Efficacy of different methods for detecting the onset of ovarian cyclicity in post-partum Murrah buffaloes.

This study was designed to investigate the sensitivity and specificity of three methods for detecting the onset of cyclicity in post-partum Murrah buffaloes. The methods investigated were visual signs, transrectal ultrasonography, and serum progesterone (P4) assay. For this study, 102 post-partum Murrah buffalo cows were grouped for monitoring their ovarian activity. The first group of buffaloes was between 26 and 35 days post-partum. Thereafter, the buffalo cows that calved were grouped after every 10 days for the study sample. Thus, the study animals were adjudged between 26 and 35, 36-45, 46-55, 56-65, 66-75, 76-85, and 86-95 days post-partum with an average of 30, 40, 50, 60, 70, 80, and 90 days post-partum, respectively. Visual estrus signs were monitored twice daily, and simultaneously, ultrasound examination was carried out at 10 days interval for accessing the presence of corpus luteum (CL). Serum P4 was estimated in the animals which were adjudged cyclic by ultrasound examination, and the assay was repeated after 10 days. The buffalo cows in estrus were inseminated artificially, and pregnancy status was assessed after 30 days post-insemination. In this study, the sensitivity and specificity of visual observation were low (39.37 and 70.73%, respectively) when compared to P4 assay (98.80 and 96.47%) and ultrasound examination (single, 97.59 and 97.59%; double, 100 and 100%), respectively. Furthermore, the sensitivity and specificity of single and double ultrasound examination and P4 assay were comparable. In conclusion, this study reports that single and double ultrasound examination and P4 assay are more efficient than visual observation in detecting the onset of ovarian cyclicity in post-partum Murrah buffaloes.

Estimation of endogenous levels of osteopontin, total antioxidant capacity and malondialdehyde in seminal plasma: Application for fertility assessment in buffalo (Bubalus bubalis) bulls.

This study was attempted to identify subfertile bulls by quantifying the endogenous levels of osteopontin (OPN), total antioxidant capacity (TAC) and malondialdehyde (MDA) in seminal plasma of buffalo bulls. On the basis of conception rate, buffalo bulls were classified into two groups: high-fertile (conception rate >50%) and subfertile bulls (conception rate <40%). A total of 100 ejaculates (10 ejaculates from each bull) were collected through artificial vagina method. The concentration of OPN, TAC and catalase (CAT) of high-fertile bulls was found to be higher (p < .05) than that of subfertile bulls. Further, MDA level in seminal plasma was found to be lower (p < .05) in high-fertile bulls compared with subfertile bulls. The fertility status had no effect on the superoxide dismutase (SOD) concentration in seminal plasma of both the groups. The levels of OPN (r = .678, p = 0.013) and TAC (r = .648, p = .042) were found to be positively correlated with bull fertility and the level of MDA (r = -.718, p = .019) was found to be negatively correlated with bull fertility. However, the fertility of bulls was not found to be significantly correlated with SOD, CAT and sperm motility. In conclusion, seminal OPN, TAC and MDA tended to be more realistic in identification of subfertile bulls from breeding herds.

Relationship of temperament with oestrous behaviour, resumption of ovarian cyclicity and milk yield in post-partum Murrah buffaloes.

This study was designed to investigate the relationship of temperament with oestrus, resumption of ovarian cyclicity and milk yield in post-partum buffaloes. For this study, 102 post-partum Murrah buffaloes were observed for temperament in open paddock and during milking. Based on the temperament score (1-5 score), they were classified into docile, slightly restless, restless, aggressive and nervous. Oestrous behaviour was monitored twice daily in all the buffaloes along with milk yield (weekly), body weight (BW) and body condition score (BCS) at day 0, 30, 60 and 90 post-partum. Based on the temperament score, the number of buffaloes classified as docile, slightly restless, restless and aggressive was 37 (36.27%), 28 (27.45%), 30 (29.41%) and 7 (6.86%), respectively, but none under nervous category. Number of buffaloes resuming cyclicity in various temperaments groups were as follows: docile (n = 35; 94.59%), slightly restless (n = 22; 78.57%), restless (n = 20; 66.67%) and aggressive (n = 7; 85.71%). Temperament was not correlated (p = .128; r=-.152) with oestrous behaviour. But, temperament was correlated (p < .0001; r = .384) with the resumption of cyclicity as docile and slightly restless buffaloes resumed cyclicity (p < .0016) earlier. Temperament of buffaloes was weakly correlated (p = .0017; r=-.306) with milk production with higher (p < .0358) total milk yield in docile (1022 ± 23.75 kg) and slightly restless buffaloes (948 ± 35.86 kg) as compared to other temperament groups. In summary, temperament of post-partum buffaloes was related with resumption of ovarian cyclicity and milk yield, but not oestrous behaviour.

