The dissociation constants (Kd) of the selected aptamers were determined employing both electrochemical impedance spectroscopy (EIS) and the fluorescence method. The sensing performance of each aptamer was evaluated for the PvLDH detection after individual immobilization on the screen-printed array electrodes. The most sensitive aptamer revealed a detection limit of 7.8 ± 0.4 fM. The sensor reliability was evaluated by comparing it with other malaria sensors.

A Rapid Colorimetric Sensor for Soluble Interleukin-2 Receptor α, Based on Aptamer-Adsorbed AuNP.

The soluble interleukin-2 receptor α (sIL-2Rα) is a broad indicator of clinical disease activity in various inflammatory diseases. Here we have developed, for the first time, a rapid, washing-free colorimetric aptasensor based on a sIL-2Rα aptamer (Kd =1.33 nm). The aptasensor was fabricated with Au nanoparticles (AuNPs) adsorbing sIL-2Rα aptamers. On addition of sIL-2Rα, the aptamers become desorbed from the AuNPs, and this in turn weakens the absorption corresponding to AuNP-catalyzed oxidation of ortho-phenylenediamine (oPD) with H2 O2 . The aptasensor was characterized by TEM imaging, ζ potential measurements, dynamic light scattering (DLS) analysis, and UV/Vis spectrometry, followed by further optimization. The fabricated sensor exhibited great analytical performance, with a linear range of 1 to 100 nm and a detection limit of 1 nm both in buffer and in spiked human serum within 25 min. Other proteins, such as bovine serum albumin (BSA), IL-17Rα, IL-5Rα, IL-13Rα2 , and CD166, showed negligible effects on the aptasensor. Thanks to the great advantages of the aptamers and AuNPs, this aptasensor provides a rapid, simple, and inexpensive process that might offer insights into various diagnostic applications of sIL-2Rα.

Overexpression of angiotensin II type 1 receptor in breast cancer cells induces epithelial-mesenchymal transition and promotes tumor growth and angiogenesis.

The angiotensin II type I receptor (AGTR1) has been implicated in diverse aspects of human disease, from the regulation of blood pressure and cardiovascular homeostasis to cancer progression. We sought to investigate the role of AGTR1 in cell proliferation, epithelial-mesenchymal transition (EMT), migration, invasion, angiogenesis and tumor growth in the breast cancer cell line MCF7. Stable overexpression of AGTR1 was associated with accelerated cell proliferation, concomitant with increased expression of survival factors including poly(ADP-ribose) polymerase (PARP) and X-linked inhibitor of apoptosis (XIAP), as well as extracellular signal-regulated kinase (ERK) activation. AGTR1-overexpressing MCF7 cells were more aggressive than their parent line, with significantly increased activity in migration and invasion assays. These observations were associated with changes in EMT markers, including reduced E-cadherin expression and increased p-Smad3, Smad4 and Snail levels. Treatment with the AGTR1 antagonist losartan attenuated these effects. AGTR1 overexpression also accelerated tumor growth and increased Ki-67 expression in a xenograft model. This was associated with increased tumor angiogenesis, as evidenced by a significant increase in microvessels in the intratumoral and peritumoral areas, and enhanced tumor invasion, with the latter response associated with increased EMT marker expression and matrix metallopeptidase 9 (MMP-9) upregulation. In vivo administration of losartan significantly reduced both tumor growth and angiogenesis. Our findings suggest that AGTR1 plays a significant role in tumor aggressiveness, and its inhibition may have therapeutic implications.

Electrochemical aptasensor of cardiac troponin I for the early diagnosis of acute myocardial infarction.

