Factors Influencing Rust (Melampsora apocyni) Intensity on Cultivated and Wild Apocynum venetum in Altay Prefecture, China.

Rust (Melampsora apocyni) on Apocynum venetum is the major constraint to the commercial development of this medicinal herb. To determine the factors influencing rust intensity (maximum disease index [DImax]), rust was investigated from 2011 to 2015 in both cultivated and wild A. venetum plants. Partial least squares path modeling (PLS-PM) was used to analyze the paths and extent of the factors related to pathogen, environment, and host that affect rust intensity. DImax exhibited considerable variations across years and study sites, with variations linked to various factors fostering disease development. PLS-PM explained 80.0 and 70.1% of variations in DImax in cultivated and wild plants, respectively. Precipitation was the key factor determining DImax in both cultivated and wild plants (path coefficient [PC] = 0.313 and 0.544, respectively). In addition, the topsoil water content in cultivated plants and the total vegetation coverage in wild plants were also critical determinants of DImax via their effects on the microclimatic factor (contribution coefficients [CC] = 0.681 and 0.989, respectively; PC = 0.831 and 0.231, respectively). In both cultivated and wild plants, host factors were mainly dominated by A. venetum density (CC = 0.989 and 0.894, respectively), and their effect on DImax via the microclimatic factor (PC = 0.841 and 0.862, respectively) exceeded that via the inoculum factor (PC = 0.705 and 0.130, respectively). However, the indirect effects led to DImax variation, while the dilution effect on host (CC = 0.154) from weed in wild plants led to the indirect effect size in wild plants of 0.200, which was lower than -0.699 in cultivated plants.

Potato spindle tuber viroid: Stability on Common Surfaces and Inactivation With Disinfectants.

The length of time Potato spindle tuber viroid (PSTVd) remained infective in extracted tomato leaf sap on common surfaces and the effectiveness of disinfectants against it were investigated. When sap from PSTVd-infected tomato leaves was applied to eight common surfaces (cotton, wood, rubber tire, leather, metal, plastic, human skin, and string) and left for various periods of time (5 min to 24 h) before rehydrating the surface and rubbing onto healthy tomato plants, PSTVd remained infective for 24 h on all surfaces except human skin. It survived best on leather, plastic, and string. It survived less well after 6 h on wood, cotton, and rubber and after 60 min on metal. On human skin, PSTVd remained infective for only 30 min. In general, rubbing surfaces contaminated with dried infective sap directly onto leaves caused less infection than when the sap was rehydrated with distilled water but overall results were similar. The effectiveness of five disinfectant agents at inactivating PSTVd in sap extracts was investigated by adding them to sap from PSTVd-infected leaves before rubbing the treated sap onto leaves of healthy tomato plants. Of the disinfectants tested, 20% nonfat dried skim milk and a 1:4 dilution of household bleach (active ingredient sodium hypochlorite) were the most effective at inactivating PSTVd infectivity in infective sap. When reverse-transcription polymerase chain reaction was used to test the activity of the five disinfectants against PSTVd in infective sap, it detected PSTVd in all instances except in sap treated with 20% nonfat dried skim milk. This study highlights the stability of PSTVd in infective sap and the critical importance of utilizing hygiene practices such as decontamination of clothing, tools, and machinery, along with other control measures, to ensure effective management of PSTVd and, wherever possible, its elimination in solanaceous crops.

First Report of Alternaria Leaf Spot Caused by Alternaria tenuissima on Blueberry (Vaccinium corymbosum) in Western Australia.

Blueberry (Vaccinium corymbosum) plants in a commercial plantation at Yanchep, Western Australia, in April and May 2013, showed a widespread leaf spotting condition. Leaf lesions were circular to irregular, light brown to gray, 1 to 5 mm in diameter, with distinct dark brownish red borders. A fungus was consistently recovered by plating surface-sterilized (1% NaOCl) sections of symptomatic leaf tissue onto water agar and sub-culturing onto potato dextrose agar (PDA). For conidial production, the fungus was grown on PDA under a 12-h/12-h dark/light photoperiod at 25°C. Fungal colonies had a dark olive color on both sides, with loose, cottony mycelium on the surface of cultures. Isolates showed morphological similarities to Alternaria tenuissima as described in other reports (1,3). Simple conidiophores ranged from 16.3 to 96.6 µm (mean 37.5 µm) and produced numerous conidia in long chains. Conidia ranged from 7.0 to 23.9 µm (mean 13.9 µm) in length and 3.9 to 7.5 µm (mean 5.7 µm) in width, contained two to five transverse septa, but only an occasional longitudinal septum was observed. Using a representative isolate, a PCR-based assay with the ITS1 and ITS4 primers was used to amplify from the 3' end of 16S rRNA, across ITS1, 5.8S rRNA, and ITS2 to the 5' end of the 26S rRNA (4). The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank (2). The sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank (Accession No. KC568287) for A. tenuissima. The relevant information for a representative isolate has been lodged in GenBank (KF408355). A conidial suspension of 2.5 × 105 conidia ml-1 from a single-spore culture was spot inoculated onto 20 leaves, ranging from recently emerged to oldest, of 6-month-old V. corymbosum Nellie Kelly plants maintained at 18/13°C 12-h/12-h day/night and >90% relative humidity for 72 h post inoculation. Symptoms were evident by 18 days post inoculation and by 24 days consisted of pale brown lesions that were mostly 2.1 to 2.5 µm in diameter and with distinct dark brownish red borders. A. tenuissima, showing morphological characteristics identical to those described above, was re-isolated from lesions to fulfill Koch's postulates. No lesions occurred on an equivalent number of leaves of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13639). A. tenuissima has been reported across Australia on a range of other hosts. However, on V. corymbosum, the pathogen has only previously been recorded in Tasmania (2009). It may also have been the cause of a leaf spotting condition on V. corymbosum recorded in Victoria (1976) and New South Wales (1984), but mistakenly listed with A. alternata as the cause. To the best of our knowledge, this is the first record of A. tenuissima on V. corymbosum in Western Australia. With 10 to 30% of leaves showing disease symptoms widely spread on many V. corymbosum plants in the commercial plantation, this pathogen could potentially adversely affect the future production of blueberries in Western Australia. References: (1) F. L. Caruso and R. C. Ramsdell, eds. Compendium of Blueberry and Cranberry Diseases. American Phytopathological Society, St. Paul, MN, 1995. (2) J. C. Kang et al. Mycol. Res. 106:1151, 2002. (3) E. G. Simmons. Mycotaxon 70:325, 1999. (4) T. J. White et al. Pages 315-322 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