Changing patterns and widening of antibiotic resistance in Shigella spp. over a decade (2000-2011), Andaman Islands, India.

This study is a part of the surveillance study on childhood diarrhoea in the Andaman and Nicobar Islands; here we report the drug resistance pattern of recent isolates of Shigella spp. (2006-2011) obtained as part of that study and compare it with that of Shigella isolates obtained earlier during 2000-2005. During 2006-2011, stool samples from paediatric diarrhoea patients were collected and processed for isolation and identification of Shigella spp. Susceptibility to 22 antimicrobial drugs was tested and minimum inhibitory concentrations were determined for third-generation cephalosporins, quinolones, amoxicillin-clavulanic acid combinations and gentamicin. A wide spectrum of antibiotic resistance was observed in the Shigella strains obtained during 2006-2011. The proportions of resistant strains showed an increase from 2000-2005 to 2006-2011 in 20/22 antibiotics tested. The number of drug resistance patterns increased from 13 in 2000-2005 to 43 in 2006-2011. Resistance to newer generation fluoroquinolones, third-generation cephalosporins and augmentin, which was not observed during 2000-2005, appeared during 2006-2011. The frequency of resistance in Shigella isolates has increased substantially between 2000-2006 and 2006-2011, with a wide spectrum of resistance. At present, the option for antimicrobial therapy in shigellosis in Andaman is limited to a small number of drugs.

Shigellosis in Bay of Bengal Islands, India: clinical and seasonal patterns, surveillance of antibiotic susceptibility patterns, and molecular characterization of multidrug-resistant Shigella strains isolated during a 6-year period from 2006 to 2011.

This study aims to determine the clinical features and seasonal patterns associated with shigellosis, the antimicrobial resistance frequencies of the isolates obtained during the period 2006-2012 for 22 antibiotics, and the molecular characterization of multidrug-resistant strains isolated from endemic cases of shigellosis in the remote islands of India, with special reference to fluoroquinolone and third-generation cephalosporins resistance. During the period from January 2006 to December 2011, stool samples were obtained and processed to isolate Shigella spp. The isolates were evaluated with respect to their antibiotic resistance pattern and various multidrug resistance determinants, including resistance genes, quinolone resistance determinants, and extended-spectrum ß-lactamase (ESBL) production. Morbidity for shigellosis was found to be 9.3 % among children in these islands. Cases of shigellosis occurred mainly during the rainy seasons and were found to be higher in the age group 2-5 years. A wide spectrum of resistance was observed among the Shigella strains, and more than 50 % of the isolates were multidrug-resistant. The development of multidrug-resistant strains was found to be associated with various drug-resistant genes, multiple mutations in the quinolone resistance-determining region (QRDR), and the presence of plasmid-mediated quinolone-resistant determinants and efflux pump mediators. This report represents the first presentation of the results of long-term surveillance and molecular characterization concerning antimicrobial resistances in clinical Shigella strains in these islands. Information gathered as part of the investigations will be instrumental in identifying emerging antimicrobial resistance, for developing treatment guidelines appropriate for that community, and to provide baseline data with which to compare outbreak strains in the future.

Emergence of an unusual genotype of rotavirus in andaman and nicobar islands, India.

