Novel carbazole-stilbene hybrids as multifunctional anti-Alzheimer agents.

Molecules capable of engaging with multiple targets associated with pathological condition of Alzheimer's disease have proved to be potential anti-Alzheimer's agents. In our goal to develop multitarget-directed ligands for the treatment of Alzheimer's disease, a novel series of carbazole-based stilbene derivatives were designed by the fusion of carbazole ring with stilbene scaffold. The designed compounds were synthesized and evaluated for their anti-AD activities including cholinesterase inhibition, Aß aggregation inhibition, antioxidant and metal chelation properties. Amongst them, (E)-1-(4-(2-(9-ethyl-9H-carbazol-3-yl)vinyl)phenyl)-3-(2-(pyrrolidin-1-yl)ethyl)thiourea (50) appeared to be the best candidate with good inhibitory activities against AChE (IC50 value of 2.64 µM) and BuChE (IC50 value of 1.29 µM), and significant inhibition of self-mediated Aß1-42 aggregation (51.29% at 25 µM concentration). The metal chelation study showed that compound (50) possessed specific copper ion chelating property. Additionally, compound (50) exhibited moderate antioxidant activity. To understand the binding mode of 50, molecular docking studies were performed, and the results indicated strong non-covalent interactions of 50 with the enzymes in the active sites of AChE, BuChE as well as of the Aß1-42 peptide. Additionally, it showed promising in silico ADMET properties. Putting together, these findings evidently showed compound (50) as a potential multitarget-directed ligand in the course of developing novel anti-AD drugs.

Selection of DNA aptamers with two modified bases.

The nucleobases comprising DNA and RNA aptamers provide considerably less chemical diversity than protein-based ligands, limiting their versatility. The introduction of novel functional groups at just one of the four bases in modified aptamers has recently led to dramatic improvement in the success rate of identifying nucleic acid ligands to protein targets. Here we explore the benefits of additional enhancement in physicochemical diversity by selecting modified DNA aptamers that contain amino-acid-like modifications on both pyrimidine bases. Using proprotein convertase subtilisin/kexin type 9 as a representative protein target, we identify specific pairwise combinations of modifications that result in higher affinity, metabolic stability, and inhibitory potency compared with aptamers with single modifications. Such doubly modified aptamers are also more likely to be encoded in shorter sequences and occupy nonoverlapping epitopes more frequently than aptamers with single modifications. These highly modified DNA aptamers have broad utility in research, diagnostic, and therapeutic applications.

Non-Hodgkin lymphoma in Romania: a single-centre experience.

Epidemiologic studies of non-Hodgkin lymphoma (NHL) in Eastern Europe are scarce in the literature. We report the experience of the "Ion Chiricuta" Institute of Oncology in Cluj-Napoca (IOCN), Romania, in the diagnosis and outcome of patients with NHL. We studied 184 consecutive NHL patients diagnosed in the Pathology Department of IOCN during the years 2004-2006. We also obtained epidemiological data from the Northwestern (NW) Cancer Registry. In the IOCN series, the most common lymphoma subtype was diffuse large B-cell lymphoma (43.5%), followed by the chronic lymphocytic leukaemia/small lymphocytic lymphoma (21.2%). T-cell lymphomas represented a small proportion (8.2%). The median age of the patients was 57 years, with a male-to-female ratio of 0.94. Patients with indolent B-cell lymphomas had the best overall survival, whereas those with mantle cell lymphoma had the worst survival. The NW Cancer Registry data showed that the occurrence of NHL in the NW region of Romania was higher in men [world age-standardized incidence rate/100 000 (ASR)-5.9; 95% CI 5.1-6.6] than in women (ASR-4.1; 95% CI 3.5-4.7) with age-standardized male-to-female ratio of 1.44 (p = 0.038). Chronic lymphocytic leukaemia/small lymphocytic lymphoma was the most common NHL in the NW region of Romania, accounting for 43% of all cases, followed by diffuse large B-cell lymphoma (36%). The 5-year, age-standardized cumulative relative survival for NHL in the County of Cluj in NW Romania, for the period of 2006-2010, was 51.4%, with 58.4% survival for men and 43.2% for women. Additional studies of NHL in Eastern Europe are needed. Copyright © 2015 John Wiley & Sons, Ltd.

Relative frequency of non-Hodgkin lymphoma subtypes in selected centres in North Africa, the middle east and India: a review of 971 cases.