First Report of Phoma glomerata Associated with the Ascochyta Blight Complex on Field Pea (Pisum sativum) in Australia.

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as "black spot disease" in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5'GTTTCCGTAGGTGAACCTGC 3') and AB28 (5'ATATGCTTAAGTTCAGCGGGT 3') were used to amplify extracted DNA from the 3' end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5' end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml-1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.

First Report of Powdery Mildew Caused by Erysiphe cruciferarum on Brassica campestris var. pekinensis, B. carinata, Eruca sativa, E. vesicaria in Australia and on B. rapa and B. oleracea var. capitata in Western Australia.

Inspection of field plantings of diverse cruciferous species, mainly oilseed varieties sown for agronomic assessment at Crawley, (31.99°S, 115.82°E), Western Australia, in September 2012, indicated the occurrence of extensive leaf and stem colonization by powdery mildew at the late flowering stage, with whitish patches 3 to 4 cm in length on stems of Brassica campestris var. pekinensis, B. carinata, B. oleracea var. capitata, B. rapa, Eruca sativa, and E. vesicaria. These patches coalesced to form a dense, white, powdery layer. Infected leaves showed signs of early senescence. Pathogenicity was demonstrated from transferring field inoculum from the most susceptible variety by pressing diseased leaves onto leaves of the six potted plant species, and incubating plants in a moist chamber for 48 hours post-inoculation (hpi) in an air-conditioned glasshouse approximating 25°C. Signs of powdery mildew were evident by 7 days post-inoculation (dpi), and well developed symptoms by 10 dpi and as observed in the field. Uninoculated control plants did not develop powdery mildew. On all inoculated species, abundant conidia typical of those produced by Erysiphe cruciferarum were observed, matching the descriptions of conidia given by Purnell and Sivanesan (3), with cylindrical conidia typically borne singly or in short chains. Mycelia were amphigenous, in patches, often spreading to become effused. Conidiophores were 3 to 4 cells, unbranched, and foot cells cylindrical. Across all host species, conidia were mostly produced singly with overall mean measured lengths 19.7 to 35.4 µm (mean 26.9 µm), and measured widths 7.1 to 12.9 µm (mean 9.7 µm), from measurements taken on 200 conidia for each of the six different species. Spore sizes measured approximated those found for E. cruciferarum by Kaur et al. (1) on B. juncea in Western Australia (viz. 21.2 to 35.4 × 8.8 to 15.9 µm), but were smaller than those reported by Purnell and Sivanesan (3) (viz. 30 to 40 × 12 to 16 µm) or by Koike and Saenz (1) (viz. 35 to 50 × 12 to 21 µm). We confirmed a length-to-width ratio >2 (mean range 2.7 to 2.8 across all six species) as found by both Purnell and Sivanesan (3) and Koike and Saenz (2). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene was carried out with universal primers ITS1 and ITS4 and PCR products from E. cruciferarum from B. oleracea var. capitata and B. rapa sequenced. BLAST analyses to compare sequences with those in GenBank showed a >99% nucleotide identity for E. cruciferarum. In Western Australia, E. cruciferarum has been recorded on B. napus var. napobrassica since 1971 (4), B. napus since 1986 (4), and on B. juncea since 2008 (1). In other regions of Australia, E. cruciferarum has been recorded on B. campestris, B. oleracea var. capitata, B. oleracea var. acephala, B. napus, B. napus var. naprobrassica, and B. rapa var. rapa. To the best of our knowledge, this is the first record of E. cruciferarum on B. campestris var. pekinensis, B. carinata, E. sativa, and E. vesicaria in Australia and on B. rapa and B. oleracea var. capitata in Western Australia. Powdery mildew epidemics on other brassicas in Western Australia are generally sporadic and it remains to be seen what the impact of this disease will be on these new host species. References: (1) P. Kaur et al. Plant Dis. 92:650, 2008. (2) S. T. Koike and G. S. Saenz. Plant Dis. 81:1093, 1997. (3) T. J. Purnell and A. Sivanesan. No. 251 in IMI Descriptions of Fungi and Bacteria, 1970. (4) R. G. Shivas. J. Royal Soc. West. Aust. 72:1, 1989.

Occurrence of Faba Bean Diseases and Determinants of Faba Bean Gall (Physoderma sp.) Epidemics in Ethiopia.