Rotavirus is the most common cause of severe diarrhoea worldwide, affecting over 125 million young children every year in developing countries. The present study is a part of ongoing childhood diarrhoeal surveillance to determine the strain diversity of rotaviruses prevalent in Andaman and Nicobar Islands. From October 2010 to February 2012, 296 stool samples from children (age group 6-60 months) with gastroenteritis were obtained from different referral hospitals/primary health centres and community health centres in Andaman and Nicobar Islands. A total of 47 samples were found positive for GARV. Among these, 21 (44.7%) samples belong to G2P[4], 12 (25.5%) samples were G1P[8], 10 (21.2%) samples belong to G9P[4], 2 (4.3%) samples belong to G1P[4] and 2 (4.3%) samples had a mixed genotype. Rotavirus G2 genotype remains the most common genotype in these islands. The prevalence of G9 rotavirus reported in the present study is higher than that reported from mainland India. The results emphasize the role of the unusual serotype G9 as an epidemiologically important genotype and the need to include G9 specificity in a rotavirus vaccine.

Advances in physicochemical pretreatment strategies for lignocellulose biomass and their effectiveness in bioconversion for biofuel production.

The inherent recalcitrance of lignocellulosic biomass is a significant barrier to efficient lignocellulosic biorefinery owing to its complex structure and the presence of inhibitory components, primarily lignin. Efficient biomass pretreatment strategies are crucial for fragmentation of lignocellulosic biocomponents, increasing the surface area and solubility of cellulose fibers, and removing or extracting lignin. Conventional pretreatment methods have several disadvantages, such as high operational costs, equipment corrosion, and the generation of toxic byproducts and effluents. In recent years, many emerging single-step, multi-step, and/or combined physicochemical pretreatment regimes have been developed, which are simpler in operation, more economical, and environmentally friendly. Furthermore, many of these combined physicochemical methods improve biomass bioaccessibility and effectively fractionate ∼96 % of lignocellulosic biocomponents into cellulose, hemicellulose, and lignin, thereby allowing for highly efficient lignocellulose bioconversion. This review critically discusses the emerging physicochemical pretreatment methods for efficient lignocellulose bioconversion for biofuel production to address the global energy crisis.

Review of chemical pretreatment of lignocellulosic biomass using low-liquid and low-chemical catalysts for effective bioconversion.

Chemical pretreatment of lignocellulosic biomass (LCB) is essential for effective biological conversion in subsequent steps to produce biofuels or biochemicals. For effective pretreatment, high lignin content and its recalcitrant nature of LCB are major factors influencing bioconversion, especially lignin is known to be effectively solubilized by alkaline, organic, and deep eutectic solvents, ionic liquids, while hemicellulose is effectively dissolved by various acid catalysts and organic solvents. Depending on the pretreatment method/catalyst used, different pretreatment process scheme should be applied with different amounts of catalyst and water inputs to achieve a satisfactory effect. In addition, the amount of processing water required in the following processes such as washing, catalyst recovery, and conditioning after pretreatment is critical factor for scale-up (commercialization). In this review, the amount of catalyst and/or water used, and the effect of pretreatment, properties of the products, and recovery of liquid are also discussed.

Antimicrobial resistance in Shigella--rapid increase & widening of spectrum in Andaman Islands, India.

BACKGROUND & OBJECTIVES: Shigellosis is known to be a major cause of acute childhood diarrhoea in Andaman & Nicobar Islands, India. Rapid emergence of antibiotic resistance warrants continuous monitoring of sensitivity pattern of bacterial isolates. We report here the salient findings of an ongoing study on shigellosis in Andaman Islands, India, with regards to change in drug resistance pattern during the past one decade. METHOD: During 2006-2009, stools samples from 412 paediatric diarrhoea patients were collected and processed for isolation and identification of Shigella spp. Susceptibility to 22 antimicrobial drugs was tested and MICs were determined for 3 rd generation cephalosporins, quinolones, amoxicillin-clavulanic acid combination and gentamicin. Drug susceptibility pattern of these isolates were compared with that of 33 isolates obtained during 2000-2002. RESULTS: Shigella isolates were recovered from 50 of 412 stool samples processed. Resistance to ampicillin, nalidixic acid, tetracycline and ciprofloxacin was observed in 100, 96, 94 and 82 per cent of the isolates, respectively. The frequency of resistance to these drugs was significantly (P<0.001) higher than that observed during 2000-2002. Resistance to seven drugs was observed in 2000-2002, whereas resistance to 21 drugs was seen during 2006-2009. The number of drug resistance pattern increased from 13 in 2000-2002 to 43 in 2006-2009. Resistance to newer generation fluoroquinolones, 3 rd generation cephalosporins and augmentin, which was not observed during 2000-2002, appeared during 2006-2009. INTERPRETATION & CONCLUSIONS: The frequency of resistance among Shigella isolates has increased substantially between 2000-2002 and 2006-2009 and the spectrum of resistance has widened. At present, the option for antimicrobial therapy in shigellosis in Andaman is limited to a small number of drugs. Continuous local monitoring of resistance patterns is necessary for the appropriate selection of empirical antimicrobial therapy.