Comparative data regarding the distribution of non-Hodgkin lymphoma (NHL) subtypes in North Africa, the Middle East and India (NAF/ME/IN) is scarce in the literature. In this study, we evaluated the relative frequencies of NHL subtypes in this region. Five expert haematopathologists classified 971 consecutive cases of newly-diagnosed NHL from five countries in NAF/ME/IN. After review, 890 cases (91·7%) were confirmed to be NHL and compared to 399 cases from North America (NA). The male-to-female ratio was significantly higher in NAF/ME/IN (1·8) compared to NA (1·1; P< 0·05). The median ages of patients with low-grade (LG) and high-grade (HG) B-NHL in NAF/ME/IN (56 and 52 years, respectively) were significantly lower than in NA (64 and 68 years, respectively). In NAF/ME/IN, a significantly lower proportion of LG B-NHL (28·4%) and a higher proportion of HG B-NHL (58·4%) were found compared to NA (56·1% and 34·3%, respectively). Diffuse large B-cell lymphoma was more common in NAF/ME/IN (49·4%) compared to NA (29·3%), whereas follicular lymphoma was less common in NAF/ME/IN (12·4%) than in NA (33·6%). In conclusion, we found significant differences in NHL subtypes and clinical features between NAF/ME/IN and NA. Epidemiological studies are needed to better understand the pathobiology of these differences.

Non-Hodgkin lymphoma in Southern Africa: review of 487 cases from The International Non-Hodgkin Lymphoma Classification Project.

Comparative data on the distribution of non-Hodgkin lymphoma (NHL) subtypes in Southern Africa (SAF) is scarce. In this study, five expert haematopathologists classified 487 consecutive cases of NHL from SAF using the World Health Organization classification, and compared the results to North America (NA) and Western Europe (WEU). Southern Africa had a significantly lower proportion of low-grade (LG) B-NHL (34·3%) and a higher proportion of high-grade (HG) B-NHL (51·5%) compared to WEU (54·5% and 36·4%) and NA (56·1% and 34·3%). High-grade Burkitt-like lymphoma was significantly more common in SAF (8·2%) than in WEU (2·4%) and NA (2·5%), most likely due to human immunodeficiency virus infection. When SAF patients were divided by race, whites had a significantly higher frequency of LG B-NHL (60·4%) and a lower frequency of HG B-NHL (32·7%) compared to blacks (22·5% and 62·6%), whereas the other races were intermediate. Whites and other races had a significantly higher frequency of follicular lymphoma and a lower frequency of Burkitt-like lymphoma compared to blacks. The median ages of whites with LG B-NHL, HG B-NHL and T-NHL (64, 56 and 67 years) were significantly higher than those of blacks (55, 41 and 34 years). Epidemiological studies are needed to better understand these differences.

Cyclin D1 expression in peripheral T-cell lymphomas.

Cyclin D1 is an important regulator of the cell cycle and overexpression of this protein by immunohistochemistry is characteristically seen in mantle cell lymphoma and other B-cell neoplasms. However, little is known about the expression of this protein in T-cell lymphomas. Cyclin-dependent kinase pathway inhibitors are in development, therefore identifying cyclin D1-positive T-cell lymphomas may provide a therapeutic target in a disease where novel treatments are urgently needed. We collected 200 peripheral T-cell lymphomas from three institutions including the following types of cases: 34 anaplastic large cell lymphoma, ALK+, 44 anaplastic large cell lymphoma, ALK negative, 68 peripheral T-cell lymphomas, not otherwise specified, 24 angioimmunoblastic T-cell lymphomas, 7 extranodal NK/T-cell lymphomas, 4 enteropathy associated T-cell lymphomas, 3 hepatosplenic T-cell lymphomas, 12 cutaneous T-cell lymphomas, and 4 large granular lymphocytic leukemias. Immunohistochemical stains for cyclin D1 protein (SP4 clone) were performed on paraffin-embedded tissue. In a subset of cases, IGH/CCND1 fluorescence in situ hybridization analysis was also performed. Cyclin D1 staining was predominantly seen in anaplastic large cell lymphoma, including 8 of 34 cases with ALK+ anaplastic large cell lymphoma (24%), and 3 of 44 cases of ALK-negative (7%) anaplastic large cell lymphoma. Three cases of peripheral T-cell lymphoma, not otherwise specified, were also positive (3/68, 4%). All other T-cell lymphomas were negative for cyclin D1. In four of the cyclin D1-positive T-cell lymphomas by immunohistochemistry, fluorescence in situ hybridization analysis was negative for IGH/CCND1 translocation or extra copies of the CCND1 gene. Cyclin D1 overexpression by immunohistochemistry is not limited to B-cell lymphomas and is also observed in some peripheral T-cell lymphomas, particularly in anaplastic large cell lymphoma, ALK+. Cyclin D1 expression was not associated with extra copies or translocation of the CCND1 gene. Cyclin D1 overexpression may be the result of a post-translational phenomenon and may represent a potential therapeutic target using agents that target the cyclin-dependent kinase pathway.