Cardiac troponin I (cTnI) is well-known as a promising biomarker for the early diagnosis of acute myocardial infarction (AMI). In this work, single-stranded DNA aptamers against cTnI were identified by the Systematic Evolution of Ligands by Exponential enrichment (SELEX) method. The aptamer candidates exhibited a high selectivity and sensitivity toward both cTnI and the cardiac Troponin complex. The binding affinities of each aptamer were evaluated based on their dissociation constants (Kd) by surface plasma resonance. The Tro4 aptamer that had the highest binding capacity to cTnI showed a very low Kd value (270 pM) compared with that of a cTnI antibody (20.8 nM). Furthermore, we designed a new electrochemical aptasensor based on square wave voltammetry using ferrocene-modified silica nanoparticles. The developed aptasensor demonstrated an excellent analytical performance for cTnI with a wide linear range of 1-10 000 pM in a buffer and a detection limit of 1.0 pM (24 pg/mL; S/N = 3), which was noticeably lower than the cutoff values (70-400 pg/mL). The specificity of the aptamers was also examined using nontarget proteins, demonstrating that the proposed sensor responded to only cTnI. In addition, cTnI was successfully detected in a human serum albumin solution. On the basis of the calibration curve that was constructed, the concentrations of cTnI in a solution supplemented with human serum were effectively measured. The calculated values correlated well with the actual concentrations of cTnI. It is anticipated that the highly sensitive and selective aptasensor for cTnI could be readily applicable for the accurate diagnosis of AMI.

Probing conformational change of intrinsically disordered α-synuclein to helical structures by distinctive regional interactions with lipid membranes.

α-Synuclein (α-Syn) is an intrinsically disordered protein, whose fibrillar aggregates are associated with the pathogenesis of Parkinson's disease. α-Syn associates with lipid membranes and forms helical structures upon membrane binding. In this study, we explored the helix formation of α-Syn in solution containing trifluoroethanol using small-angle X-ray scattering and electrospray ionization ion mobility mass spectrometry. We then investigated the structural transitions of α-Syn to helical structures via association with large unilamellar vesicles as model lipid membrane systems. Hydrogen-deuterium exchange combined with electrospray ionization mass spectrometry was further utilized to understand the details of the regional interaction mechanisms of α-Syn with lipid vesicles based on the polarity of the lipid head groups. The characteristics of the helical structures were observed with α-Syn by adsorption onto the anionic phospholipid vesicles via electrostatic interactions between the N-terminal region of the protein and the anionic head groups of the lipids. α-Syn also associates with zwitterionic lipid vesicles and forms helical structures via hydrophobic interactions. These experimental observations provide an improved understanding of the distinct structural change mechanisms of α-Syn that originate from different regional interactions of the protein with lipid membranes and subsequently provide implications regarding diverse protein-membrane interactions related to their fibrillation kinetics.

Structural insights into Escherichia coli polymyxin B resistance protein D with X-ray crystallography and small-angle X-ray scattering.

BACKGROUND: Polymyxin B resistance protein D (PmrD) plays a key role in the polymyxin B-resistance pathway, as it is the signaling protein that can act as a specific connecter between PmrA/PmrB and PhoP/PhoQ. We conducted structural analysis to characterize Escherichia coli (E. coli) PmrD, which exhibits different features compared with PmrD in other bacteria. RESULTS: The X-ray crystal structure of E. coli PmrD was determined at a 2.00 Å resolution, revealing novel information such as the unambiguous secondary structures of the protein and the presence of a disulfide bond. Furthermore, various assays such as native gel electrophoresis, surface plasmon resonance (SPR), size-exclusion chromatography, dynamic light scattering (DLS), and small-angle X-ray scattering (SAXS) measurements, were performed to elucidate the structural and functional role of the internal disulfide bond in E. coli PmrD. CONCLUSIONS: The structural characteristics of E. coli PmrD were clearly identified via diverse techniques. The findings help explain the different protective mechanism of E. coli compared to other Gram-negative bacteria.

A colorimetric aptasensor for the diagnosis of malaria based on cationic polymers and gold nanoparticles.