Physoderma fungal species cause faba bean gall (FBG) which devastates faba bean (Vicia faba L.) in the Ethiopian highlands. In three regions (Amahara, Oromia, and Tigray), the relative importance, distribution, intensity, and association with factors affecting FBG damage were assessed for the 2019 (283 fields) and 2020 (716 fields) main cropping seasons. A logistic regression model was used to associate biophysical factors with FBG incidence and severity. Amhara region has the highest prevalence of FBG (95.7%), followed by Tigray (83.3%), and the Oromia region (54%). Maximum FBG incidence (78.1%) and severity (32.8%) were recorded from Amhara and Tigray areas, respectively. The chocolate spot was most prevalent in West Shewa, Finfinne Special Zone, and North Shewa of the Oromia region. Ascochyta blight was found prevalent in North Shewa, West Shewa, Southwest Shewa of Oromia, and the South Gondar of Amhara. Faba bean rust was detected in all zones except for the South Gonder and North Shewa, and root rot disease was detected in all zones except South Gonder, South Wollo, and North Shewa of Amahara. Crop growth stage, cropping system, altitude, weed density, and fungicide, were all found to affect the incidence and severity of the FBG. Podding and maturity stage, mono-cropping, altitude (>2,400), high weed density, and non-fungicide were found associated with increased disease intensities. However, crop rotation, low weed infestation, and fungicide usage were identified as potential management options to reduce FBG disease.

First Report of Rice Blast (Magnaporthe oryzae) on Rice (Oryza sativa) in Western Australia.

Commercial rice crops (Oryza sativa L.) have been recently reintroduced to the Ord River Irrigation Area in northern Western Australia. In early August 2011, unusual leaf spot symptoms were observed by a local rice grower on rice cultivar Quest. A leaf spot symptom initially appeared as grey-green and/or water soaked with a darker green border and then expanded rapidly to several centimeters in length and became light tan in color with a distinct necrotic border. Isolations from typical leaf lesions were made onto water agar, subcultured onto potato dextrose agar, and maintained at 20°C. A representative culture was lodged in the Western Australian Culture Collection Herbarium, Department of Agriculture and Food Western Australia (WAC 13466) and as a herbarium specimen in the Plant Pathology Herbarium, Plant Biosecurity Science (BRIP 54721). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 (4). The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Magnaporthe oryzae B.C. Couch, the causal agent of rice blast, the most important fungal disease of rice worldwide (1). Additional sequencing with the primers Bt1a/Bt1b for the ß-tubulin gene, primers ACT-512F/ACT-783R for the actin gene, and primers CAL-228F/CAL-737R for the calmodulin gene showed 100% identity in each case with M. oryzae sequences in GenBank, confirming molecular similarity with other reports, e.g., (1). The relevant sequence information for a representative isolate has been lodged in GenBank (GenBank Accession Nos. JQ911754 for (ITS) 1 and 2; JX014265 for ß-tubulin; JX035809 for actin; and JX035808 for calmodulin). Isolates also showed morphological similarity with M. oryzae as described in other reports, e.g., (3). Spores of M. oryzae were produced on rice agar under "black light" at 21°C for 4 weeks. Under 30/28°C (day/night), 14/12 h (light/dark), rice cv. Quest was grown for 7 weeks, and inoculated by spraying a suspension 5 × 105 spores/ml onto foliage until runoff occurred. Inoculated plants were placed under a dark plastic covering for 72 h to maximize humidity levels around leaves, and subsequently maintained under >90% RH conditions. Typical symptoms of rice blast appeared within 14 days of inoculation and were as described above. Infection studies were successfully repeated and M. oryzae was readily reisolated from leaf lesions. No disease symptoms were observed nor was M. oryzae isolated from water-inoculated control rice plants. There have been previous records of rice blast in the Northern Territory (2) and Queensland, Australia (Australian Plant Pest Database), but this is the first report of M. oryzae in Western Australia, where it could potentially be destructive if conditions prove conducive. References: (1) B. C. Couch and L. M. Kohn. Mycologia 94:683, 2002; (2) J. B. Heaton. The Aust. J. Sci. 27:81, 1964; (3) C. V. Subramanian. IMI Descriptions of Fungi and Bacteria No 169, Pyricularia oryzae, 1968; (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, New York, 1990.

First Report of Sarocladium oryzae Causing Sheath Rot on Rice (Oryza sativa) in Western Australia.

Rice (Oryza sativa L.) has been grown in the Ord River Irrigation Area (ORIA) in northern Western Australia since 1960. In 2011, a sheath rot of rice was observed in the ORIA. Symptoms were variable, appearing as either (i) oblong pale to dark brown lesions up to 3 cm length, (ii) lesions with pale grey/brown centers and with dark brown margins, or (iii) diffuse dark or reddish brown streaks along the sheath. Lesions enlarged and coalesced, often covering the majority of the leaf sheath, disrupting panicle emergence. Isolations from small pieces of infested tissues from plants showing sheath rot symptoms were made onto water agar, subcultured onto potato dextrose agar, cultures maintained at 20°C, and a representative culture lodged both in the Western Australian Culture Collection maintained at the Department of Agriculture and Food Western Australia (as WAC 13481) and in the culture collection located at the DAFF Plant Pathology Herbarium (as BRIP 54763). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 according to the published protocol (4). The DNA PCR products from a single isolate were sequenced and BLAST analyses used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Sarocladium oryzae (Sawada) W. Gams & D. Hawksworth. Isolates showed morphological (e.g., conidiophore and conidia characteristics) (2) and molecular (1) similarities with S. oryzae as described in other reports. The relevant sequence information for a representative isolate was lodged in GenBank (GenBank Accession No. JQ965668). Spores of S. oryzae were produced on rice agar under "black light" at 22°C to induce sporulation over 4 weeks. Under conditions of 30/28°C (day/night), 14/12 h (light/dark), rice cv. Quest, grown for 11 weeks until plants reached the tillering stage, was inoculated by spraying a suspension 5 × 107 spores/ml of the same single isolate onto foliage until runoff occurred. Inoculated plants were placed under a dark plastic cover for 72 h to maximize humidity levels around leaves and subsequently maintained under >90% relative humidity conditions. Symptoms of sheath rot as described in (i) and (ii) above appeared by 14 days after inoculation, with lesions up to 23 cm long by 15 days post-inoculation. Severe disease prevented young panicles from emerging. Infection studies were successfully repeated and S. oryzae was reisolated from leaf lesions 1 week after lesion appearance. No disease was observed on water-inoculated control rice plants. There have been records of S. oryzae on rice in New South Wales in the early 1980s (3) and in 2006 to 2007 (Australian Plant Pest Database), but to our knowledge, this is the first report of this pathogen in Western Australia. References: (1) N. Ayyadurai et al. Cur. Microbiol. Mycologia 50:319, 2005. (2) B. L. K. Brady. No. 673 in: IMI Descriptions of Fungi and Bacteria, 1980. (3) D. Phillips et al. FAO Plant Prot. Bull. 40:4, 1992. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