Non-Hodgkin lymphoma in the developing world: review of 4539 cases from the International Non-Hodgkin Lymphoma Classification Project.

The distribution of non-Hodgkin lymphoma subtypes varies around the world, but a large systematic comparative study has never been done. In this study, we evaluated the clinical features and relative frequencies of non-Hodgkin lymphoma subtypes in five developing regions of the world and compared the findings to the developed world. Five expert hematopathologists classified 4848 consecutive cases of lymphoma from 26 centers in 24 countries using the World Health Organization classification, and 4539 (93.6%) were confirmed to be non-Hodgkin lymphoma, with a significantly greater number of males than females in the developing regions compared to the developed world (P<0.05). The median age at diagnosis was significantly lower for both low- and high-grade B-cell lymphoma in the developing regions. The developing regions had a significantly lower frequency of B-cell lymphoma (86.6%) and a higher frequency of T- and natural killer-cell lymphoma (13.4%) compared to the developed world (90.7% and 9.3%, respectively). Also, the developing regions had significantly more cases of high-grade B-cell lymphoma (59.6%) and fewer cases of low-grade B-cell lymphoma (22.7%) compared to the developed world (39.2% and 32.7%, respectively). Among the B-cell lymphomas, diffuse large B-cell lymphoma was the most common subtype (42.5%) in the developing regions. Burkitt lymphoma (2.2%), precursor B- and T-lymphoblastic leukemia/lymphoma (1.1% and 2.9%, respectively) and extranodal natural killer/T-cell lymphoma (2.2%) were also significantly increased in the developing regions. These findings suggest that differences in etiologic and host risk factors are likely responsible, and more detailed epidemiological studies are needed to better understand these differences.

Non-Hodgkin lymphoma in the Far East: review of 730 cases from the international non-Hodgkin lymphoma classification project.

Large and systematic studies of non-Hodgkin lymphoma (NHL) in the Far East (FE) with good comparative data are scarce in the literature. In this study, five expert hematopathologists classified 730 consecutive cases of newly-diagnosed NHL from four sites in the FE (excluding Japan) using the World Health Organization classification. The results were compared to 399 cases from North America (NA). We found a significantly higher male to female ratio in the FE compared to NA (1.7 versus 1.1; p < 0.05). The median ages of patients with low-grade (LG) and high-grade (HG) B-NHL in the FE (58 and 51 years, respectively) were significantly lower than in NA (64 and 68 years, respectively). The FE had a significantly lower relative frequency of B-NHL and a higher frequency of T-NHL (82 vs. 18 %) compared to NA (90.5 vs. 9.5 %). Among mature B cell lymphomas, the FE had a significantly higher relative frequency of HG B-NHL (54.8 %) and a lower frequency of LG B-NHL (27.2 %) than NA (34.3 and 56.1 %, respectively). Diffuse large B cell lymphoma was more common in the FE (49.4 %) compared to NA (29.3 %), whereas the relative frequency of follicular lymphoma was lower in the FE (9.4 %) compared to NA (33.6 %). Among T-NHL, nasal NK/T cell NHL was more frequent in the FE (5.2 %) compared to NA (0 %). Peripheral T cell lymphoma was also more common in the FE (9.1 %) than in NA (5.3 %). Further epidemiologic studies are needed to better understand the pathobiology of these differences.

Common immune-related exposures/conditions and risk of non-Hodgkin lymphoma: a case-control study of disease-discordant twin pairs.