Association between age at first calving, first lactation traits and lifetime productivity in Murrah buffaloes.

OBJECTIVE: This study was conducted to estimate the association of age at first calving (AFC) with first lactation traits as well as lifetime performance traits in Murrah buffaloes. METHODS: Data on first lactation and life time performance of Murrah buffaloes (n = 679), maintained at Indian Council of Agricultural Research-Central Institute for Research on Buffaloes, Hisar, India during the period 1983 through 2017, were deduced to calculate heritability estimates, genetic and phenotypic correlation of different first lactation and lifetime traits. The univariate animal model was fitted to estimate variance components and heritability separately for each trait, while bivariate animal models were set to estimate genetic and phenotypic correlations between traits under study. RESULTS: The heritability was high for first peak milk yield (FPY, 0.64±0.08), moderate for AFC (0.48±0.07) and breeding efficiency (BE 0.39±0.09). High genetic correlations of first lactation total milk yield (FLTMY) with first lactation standard milk yield (FLSMY, 305 days or less), FPY, and first lactation length (FLL) was seen. Likewise, genetic correlation of AFC was positive with FLTMY, FLL, first dry period (FDP), first service period (FSP), first calving interval (FCI), herd life (HL) and productive days (PD). Significant phenotypic correlation of FLTMY was observed with HL, productive life (PL), PD, total lifetime milk yield (LTMY), standard lifetime milk yield (standard LTMY). Moreover, positive genetic and phenotypic correlation of FPY was observed with HL, PL, PD, total LTMY and standard LTMY. CONCLUSION: This study reports that AFC had positive genetic correlation with FDP, FSP, FCI, and unproductive days while, negative association of AFC was observed with FLSMY, PL, total LTMY, standard LTMY, and BE. This suggests that reduction of AFC would results in improvement of lifetime performance traits.

Prevalence of the plasmid-mediated quinolone resistance determinants among clinical isolates of Shigella sp. in Andaman & Nicobar Islands, India.

AIMS: This study was carried out to find the prevalence of various plasmid-mediated quinolone-resistant (PMQR) determinants among the quinolone-resistant clinical isolates of Shigella sp. from paediatric patients in Andaman & Nicobar Islands. METHODS AND RESULTS: A total of 106 quinolone-resistant Shigella isolates obtained from paediatric patients during hospital-based surveillance from January 2003 to June 2010 were screened for the presence of various PMQR determinants. Of 106 isolates, 8 (7.5%) showed the presence of aac (6')-Ib-cr and 3 (2.8%) harboured the qnrB genes with 2 (1.9%) of these isolates showing the presence of both. All the 9 isolates had uniform mutations in gyrA (S83L) and in parC (S80I). CONCLUSIONS: The prevalence of fluoroquinolone-acetylating aminoglycoside acetyltransferase {aac (6')-Ib-cr} gene is higher than qnrB gene among the clinical Shigella isolates. These PMQR determinants were detected in the Shigella isolates obtained from 2008-2010, indicating that it happens in a stepwise manner following the multiple mutations in quinolone resistance-determining regions increase or extend resistance to quinolones or fluoroquinolones. SIGNIFICANCE AND IMPACT OF STUDY: The prevalence of these genes are of grave concern as it may be horizontally transferred to other human pathogenic bacteria and can lead to therapeutic failure as a consequence of antimicrobial resistance, not only for the islands but also for the entire south-east region. The results obtained should encourage further studies on the implications of the presence, distribution, association and variation of these determinants in our quest for understanding PMQR.