First Report of Phoma herbarum on Tedera (Bituminaria bituminosa var. albomarginata) in Australia.

Tedera (Bituminaria bituminosa (L.) C.H. Stirton var. albomarginata) has been successfully established across the mixed-farming (wheat-sheep) region of Western Australia because this species has remarkable drought tolerance and can survive the dry-summer period with strong retention of green leaf. A leaf spot symptom involving pale brown lesions with distinct dark brown margins had been observed in genetic evaluation plots of tedera at Medina and Mount Barker, Western Australia, and a Phoma sp. was isolated. Single-spore isolations of a typical Phoma sp. isolate were made onto potato dextrose agar and maintained at 20°C, and a representative culture has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13435). Amplification of the internal transcribed spacer (ITS) 1 and ITS2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 according to published protocol (3). The DNA PCR products were sequenced and BLAST analyses was used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Phoma herbarum. Isolates also showed morphological (e.g., 1) and molecular (e.g., 2) similarities with P. herbarum as described in other reports. The relevant sequence information for a representative isolate has been lodged in GenBank (Accession No. JQ282910). A conidial suspension of 107 conidia ml-1 from a single-spore culture was spray inoculated onto foliage of 6-week-old tedera plants maintained under >90% relative humidity conditions for 72-h postinoculation. Symptoms evident by 10 days postinoculation consisted of pale brown lesions, mostly 1.5 to 4 mm in diameter, which developed a distinct, dark brown margin. Occasional lesions also showed a distinct chlorotic halo extending 1 to 1.5 mm outside the boundary of the lesion. Infection studies were successfully repeated twice and P. herbarum was readily reisolated from infected foliage. No disease was observed on and no P. herbarum were isolated from water-inoculated control plants. Except for a recent published report of P. herbarum on field pea (Pisum sativum L.) (2), this pathogen has only been noted in the Australian Plant Pest Database as occurring on lucerne (Medicago sativa L.) and soybean (Glycine max (L.) Merr.) in Western Australia in 1985 and on a Protea sp. in 1991. To our knowledge, this is the first published report of P. herbarum as a pathogen on tedera in Australia or elsewhere. That P. herbarum occurs on other hosts in Australia and has a wide host range elsewhere together suggest its potential to be a pathogen on a wider range of host genera and species. References: (1) G. L. Kinsey. No. 1501 in: IMI Descriptions of Fungi and Bacteria. 2002. (2) Y. P. Li et al. Plant Dis. 95:1590, 2011. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

First Report of Black Spot Caused by Boeremia exigua var. exigua on Field Pea in Australia.

Black spot is a major disease of field pea (Pisum sativum L.) production across southern Australia. Known causal agents in Australia include one or more of Mycosphaerella pinodes (Berk. & Bloxam) Vestergr., Phoma medicaginis var. pinodella (L.K. Jones), Ascochyta pisi Lib., or P. koolunga (Davidson, Hartley, Priest, Krysinska-Kaczmarek, Herdina, McKay & Scott) (2), but other pathogens may also be associated with black spot symptoms. Black spot generally occurs on most plants and in most pea fields in Western Australia (W.A.), and during earlier winter/spring surveys of blackspot pathogens, some isolates were tentatively allocated to P. medicaginis var. pinodella despite different cultural characteristics on potato dextrose agar (PDA). Recently, single-spore isolations of a single culture each from an infested pea crop at Medina, Moora, and Mt. Barker in W.A. were made onto PDA. A PCR-based assay with TW81 and AB28 primers was used to amplify from the ITS-5.8S rDNA region. Purified DNA products were sequenced for the three isolates and then BLASTn was used to compare sequences with those in GenBank. Our sequences (GenBank Accession Nos. JN37743, JN377439, and JN377438) had 100% nucleotide identity with P. exigua Desm. var. exigua accessions (GI13385450, GI169894028, and GI189163921), an earlier synonym of what is now known as Boeremia exigua var. exigua ([Desm.] Aveskamp, Gruyter & Verkley) (1). Davidson et al. (2) used the same primers to identify P. koolunga, but none of our isolates were P. koolunga. A suspension of 107 conidia ml-1 of each representative isolate was inoculated onto foliage of 15-day-old field pea cv. Dundale plants and maintained at >90% relative humidity for 72 h postinoculation. Control plants inoculated with just water remained symptomless. Brown lesions were evident by 8 to 10 days postinoculation and mostly 1 to 3 mm in diameter. B. exigua var. exigua was readily reisolated from infected leaves. Isolates have been lodged in the W.A. Culture Collection Herbarium maintained at the Department of Agriculture and Food W.A. (Accession Nos. WAC13500, WAC13502, and WAC13501 from Medina, Moora, and Mt. Barker, respectively). Outside Australia, its synonym P. exigua var. exigua is a known pathogen of field pea (4), other legumes including common bean (Phaseolus vulgaris L.) (4) and soybean (Glycine max [L.] Merr.) (3), and is known to produce phytotoxic cytochalasins. In eastern Australia, P. exigua var. exigua has been reported on common bean (1930s and 1950s), phasey bean (Macroptilium lathyroides [L.] Urb.) and siratro (M. atropurpureum (DC.) Urb.) (1950s and 1960s), mung bean (Vigna radiata [L.] Wilczek.) (1960s), ramie (Boehmeria nivea [L.] Gaudich.) (1939), potato (Solanum tuberosum L.) (1980s), and pyrethrum (Tanacetum cinerariifolium [Trevir.] Schultz Bip.) (2004 and 2007) (Australian Plant Pest Database). To our knowledge, this the first report of B. exigua var. exigua on field pea in Australia, and because of its potential to be a significant pathogen on field pea, warrants further evaluation. References: (1) M. M. Aveskamp et al. Stud. Mycol. 65:1, 2010. (2) J. A. Davidson et al. Mycologia 101:120, 2009. (3) L. Irinyi et al. Mycol. Res. 113:249, 2009. (4) J. Marcinkowska. Biul. Inst. Hod. Aklim. Rosl. 190:169, 1994.