Malaria, a major burden of disease caused by parasites of the genus Plasmodium, is widely spread in tropical and subtropical regions. Here, we have successfully developed a diagnostic technique for malaria. The proposed method is based on the interaction among the Plasmodium lactate dehydrogenase (pLDH), which is a biomarker for malaria, and pL1 aptamer against Plasmodium vivax lactate dehydrogenase (PvLDH) and Plasmodium falciparum lactate dehydrogenase (PfLDH). In addition, the cationic polymers, poly(diallyldimethylammonium chloride) (PDDA) and poly(allylamine hydrochloride) (PAH), aggregate gold nanoparticles (AuNPs) that should be possible to observe the change in color from red to blue, which depends on the concentration of pLDH. Using this aptasensor, pLDH proteins were successfully detected with low detection limits. Moreover, the specificity test proved that the aptasenor is very specific in targeting proteins over other interfering proteins. In addition, the pLDH from infected blood samples of the two main species of malaria were also detected. The limits of detection for P. vivax were determined as 80 parasites/µl for PDDA and 74 parasites/µl for PAH. The aptasenor has great advantages that can simply and rapidly diagnose malaria. Thus, the developed aptasensor for detection of pLDH can offer an effective and sensitive diagnosis of malaria.

Development of a one-shot dual aptamer-based fluorescence nanosensor for rapid, sensitive, and label-free detection of periostin.

Periostin is associated with several diseases, including cancers. Therefore, monitoring blood periostin levels is a powerful tool for diagnosing various diseases and identifying their severity. However, conventional detection methods pose several challenges, including high costs. To address these issues, we developed a novel one-shot dual aptamer-based fluorescence nanosensor for detecting periostin. The proposed nanosensor facilitates rapid, label-free, and sensitive detection of periostin using gold nanoprobes constructed by rhodamine-b isothiocyanate, PL2trunc aptamer, and gold nanoparticles and silver nanoprobes fabricated by the PL5trunc aptamer and silver nanoparticles. The two nanoprobes form a core-satellite structure by interacting with periostin, and the nanosensor detects periostin through the fluorescence regenerated by the increased proximity between them. The nanosensor successfully detected periostin with remarkable detection limits of 106.68 pM in buffer and 463.3 pM in serum-spiked conditions within 30 min without additional washing or signal amplification processes. Considering serum periostin levels in various diseases, the proposed nanosensor provides a suitable method for identifying patients with various diseases and determining disease severity. Moreover, the platform can be helpful as a practical method for on-site medical diagnosis because it can be adapted to detect other biomarkers simply by replacing the aptamer with other detection probes.

Development of an optical sandwich ELONA using a pair of DNA aptamers for yellow fever virus NS1.

Here, we proposed an enzyme-linked oligonucleotide assay (ELONA) for yellow fever (YF) diagnosis that uses a pair of aptamers, YFns1-4 and YFns1-31. The aptamers were selected to specifically bind to nonstructural protein 1 (NS1), which is secreted at a high concentration after YF infection. We applied the aptamers which did not interfere with each other on binding to the NS1 in a sandwich ELONA. In the assay, the best detection sensitivity was obtained when the combination of YFns1-31 as a capture aptamer and YFns1-4 as a detect aptamer was used. The sensitivity could be attributed to the results of the direct ELONA with each YFns1-4 and YFns1-31; a great absorbance intensity and a broad detectable range of NS1, respectively. The sandwich ELONA achieved a low detection limit of 0.85 nM in buffer and was highly specific to the YFV-NS1 as its detection signals were significantly distinct from those of other flavivirus-derived NS1. In addition, the assay showed a desirable sensitivity in serum-spiked condition. Our developed sandwich ELONA can be a new practical and applicable serological diagnostics in YF endemic regions where other flaviviruses coexist and facilities for complex diagnostic tests are lacking.

Detection of the strand exchange reaction using DNAzyme and Thermotoga maritima recombinase A.