Cardiac resynchronization therapy: current trends and future directions.

Despite the clear cut indications for cardiac resynchronization therapy (CRT) laid down by guideline forming bodies, there are numerous unresolved issues. This review article primarily focuses on the current trends in CRT and the challenges encountered in patient selection, procedure related and postimplantation patient management issues. The high rate of non-response to CRT warrants a critical appraisal of the patient selection criteria, with the role of QRS duration and use of imaging to quantify ventricular dyssynchrony being the major points of discussion. Likewise the role of CRT in relatively asymptomatic heart failure patients, those with atrial fibrillation and the benefits of providing an implantable cardioverter defibrillator backup to all CRT devices has yet to be clearly defined. The development of effective and minimally invasive surgical techniques, dependable and reproducible means for optimal pacing site localization and comparative trials on superior mode of lead positioning, pacing sites and optimized CRT programming encompassing diverse patient populations would further advance current standards of CRT. Innovative approaches to resolve these controversies and future goal directed research is needed. Development of novel, comprehensive prediction tools to identify responders to CRT and the possibility of 'leadless' pacing would be interesting futuristic prospects.

Is intimal hyperplasia a marker of neuro-ophthalmic complications of giant cell arteritis?

OBJECTIVE: The ischaemic complications of giant cell arteritis (GCA) such as blindness and stroke may result from luminal narrowing of the affected arteries. This study focuses on the association between the severity of intimal proliferation on temporal artery biopsy (TAB) histology and neuro-ophthalmic complications (NOCs) of GCA. METHOD: We identified 30 cases of biopsy-proven temporal arteritis. One histopathologist (blinded to the clinical details) evaluated the TAB specimens and categorized the degree of maximum stenosis due to intimal hyperplasia into four grades: grade 1 is <50% luminal occlusion due to intimal hyperplasia, grade 2 is 50-75%, grade 3 is >75% and grade 4 is complete luminal occlusion. A second histopathologist (also blinded to the clinical details) independently evaluated the TAB specimens using the same grading system. The NOCs in these patients were noted after a case record review. RESULTS: Of the 30 patients, 12 had NOC-10 with eye complications (complete visual loss, anterior ischaemic neuropathy, visual field defects), one patient had cerebral infarcts and one had both cerebral infarcts and vision loss. There was evidence for a statistically significant trend of NOC associated with higher intimal hyperplasia scores (P = 0.001). The scores of the histopathologists agreed for 23 (77%) patients and differed by 1 category for the remaining 7 (kappa-statistic 0.88). CONCLUSIONS: Our study suggests that the degree of intimal hyperplasia on TAB histology (routinely available to all hospital units) seems to be closely associated with NOCs of GCA. The study highlights the possible prognostic as well as diagnostic role of the biopsy. We feel that intimal hyperplasia noted in biopsy specimens may help us in the risk stratification of GCA patients and targeting of appropriate and novel therapies.

Inhibition of the actions of palytoxin on the K+ efflux from red cells and on the Na/K-ATPase activity by a monoclonal antibody.

Palytoxin (PTX) binds to the Na/K pump, inhibits the (Na/K)-ATPase and forms Na and K permeable channels in human red cells. Here, we report that a monoclonal antibody raised against a derivative of PTX (Bignami, G.S. et al. (1992) Toxicon 30, 687-700) inhibits these effects. The observations are consistent with a model in which (a) the antibody binds and, thus reduces the concentration of free PTX available to react with the Na/K pump, and, (b) the PTX-antibody complex also binds to the PTX receptor on the Na/K pump but in such a way that a cation permeable channel is not formed, probably by reducing the concentration of free PTX. Using this model, we estimate that the apparent dissociation constant for the binding of PTX to antibody is 0.2 nM.

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome.

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.