First Report of Phoma herbarum on Field Pea (Pisum sativum) in Australia.

Black spot disease on field pea (Pisum sativum) in Australia is generally caused by one or more of the four fungi: Mycosphaerella pinodes (anamorph Ascochyta pinodes), Phoma medicaginis var. pinodella (synonym Phoma pinodella), Ascochyta pisi, and Phoma koolunga (1,2,4). However, in 2010 from a field pea blackspot disease screening nursery at Medina, Western Australia, approximately 25% of isolates were a Phoma sp. that was morphologically different to Phoma spp. previously reported on field pea in Western Australia, while the remaining 75% of isolates were either M. pinodes or P. medicaginis var. pinodella. Single-spore isolations of 23 isolates of this Phoma sp. were made onto potato dextrose agar. A PCR-based assay with the TW81 and AB28 primers was used to amplify from the 3' end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5' end of the 28S rDNA. The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank for P. herbarum. Isolates also showed morphological similarities to P. herbarum as described in other reports (e.g., 3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. JN247437). The same primers were used by Davidson et al. (2) to identify P. koolunga, but none of our 23 isolates were P. koolunga. A conidial suspension of 107 conidia ml-1 from a single-spore culture was spray inoculated onto foliage of 10-day-old Pisum sativum cv. Dundale plants maintained under >90% relative humidity conditions for 72 h postinoculation. Symptoms evident by 11 days postinoculation consisted of pale brown lesions that were mostly 1.5 to 2 mm long and 1 to 1.5 mm wide. Approximately 50% of lesions showed a distinct chlorotic halo extending 1 to 2 mm outside the boundary of the lesion. P. herbarum was readily reisolated from infected foliage. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13499). Outside of Australia, P. herbarum, while generally considered a soilborne opportunistic pathogen, has been reported on a wide range of species, including field pea (3). Molecular analysis of historical isolates collected from field pea in Western Australia, mostly in the late 1980s, did not show any incidence of P. herbarum, despite this fungus being reported on alfalfa (Medicago sativa) and soybean (Glycine max) in Western Australia in 1985 (Australian Plant Pest Database). In Western Australia, this fungus has also been recorded on a Protea sp. in 1991 and on Arabian pea (Bituminaria bituminosa) in 2010 (Australian Plant Pest Database). To our knowledge, this is the first report of P. herbarum as a pathogen on field pea in Australia. These previous reports of P. herbarum on other hosts in Western Australia and the wide host range of P. herbarum together suggest the potential for this fungus to be a pathogen on a wider range of genera/species than field pea. References: (1) T. W. Bretag and M. Ramsey. Page 24 in: Compendium of Pea Diseases and Pests. 2nd ed. The American Phytopathologic Society, St Paul, MN, 2001. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. L. Kinsey. Phoma herbarum. No 1501. IMI Descriptions of Fungi and Bacteria, 2002. (4) T. L. Peever et al. Mycologia 99:59, 2007.

Infection processes and involvement of defense-related genes in the expression of resistance in cultivars of subterranean clover (Trifolium subterraneum) to Phytophthora clandestina.

Studies on infection processes and gene expression were done to determine differential responses of cultivars of Trifolium subterraneum resistant and susceptible to infection by races of Phytophthora clandestina. In the infection process study, one race was inoculated onto the roots of T. subterraneum cvs. Woogenellup and Junee (compatible or incompatible interactions, respectively). There were no differences in relation to the processes of cyst attachment, germination, and hyphal penetration. There were, however, major differences in infection progression observed post-penetration between compatible and incompatible interactions. In susceptible cv. Woogenellup, hyphae grew into the vascular bundles and produced intercellular antheridia and oogonia in the cortex and stele by 4 days postinoculation (dpi), oospores in the cortex and stele by 8 dpi, when sporangia were evident on the surface of the root. Infected taproots were discolored. Early destruction of taproots prevented emergence of lateral roots. Roots of resistant cv. Junee showed no oospores or sporangia and no disease at 8 dpi. In the gene expression studies, two races of P. clandestina were inoculated onto three cultivars of T. subterraneum. Results showed that three genes known to be associated with plant defense against plant pathogens were differentially expressed in the roots during compatible and incompatible interactions. Phenylalanine ammonia lyase and chalcone synthase genes were activated 4 h postinoculation (hpi) and cytochrome P450 trans-cinnamic acid 4-monooxygenase gene was activated 8 hpi in the incompatible interactions in cvs. Denmark and Junee following inoculation with Race 177. In contrast, in compatible interactions in cv. Woogenellup, there were no significant changes in the activation of these three genes following inoculation, indicating that these three genes were associated with the expression of resistance to Race 177 of the pathogen by the host. To confirm this result, in the second test, cv. Woogenellup was challenged by Race 000 of P. clandestina. In this incompatible interaction, cv. Woogenellup was resistant and expressed highly all three genes in the manner similar to the incompatible interactions observed in the first test.