We have designed multiple detection systems for the DNA strand exchange process. Thermostable Thermotoga maritima recombinase A (TmRecA), a core protein in homologous recombination, and DNAzyme, a catalytic DNA that can cleave a specific DNA sequence, are introduced in this work. In a colorimetric method, gold nanoparticles (AuNPs) modified with complementary DNAs (cDNAs) were assembled by annealing. Aggregated AuNPs were then separated irreversibly by TmRecA and DNAzyme, leading to a distinct color change in the particles from purple to red. For the case of fluorometric detection, fluorescein isothiocyanate (FITC)-labeled DNA as a fluorophore and black hole quencher 1 (BHQ1)-labeled DNA as a quencher were used; successful strand exchange was clearly detected by variations in fluorescence intensity. In addition, alterations in the impedance of a gold electrode with immobilized DNA were employed to monitor the regular exchange of DNA strands. All three methods provided sufficient evidence of efficient strand exchange reactions and have great potential for applications in the monitoring of recombination, discovery of new DNAzymes, detection of DNAzymes, and measurement of other protein activities.

Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods.

A gold nanoparticle based dual fluorescence-colorimetric method was developed as an aptasensor to detect ampicillin using its single-stranded DNA (ssDNA) aptamer, which was discovered by a magnetic bead-based SELEX technique. The selected aptamers, AMP4 (5'-CACGGCATGGTGGGCGTCGTG-3'), AMP17 (5'-GCGGGCGGTTGTATAGCGG-3'), and AMP18 (5'-TTAGTTGGGGTTCAGTTGG-3'), were confirmed to have high sensitivity and specificity to ampicillin (K(d), AMP7 = 9.4 nM, AMP17 = 13.4 nM, and AMP18 = 9.8 nM, respectively). The 5'-fluorescein amidite (FAM)-modified aptamer was used as a dual probe for observing fluorescence differences and color changes simultaneously. The lower limits of detection for this dual method were a 2 ng/mL by fluorescence and a 10 ng/mL by colorimetry for ampicillin in the milk as well as in distilled water. Because these detection limits were below the maximum residue limit of ampicillin, this aptasensor was sensitive enough to detect antibiotics in food products, such as milk and animal tissues. In addition, this dual aptasensor will be a more accurate method for antibiotics in food products as it concurrently uses two detection methods: fluorescence and colorimetry.

Aptamers and their biological applications.

Recently, aptamers have attracted the attention of many scientists, because they not only have all of the advantages of antibodies, but also have unique merits, such as thermal stability, low cost, and unlimited applications. In this review, we present the reasons why aptamers are known as alternatives to antibodies. Furthermore, several types of in vitro selection processes, including nitrocellulose membrane filtration, affinity chromatography, magnetic bead, and capillary electrophoresis-based selection methods, are explained in detail. We also introduce various applications of aptamers for the diagnosis of diseases and detection of small molecules. Numerous analytical techniques, such as electrochemical, colorimetric, optical, and mass-sensitive methods, can be utilized to detect targets, due to convenient modifications and the stability of aptamers. Finally, several medical and analytical applications of aptamers are presented. In summary, aptamers are promising materials for diverse areas, not just as alternatives to antibodies, but as the core components of medical and analytical equipment.

Aptamer-antibody hybrid ELONA that uses hybridization chain reaction to detect a urinary biomarker EN2 for bladder and prostate cancer.

We report an EN2-specific (Kd = 8.26 nM) aptamer, and a sensitive and specific enzyme-linked oligonucleotide assay (ELONA) for rapid and sensitive colorimetric detection of bladder and prostate cancer biomarker EN2 in urine. The assay relies on an aptamer-mediated hybridization chain reaction (HCR) to generate DNA nanostructures that bind to EN2 and simultaneously amplify signals. The assay can be performed within 2.5 h, and has a limit of detection of 0.34 nM in buffer and 2.69 nM in artificial urine. Moreover, this assay showed high specificity as it did not detect other urinary proteins, including biomarkers of other cancers. The proposed ELONA is inexpensive, highly reproducible, and has great chemical stability, so it may enable development of a simple, sensitive and accurate diagnostic tool to detect bladder and prostate cancers early.

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

Asymmetric shorter-duplex siRNA structures trigger efficient gene silencing with reduced nonspecific effects.