We evaluated the association between common immune system-altering experiences and non-Hodgkin lymphoma (NHL) risk using a case-control study of 162 like-sex twin pairs discordant for NHL, identified from the International Twin Study. Information on medical history and evidence of childhood exposure to microbes was obtained by questionnaire from 1998 to 2002. Conditional logistic regression was used to estimate odds ratios and 95% confidence intervals. Intra-twin-pair agreement between twins on individual exposures was high (76%-97%). A negative association between NHL and seasonal hay fever (odds ratio (OR) = 0.28, 95% confidence interval (CI): 0.10, 0.75) and certain allergies (OR = 0.29, 95% CI: 0.13, 0.68) was observed. The number of atopic diseases was negatively associated with NHL (P for trend = 0.0003). A history of infectious mononucleosis was negatively associated with NHL risk (OR = 0.35, 95% CI: 0.14, 0.90). NHL risk was associated with more frequent childhood exposure to microbes during early life (P for trend = 0.04). No differences in association by NHL subtype were observed, although statistical power for these comparisons was low. These observations support the hypothesis that immune-related exposures, especially atopy, are associated with decreased NHL risk. Use of the within-twin-pair study design mitigates confounding by genome, family structure, and unmeasured characteristics of early childhood factors.

Classification of non-Hodgkin lymphoma in South-eastern Europe: review of 632 cases from the international non-Hodgkin lymphoma classification project.

The distribution of non-Hodgkin lymphoma (NHL) subtypes varies around the world, but a systematic study of South-eastern Europe (SEEU) has never been done. Therefore, we evaluated the relative frequencies of NHL subtypes in three SEEU countries--Croatia, Romania and Macedonia. Five expert haematopathologists reviewed 632 consecutive cases of newly diagnosed NHL from the three SEEU countries using the World Health Organization classification. The results were compared to 399 cases from North America (NA) and 580 cases from Western Europe (WEU). The proportions of B- and T-cell NHL and the sex distribution in SEEU were similar to WEU and NA. However, the median ages of patients with low- and high-grade B-NHL in SEEU (60 and 59 years, respectively) were significantly lower than in NA (64 and 68 years, respectively; P < 0·05). SEEU had a significantly lower proportion of low-grade B-NHL (46·6%) and higher proportion of high-grade B-NHL (44·5%) compared to both WEU (54·5% and 36·4%, respectively) and NA (56·1% and 34·3%, respectively). There were no significant differences in the relative frequencies of T-NHL subtypes. This study provides new insights into differences in the relative frequencies of NHL subtypes in different geographic regions. Epidemiological studies are needed to better characterize and explain these differences.

Classification of non-Hodgkin lymphoma in Central and South America: a review of 1028 cases.

The distribution of non-Hodgkin lymphoma (NHL) subtypes differs around the world but a systematic study of Latin America has not been done. Therefore, we evaluated the relative frequencies of NHL subtypes in Central and South America (CSA). Five expert hematopathologists classified consecutive cases of NHL from 5 CSA countries using the WHO classification and compared them to 400 cases from North America (NA). Among the 1028 CSA cases, the proportions of B- and T-cell NHL and the sex distribution were similar to NA. However, the median age of B-cell NHL in CSA (59 years) was significantly lower than in NA (66 years; P < .0001). The distribution of high-grade (52.9%) and low-grade (47.1%) mature B-cell NHL in CSA was also significantly different from NA (37.5% and 62.5%; P < .0001). Diffuse large B-cell lymphoma was more common in CSA (40%) than in NA (29.2%; P < .0001), whereas the frequency of follicular lymphoma was similar in Argentina (34.1%) and NA (33.8%), and higher than the rest of CSA (17%; P < .001). Extranodal NK/T-cell NHL was also more common in CSA (P < .0001). Our study provides new objective evidence that the distribution of NHL subtypes varies significantly by geographic region and should prompt epidemiologic studies to explain these differences.

A genome-wide meta-analysis of nodular sclerosing Hodgkin lymphoma identifies risk loci at 6p21.32.