Molecular Genetic Characterization of Olpidium virulentus Isolates Associated with Big-Vein Diseased Lettuce Plants.

Lettuce plants showing symptoms of lettuce big-vein disease were collected from fields in the Perth Metropolitan region of southwest Australia. When root extracts from each plant were tested by polymerase chain reaction (PCR) using primers specific to the rDNA internal transcribed spacer (ITS) region of Olpidium brassicae and O. virulentus, only O. virulentus was detected in each of them. The nucleotide sequences of the complete rDNA ITS regions of isolates from five of the root samples and 10 isolates of O. virulentus from Europe and Japan showed 97.9 to 100% identities. However, with the six O. brassicae isolates, their identities were only 76.9 to 79.4%. On phylogenetic analysis of the complete rDNA-ITS region sequences of the five Australian isolates and 10 others, the Australian isolates fitted within two clades of O. virulentus (I and II), and within clade I into two of its four subclades (Ia and Id). Japanese isolates had greatest sequence diversity fitting into both clades and into all of clade I subclades except Ib, while European isolates were restricted to subclades Ib and Id. When the partial rDNA-ITS region sequences of two additional southwest Australian isolates, four from Europe, and four from the Americas were included in the analyses, the Australian isolates were within O. virulentus subclades Ia and Id, the European isolates within subclade Ic, and the American isolates within subclades Ia and Ib. These findings suggest that there may have been at least three separate introductions of O. virulentus into the isolated Australian continent since plant cultivation was introduced following its colonization by Europeans. They also have implications regarding numbers of different introductions to other isolated regions. Lettuce big-vein associated virus and Mirafiori lettuce big-vein virus were both detected when symptomatic lettuce leaf tissue samples corresponding to the root samples from southwest Australia were tested using virus-specific primers in reverse transcription-PCR, so presence of both viruses was associated with O. virulentus occurrence.

Occurrence of a new subclade of Leptosphaeria biglobosa in Western Australia.

Stem canker of crucifers is caused by an ascomycete species complex comprising of two main species, Leptosphaeria maculans and L. biglobosa. These are composed of at least seven distinct subclades based on biochemical data or on sequences of internal transcribed spacer (ITS), the mating type MAT1-2 or fragments of actin or beta-tubulin genes. In the course of a wide-scale characterization of the race structure of L. maculans from Western Australia, a few isolates from two locations failed to amplify specific sequences of L. maculans, i.e., the mating-type or minisatellite alleles. Based on both pathogenicity tests and ITS size, these isolates were classified as belonging to the L. biglobosa species. Parsimony and distance analyses performed on ITS, actin and beta-tubulin sequences revealed that these isolates formed a new L. biglobosa subclade, more related to the Canadian L. biglobosa 'canadensis' subclade than to the L. biglobosa 'australensis' isolates previously described in Australia (Victoria). They are termed here as L. biglobosa 'occiaustralensis'. These isolates were mainly recovered from resistant oilseed rape cultivars that included the Brassica rapa sp. sylvestris-derived resistance source, but not from the susceptible cv. Westar. The pathogenicity of L. biglobosa 'occiaustralensis' to cotyledons of most oilseed rape genotypes was higher than that of L. biglobosa 'canadensis' or L. biglobosa 'australensis' isolates.

First Report of Powdery Mildew Caused by Erysiphe cruciferarum on Brassica juncea in Australia.

In Australia, Brassica juncea (L.) Czern & Coss (Indian mustard) has the potential as a more drought-tolerant oilseed crop than the B. napus L., with the first canola-quality B. juncea varieties released in Australia in 2006 and first sown for commercial production in 2007. Increased production of B. juncea is expected to result in the appearance of diseases previously unreported in Australia. In the spring of 2007 at the University of Western Australia field plots at Crawley (31.99°S, 115.82°E), Western Australia, plants of B. juncea genotypes from Australia and China had extensive stem colonization by powdery mildew at the end of the flowering period, with whitish patches ranging in size from 3 mm to 3 cm long. These patches coalesced to form a dense, white, powdery layer as they expanded. Pathogenicity was demonstrated by gently pressing infected stems containing abundant sporulation onto leaves of potted B. juncea seedlings of variety JM-18, incubating the plants in a moist chamber for 48 h, and then maintaining the plants in a controlled-environment room at 18/13°C for day/night. Signs of powdery mildew appeared at 7 days after inoculation, and by 10 days, it was well developed. Uninoculated control plants did not have powdery mildew. When symptomatic plants were examined, abundant conidia were typical of Erysiphe cruciferarum Opiz ex Junell, with cylindrical conidia borne singly or in short chains as described previously (2). Mycelia were amphigenous, in patches, and often spreading to become effused. Conidiophores were straight, foot cells were cylindrical, and conidia were mostly produced singly and measured 21.2 to 35.4 (mean 26.7 µm) × 8.8 to 15.9 µm (mean 11.9 µm) from measurements of 100 conidia. The spore size that we measured approximated what was found for E. cruciferarum (2) (30 to 40 × 12 to 16 µm), since we found 35 and 50% of spores falling within this range in terms of length and width, respectively. Conidia were, however, generally smaller in size than that reported on broccoli raab in California (1) (35 to 50 × 12 to 21 µm). We confirmed a length-to-width ratio greater than 2 as was found previously (1,2). Infected leaves showed signs of early senescence. While powdery mildew caused by E. cruciferarum is an important disease of B. juncea in India where yield losses as much as 17% have been reported (4), its potential impact in Australia is yet to be determined. To our knowledge, this is the first record of E. cruciferarum on B. juncea in Australia. In Western Australia, E. cruciferarum has been recorded on B. napus (oilseed rape) since 1986 and on B. napus L. var. napobrassica (L.) Reichenb. (swede) since 1971 (3). In other regions of Australia, it has been recorded on B. rapa in Queensland since 1913 and on B. napus (oilseed rape) in South Australia since 1973. References: (1) S. T. Koike and G. S. Saenz. Plant Dis. 81:1093, 1997. (2) T. J. Purnell and A. Sivanesan. No 251 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1970. (3) R. G. Shivas. J. R. Soc. West. Aust. 72:1, 1989. (4) A. K. Shukla et al. Manual on Management of Rapeseed-Mustard Diseases. National Research Centre on Rapeseed-Mustard, Bharatpur, India, 2003.