Small interfering RNAs (siRNAs) are short, double-stranded RNAs that mediate efficient gene silencing in a sequence-specific manner by utilizing the endogenous RNA interference (RNAi) pathway. The current standard synthetic siRNA structure harbors a 19-base-pair duplex region with 3' overhangs of 2 nucleotides (the so-called 19+2 form). However, the synthetic 19+2 siRNA structure exhibits several sequence-independent, nonspecific effects, which has posed challenges to the development of RNAi therapeutics and specific silencing of genes in research. In this study, we report on the identification of truncated siRNA backbone structures with duplex regions shorter than 19 bp (referred to as asymmetric shorter-duplex siRNAs or asiRNAs) that can efficiently trigger gene silencing in human cell lines. Importantly, this asiRNA structure significantly reduces nonspecific effects triggered by conventional 19+2 siRNA scaffold, such as sense-strand-mediated off-target gene silencing and saturation of the cellular RNAi machinery. Our results suggest that this asiRNA structure is an important alternative to conventional siRNAs for both functional genomics studies and therapeutic applications.

Troponin Aptamer on an Atomically Flat Au Nanoplate Platform for Detection of Cardiac Troponin I.

Well-ordered bioreceptors on atomically flat Au surfaces can be a high-performance biosensor. Cardiac troponin I proteins (cTnIs) have been regarded as a specific biomarker for acute myocardial infarction (AMI). Here, we report the accurate detection of cTnIs using an aptamer-immobilized Au nanoplate platform. The single-crystalline and atomically flat Au nanoplate was characterized by atomic force microscopy. For the precise detection of cTnI, we immobilized an aptamer that can strongly bind to cTnI onto an atomically flat Au nanoplate. Using the aptamer-immobilized Au nanoplate, cTnIs were successfully detected at a concentration of 100 aM (2.4 fg/mL) in buffer solution. Furthermore, cTnIs in serum could be identified at a concentration of 100 fM (2.4 pg/mL). The total assay time was ~7 h. Importantly, the aptamer-immobilized Au nanoplate enabled us to diagnose AMI patients accurately, suggesting the potential of the present method in the diagnosis of AMI.

Effect of E. coli MutL on the steady-state ATPase activity of MutS in the presence of short blocked end DNAs.

The effect of wild-type and mutant MutL on the steady-state ATPase activity of MutS from Escherichia coli has been investigated in the absence and presence of 22, 50, and 75 base pair hetero- and homoduplex DNAs with open and blocked ends. The steady-state ATPase activity of MutS has been measured at 37 degrees C using a spectrophotometric method. The presence of MutL did not affect appreciably on the ATPase activity of MutS in the absence of DNA or in the presence of blocked end homoduplex DNAs. However, the addition of MutL affected oppositely on the ATPase activity of MutS in the presence of G-T mismatched DNAs depending on their end status. We have also found that only the ATPase active forms of MutL increased the ATPase activity of MutS in the presence of G-T mismatched DNAs with blocked ends. The results suggest that MutL ATPase activity is required to catalyze dissociation of the MutS sliding clamps.

Crystal structures of substrate and inhibitor complexes of ribose 5-phosphate isomerase A from Vibrio vulnificus YJ016.

Ribose-5-phosphate isomerase A (RpiA) plays an important role in interconverting between ribose-5-phosphate (R5P) and ribulose-5-phosphate in the pentose phosphate pathway and the Calvin cycle. We have determined the crystal structures of the open form RpiA from Vibrio vulnificus YJ106 (VvRpiA) in complex with the R5P and the closed form with arabinose-5-phosphate (A5P) in parallel with the apo VvRpiA at 2.0 A resolution. VvRpiA is highly similar to Eschericihia coliRpiA, and the VvRpiA-R5P complex strongly resembles the E. coli RpiA-A5P complex. Interestingly, unlike the E. coli RpiA-A5P complex, the position of A5P in the VvRpiA-A5P complex reveals a different position than the R5P binding mode. VvRpiA-A5P has a sugar ring inside the binding pocket and a phosphate group outside the binding pocket: By contrast, the sugar ring of A5P interacts with the Asp4, Lys7, Ser30, Asp118, and Lys121 residues; the phosphate group of A5P interacts with two water molecules, W51 and W82.