Nodular sclerosing Hodgkin lymphoma (NSHL) is a distinct, highly heritable Hodgkin lymphoma subtype. We undertook a genome-wide meta-analysis of 393 European-origin adolescent/young adult NSHL patients and 3315 controls using the Illumina Human610-Quad Beadchip and Affymetrix Genome-Wide Human SNP Array 6.0. We identified 3 single nucleotide polymorphisms (SNPs) on chromosome 6p21.32 that were significantly associated with NSHL risk: rs9268542 (P = 5.35 × 10(-10)), rs204999 (P = 1.44 × 10(-9)), and rs2858870 (P = 1.69 × 10(-8)). We also confirmed a previously reported association in the same region, rs6903608 (P = 3.52 × 10(-10)). rs204999 and rs2858870 were weakly correlated (r(2) = 0.257), and the remaining pairs of SNPs were not correlated (r(2) < 0.1). In an independent set of 113 NSHL cases and 214 controls, 2 SNPs were significantly associated with NSHL and a third showed a comparable odds ratio (OR). These SNPs are found on 2 haplotypes associated with NSHL risk (rs204999-rs9268528-rs9268542-rs6903608-rs2858870; AGGCT, OR = 1.7, P = 1.71 × 10(-6); GAATC, OR = 0.4, P = 1.16 × 10(-4)). All individuals with the GAATC haplotype also carried the HLA class II DRB1*0701 allele. In a separate analysis, the DRB1*0701 allele was associated with a decreased risk of NSHL (OR = 0.5, 95% confidence interval = 0.4, 0.7). These data support the importance of the HLA class II region in NSHL etiology.

Identification of the V600D mutation in Exon 15 of the BRAF oncogene in congenital, benign langerhans cell histiocytosis.

Langerhans cell histiocytosis (LCH) is a well-known but rare disease that may occur at any age with markedly variable clinical features: self-regressive, localized, multiorgan, aggressive, or fatal outcome. Congenital LCH is rare and often clinically benign. While LCH is characterized by a clonal proliferation of Langerhans cells, its etiology is unknown. Although BRAF V600E mutations were recently identified as a recurrent genetic alteration in LCH cases, the clinical significance of this mutation within the heterogeneous spectrum of LCH is also currently unknown. We studied a cutaneous, benign form of congenital LCH that occurred in a newborn male, without recurrence for 8 years. Histopathologically, the skin lesion excised after birth showed the typical cytologic and immunophenotypic features of LCH. Sequencing analysis of Exon 15 of the BRAF gene revealed the V600D mutation, with an allelic abundance of 25-30%, corresponding to the LCH cells being hemizygous for the mutant allele. BRAF V600E-specific polymerase chain reaction was negative. Our report is the first to identify the rare, variant BRAF V600D mutation in LCH, and provides support for constitutively activated BRAF oncogene-induced cell senescence as a mechanism of regression in congenital, benign LCH. Further, our clinicopathologic findings provide proof for the first time that the V600D mutation can also occur in the absence of ultraviolet light, and can occur in a clinically benign proliferation, similar to the V600E mutation. Additional clinicopathologic studies in larger numbers of LCH patients may be valuable to ascertain the pathophysiologic role of BRAF mutations in LCH.

Theranostic Diagnostics.

Diagnosing and then treating disease defines theranostics. The approach holds promise by facilitating targeted disease outcomes. The simultaneous analysis of finding the presence of disease pathophysiology while providing a parallel in treatment is a novel and effective strategy for seeking improved medical care. We discuss how theranostics improves disease outcomes is discussed. The chapter reviews the delivery of targeted therapies. Bioimaging techniques are highlighted as early detection and tracking systems for microbial infections, degenerative diseases, and cancers.

Co(II)-Cu(II) mixed-oxide catalysts for single-step synthesis of 2,4,5-triaryl-1H-imidazole derivatives under microwave irradiation.

In this study, a catalyst composite of Co-Cu was prepared from chloride-containing precursor of Co(II) and Cu(II) metals using the milky latex of the Euphorbia neriifolia plant following green principles of synthesis. The catalyst composite was characterized using XRD, EDAX, SEM, HR-TEM, FTIR, XPS and TOF-MS. The crystallinity of the mixed-oxide composite with a distorted octahedral nature was confirmed from analysis. Chemical charge analysis of the Co-Cu mixed phase based on XPS revealed Co2+ and Cu2+ oxidation states. This material was used for synthesizing 2,4,5-triaryl-1H-imidazole (TIMDZOL) derivatives. Analysis of reaction conditions revealed that EtOH : PEG at 8 : 2 ratio under microwave conditions showed better yields with less time and better reusability of the Co-Cu catalyst.

First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India.

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5'AACTGAAGAGTTTGATCCTGGCTC3' and PR:5'TACGGTTACCTTGTTACGACTT3', a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml-1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

Deployment of AMMI, GGE-biplot and MTSI to select elite genotypes of castor (Ricinus communis L.).