Stabilization of Resistance to Leptosphaeria maculans in Brassica napus-B. juncea Recombinant Lines and Its Introgression into Spring-Type Brassica napus.

The value of Katanning Early Maturing (KEM) breeding lines from Western Australia, derived from Brassica napus × B. juncea crosses, was assessed as a source of germplasm for resistance to blackleg disease (caused by Leptosphaeria maculans) in spring-type oilseed rape cultivars. The stability of blackleg resistance in these KEM lines was related to key cytological characteristics to determine why there are poor levels of introgression of this resistance into progeny. Promising recombinant KEM lines were crossed with the spring-type B. napus cv. Dunkeld, which has useful polygenic resistance to blackleg, and screened for resistance. The lines were analyzed cytologically for pairing of bivalents in each generation to aid in the selection of stable recombinant lines. KEM recombinant lines showing regular meiotic behavior and a high level of blackleg resistance were obtained for the first time. We also showed that the stable introgression of the B. juncea resistance from the KEM lines into a 'Dunkeld' background was possible. Inoculation of selfing and backcross populations with isolates of L. maculans having different AvrLm genes indicated that the B. juncea resistance gene, Rlm6, had been introgressed into a B. napus spring-type cultivar carrying polygenic resistance. The combination of both resistances would enhance the overall effectiveness of resistance against L. maculans. This is clearly needed in Australia and France where cultivars relying upon single dominant gene-based resistance for their effectiveness have proved not durable.

Epidemiology of Blackleg (Leptosphaeria maculans) of Canola (Brassica napus) in Relation to Maturation of Pseudothecia and Discharge of Ascospores in Western Australia.

ABSTRACT The timing of maturation of pseudothecia and discharge of ascospores of the blackleg fungus (Leptosphaeria maculans) is critical in relation to infection early in the cropping season of canola. During 1998 to 2000, development of pseudothecia was investigated on residues of the previous year's canola crop collected from four agroclimatically different locations: Mount Barker (southern high rainfall), Wongan Hills (central medium rainfall), Merredin (central low rainfall), and East Chapman (northern low rainfall) in Western Australia. The pseudothecia matured on residues at different times after harvest in various regions. In general, pseudothecia maturity occurred earlier in the high-rainfall areas than in medium- and low-rainfall areas. An ascospore discharge pattern was investigated from residues of crop from the previous year (6-month-old residues) at three locations-Mount Barker, Wongan Hills, and East Chapman in Western Australia-and from 18-month-old residues that were burnt and raked in the previous year at Mount Barker and East Chapman. Ascospore discharge commenced earlier in high-rainfall (>450 mm) areas (Mount Barker) and late in northern low-rainfall (<325 mm) areas (East Chapman). The major ascospore showers took place during May (late autumn) and June (early winter) at Mount Barker and during July and August (mid- to late winter) at East Chapman. The number of ascospores discharged was extremely low at East Chapman compared with Mount Barker. At both locations, the number of ascospores discharged from 18-month-old residues that were raked and burnt in the previous year were only approximately 10% of those discharged from previous year's residues left undisturbed. The discharge of ascospores on any given day was negatively correlated with accumulated temperatures, maximum temperature, evaporation, minimum and maximum soil temperatures, and solar radiation and was positively correlated with the minimum temperature, rain, and minimum relative humidity. This is the first report describing how pseudothecia mature on residues in different rainfall areas in Western Australia, and it potentially can be used in developing a forecasting system to avoid the synchronization of major ascospore showers with the maximum susceptibility period of canola seedlings.

Analysis of Leptosphaeria maculans Race Structure in a Worldwide Collection of Isolates.

ABSTRACT Leptosphaeria maculans, the causal agent of stem canker of oilseed rape, develops gene-for-gene interactions with its hosts. To date, eight L. maculans avirulence (Avr) genes, AvrLm1 to AvrLm8, have been genetically characterized. An additional Avr gene, AvrLm9, that interacts with the resistance gene Rlm9, was genetically characterized here following in vitro crosses of the pathogen. A worldwide collection of 63 isolates, including the International Blackleg of Crucifers Network collection, was genotyped at these nine Avr loci. In a first step, isolates were classified into pathogenicity groups (PGs) using two published differential sets. This analysis revealed geographical disparities as regards the proportion of each PG. Genotyping of isolates at all Avr loci confirmed the disparities between continents, in terms of Avr allele frequencies, particularly for AvrLm2, AvrLm3, AvrLm7, AvrLm8, and AvrLm9, or in terms of race structure, diversity, and complexity. Twenty-six distinct races were identified in the collection. A larger number of races (n = 18) was found in Australia than in Europe (n = 8). Mean number of virulence alleles per isolate was also higher in Australia (5.11 virulence alleles) than in Europe (4.33) and Canada (3.46). Due to the diversity of populations of L. maculans evidenced here at the race level, a new, open terminology is proposed for L. maculans race designation, indicating all Avr loci for which the isolate is avirulent.