Castor (Ricinus communis L.) is an important industrial multipurpose non-edible oilseed C3 crop belongs to spurge family popularly known as Euphorbiaceae. Its oil has exceptional properties which provides an industrial importance to this crop. The present investigation is aimed to judge the stability and performance of yield and yield assigning traits and selection of suitable genotype for varied locality of western rainfed regions of India. During the study with 90 genotypes, the genotype × environment interaction was found to be significant for seed yield per plant as well as for plant height up to primary raceme, total length of primary raceme, effective length of primary raceme, capsules on main raceme and effective number of racemes per plant. E1 is the least interactive and highly representative site for seed yield. Which won where and what biplot decipher ANDCI 10-01 as vertex genotype for E3 while ANDCI 10-03 and P3141 for E1 and E2. Average Environment co-ordinate identify ANDCI 10-01, P3141, P3161, JI 357 and JI 418 as tremendously stable and high seed yielding genotypes. The study outlined the pertinency of Multi Trait Stability Index, that calculated based on the genotype-ideotype distance as the multiple interacting variables. MTSI evaluated all genotypes and sort ANDCI 12-01, JI 413, JI 434, JI 380, P3141, ANDCI 10-03, SKI 215, ANDCI 09, SI 04, JI 437, JI 440, RG 3570, JI 417 and GAC 11 with maximum stability and high mean performance of analyzed interacting traits.

Prevalence and characteristics of eating disorders among college students of a nonmetro city of Gujarat.

Context: There is a relative paucity of prevalence data about eating disorders (EDs) in India among young population. Aims: We aimed to estimate the prevalence and characteristics of EDs and abnormal eating behaviors among college students of a nonmetro city of Gujarat. Setting and Design: A cross-sectional survey was done among five colleges of a nonmetro city in Gujarat from February to September 2019. Subjects and Methods: Total 790 college students were assessed using a semi-structured format, Eating Attitudes Test-26, and Bulimic Investigatory Test Edinburgh followed by structured clinical interview as per DSM-5 criteria for EDs. Statistical Analysis: Outcomes were expressed in frequency, proportion, mean, and standard deviation. P values were calculated by Pearson Chi-square test or Fisher's exact test to determine the significance of the result. Results: The prevalence of abnormal eating behaviors was 25.2% (n = 199). Anorexia nervosa (AN) was not detected. The prevalence of bulimia nervosa (BN) was 0.2% and other specified feeding or eating disorder (OSFED) was 0.6%. "Being aware of calorie content" (53.7%) and "preoccupation with desire of thinness" (46.3%) were commonly found. "Impulse to vomit after meals" (2.5%) was least common. Lower body mass index was found among subjects with abnormal eating behavior. None of the subjects had amenorrhea. Conclusions: The prevalence of disordered eating behaviors, BN, and OSFED was 25.2%, 0.2%, and 0.6%, respectively. AN was not detected. OSFED was the most common ED and the characteristic "body image disturbance" was the most common symptom.

Carbazole-based semicarbazones and hydrazones as multifunctional anti-Alzheimer agents.

With the aim to combat a multi-faceted neurodegenerative Alzheimer's disease (AD), a series of carbazole-based semicarbazide and hydrazide derivatives were designed, synthesized and assessed for their cholinesterase (ChE) inhibitory, antioxidant and biometal chelating activity. Among them, (E)-2-((9-ethyl-9H-carbazol-3-yl)methylene)-N-(pyridin-2-yl)hydrazinecarbothioamide (62) and (E)-2-((9-ethyl-9H-carbazol-3-yl)methylene)-N-(5-chloropyridin-2-yl)hydrazinecarbothioamide (63) emerged as the premier candidates with good ChE inhibitory activities (IC50 values of 1.37 µM and 1.18 µM for hAChE, IC50 values of 2.69 µM and 3.31 µM for EqBuChE, respectively). All the test compounds displayed excellent antioxidant activity (reduction percentage of DPPH values for compounds (62) and (63) were 85.67% and 84.49%, respectively at 100 µM concentration). Compounds (62) and (63) conferred specific copper ion chelating property in metal chelation study. Molecular docking studies of compounds (62) and (63) indicate strong interactions within the active sites of both the ChE enzymes. Besides that, these compounds also exhibited significant in silico drug-like pharmacokinetic properties. Thus, taken together, they can serve as a starting point in the designing of multifunctional ligands in pursuit of potential anti-AD agents that might further prevent the progression of ADs.Communicated by Ramaswamy H. Sarma.