First Report of White Leaf Spot Caused by Pseudocercosporella capsellae on Brassica juncea in Australia.

Brassica juncea (L.) Czern & Coss (mustard) has potential as a more drought-tolerant oilseed crop than the Brassica napus, and the first two canola-quality B. juncea cultivars will be sown as large strip trials across Australia in 2005. This will allow commercial evaluation of oil and meal quality and for seed multiplication for the commercial release Australia-wide in 2006. Inspection of experimental B. juncea field plantings at Beverley (32°6'30″S, 116°55'22″E), and Wongan Hills (30°50'32″S, 116°43'33″E), Western Australia in September 2004 indicated the occurrence of extensive leaf spotting during B. juncea flowering. Symptoms of this disease included as many as 15 or more grayish white-to-brownish spot lesions per leaf, often with a distinct brown margin. Some elongate grayish stem lesions were also observed as reported earlier for B. napus oilseed rape (1). When affected materials were incubated in moist chambers for 48 h, abundant conidia typical of Pseudocercosporella capsellae (Ellis & Everh.) Deighton were observed that matched the descriptions of conidia given by Deighton (2) and those on B. napus in Western Australia (1). Five single-spore cultures from lesions were grown on water agar (WA) where the colonies characteristically produced purple-pink pigment in the agar after 2 weeks growth in an incubator maintained at 20°C with a 12-h photoperiod (3). Since agar cultures of P. capsellae rarely produce conidia (3), this observation helped with the verification of the cultures. Mycelial inoculum from these cultures was used to inoculate cotyledons of 50 7-day-old plants of B. juncea to satisfy Koch's postulates. Small pieces of mycelia were teased out from the surface of the growing margin of potato dextrose agar (PDA) cultures and inoculated onto both lobes of each cotyledon and plants incubated in a 100% humidity chamber for 48 h within a controlled environment room maintained at 20/15°C (day/night) with a 12-h photoperiod. After 2 weeks, lesions 5 to 8 mm in diameter were observed on the cotyledons. There were no symptoms on control plants that were treated with water only. Lesions on infected cotyledons incubated on moist filter paper for 24 h produced abundant cylindrical conidia showing 2 to 3 septa measuring 42.9 to 71.4 µm long and 2.9 to 3.1 µm wide. Single-spore isolations from these conidia produced typical P. capsellae colonies showing purple-pink pigments in WA, and dark, compacted, and slow-growing colonies with a dentate margin on PDA. White leaf spot caused by P. capsellae is an important disease of crucifers worldwide, but to our knowledge, this is the first report of P. capsellae on B. juncea in Australia. In Western Australia, P. capsellae occurs on B. napus oilseed rape (1) and in 1956, 1984, and 1987, it was recorded on B. rapa, B. oleracea, and B. chinensis, respectively (4), and on the same range of Brassica hosts in other regions of Australia. References: (1) M. J. Barbetti and K. Sivasithamparam. Aust. Plant Pathol.10:43, 1981. (2) F. C. Deighton. Commonw. Mycol. Inst. Mycol. Pap. 133:42, 1973. (3) S. T. Koike. Plant Dis. 80:960, 1996. (4) R. G. Shivas. J. R. Soc. West. Aust. 72:1, 1989.

First Report of an Alternaria Leaf Spot Caused by Alternaria brassicae on Crambe abyssinicia in Australia.

Crambe abyssinicia Hochst. is grown sporadically worldwide for its value as a source of high erucic acid industrial oils and secondary commercial products. While there is increasing interest in cropping C. abyssinicia in Australia, for these potentials and also as a source of oil for biodiesel production, currently, there have been no commercial crops of this species. In September 2004, inspection of a small experimental field crop in Beverley, Western Australia indicated the presence of significant leaf spotting just prior to commencement of flowering. The symptoms of this disease included as many as 10 to 15 spot lesions per leaf that were generally rounded and varied between 0.5 to 11 mm in diameter. Clusters of these lesions were often associated with chlorosis of the region of leaves where they occurred. More than 95% of plants inspected showed these symptoms. When affected leaves were incubated in moist chambers, typical conidia of Alternaria brassicae (Berk.) Sacc. were observed. The description of these conidia matched that of the Commonwealth Mycological Institute for this pathogen (1) showing obclavate conidia 105 to 210 µm long and 20 to 30 µm thick, with 11 to 15 transverse septa and 0 to 3 longitudinal or oblique septa, predominantly with a pronounced beak 5 to 8 µm thick extending 0.3 to 0.5 µm of the length of the conidium. Single-spore isolations were made onto potato dextrose agar. Subcultures of these isolates were identified using a polymerase chain reaction (PCR)- based assay (2). This assay involved the use of two sets of A. brassicae-specific primers selected for conventional and real-time PCR. The colonies were confirmed to belong to A. brassicae. In a pathogenicity test to confirm Koch's postulates, single-spore isolates were inoculated onto cotyledons and leaves of 10-day-old C. abyssinicia seedlings. Symptoms on inoculated plants appeared within a period of 14 days of inoculation, matching those found on the affected plants in the field, and A brassicae was reisolated. A. brassicae causes an important worldwide disease of crucifers, for example, it can be a devastating disease of rapeseed and the other cruciferous crops in the United States and Canada. Since A. brassicae has already been reported on other species of crucifers Australia-wide, it may pose a threat to any potential Crambe spp. industry in this country. References: (1) M. B. Ellis No. 162 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, England, 1966. (2) T. Guillemette et al. Plant Dis. 88:490, 2004.