Expansion of the SOS regulon of Vibrio cholerae through extensive transcriptome analysis and experimental validation.

BACKGROUND: The SOS response is an almost ubiquitous response of cells to genotoxic stresses. The full complement of genes in the SOS regulon for Vibrio species has only been addressed through bioinformatic analyses predicting LexA binding box consensus and in vitro validation. Here, we perform whole transcriptome sequencing from Vibrio cholerae treated with mitomycin C as an SOS inducer to characterize the SOS regulon and other pathways affected by this treatment. RESULTS: Comprehensive transcriptional profiling allowed us to define the full landscape of promoters and transcripts active in V. cholerae. We performed extensive transcription start site (TSS) mapping as well as detection/quantification of the coding and non-coding RNA (ncRNA) repertoire in strain N16961. To improve TSS detection, we developed a new technique to treat RNA extracted from cells grown in various conditions. This allowed for identification of 3078 TSSs with an average 5'UTR of 116 nucleotides, and peak distribution between 16 and 64 nucleotides; as well as 629 ncRNAs. Mitomycin C treatment induced transcription of 737 genes and 28 ncRNAs at least 2 fold, while it repressed 231 genes and 17 ncRNAs. Data analysis revealed that in addition to the core genes known to integrate the SOS regulon, several metabolic pathways were induced. This study allowed for expansion of the Vibrio SOS regulon, as twelve genes (ubiEJB, tatABC, smpA, cep, VC0091, VC1190, VC1369-1370) were found to be co-induced with their adjacent canonical SOS regulon gene(s), through transcriptional read-through. Characterization of UV and mitomycin C susceptibility for mutants of these newly identified SOS regulon genes and other highly induced genes and ncRNAs confirmed their role in DNA damage rescue and protection. CONCLUSIONS: We show that genotoxic stress induces a pervasive transcriptional response, affecting almost 20% of the V. cholerae genes. We also demonstrate that the SOS regulon is larger than previously known, and its syntenic organization is conserved among Vibrio species. Furthermore, this specific co-localization is found in other γ-proteobacteria for genes recN-smpA and rmuC-tatABC, suggesting SOS regulon conservation in this phylum. Finally, we comment on the limitations of widespread NGS approaches for identification of all RNA species in bacteria.

UV-C Adaptation of Shigella: Morphological, Outer Membrane Proteins, Secreted Proteins, and Lipopolysaccharides Effects.

Water UV disinfection remains extremely important, particularly in developing countries where drinking and reclaimed crop irrigation water may spread devastating infectious diseases. Enteric bacterial pathogens, among which Shigella, are possible contaminants of drinking and bathing water and foods. To study the effect of UV light on Shigella, four strains were exposed to different doses in a laboratory-made irradiation device, given that the ultraviolet radiation degree of inactivation is directly related to the UV dose applied to water. Our results showed that the UV-C rays are effective against all the tested Shigella strains. However, UV-C doses appeared as determinant factors for Shigella eradication. On the other hand, Shigella-survived strains changed their outer membrane protein profiles, secreted proteins, and lipopolysaccharides. Also, as shown by electron microscopy transmission, morphological alterations were manifested by an internal cytoplasm disorganized and membrane envelope breaks. Taken together, the focus of interest of our study is to know the adaptive mechanism of UV-C resistance of Shigella strains.

Moonlighting bacteriophage proteins derepress staphylococcal pathogenicity islands.

Staphylococcal superantigen-carrying pathogenicity islands (SaPIs) are discrete, chromosomally integrated units of approximately 15 kilobases that are induced by helper phages to excise and replicate. SaPI DNA is then efficiently encapsidated in phage-like infectious particles, leading to extremely high frequencies of intra- as well as intergeneric transfer. In the absence of helper phage lytic growth, the island is maintained in a quiescent prophage-like state by a global repressor, Stl, which controls expression of most of the SaPI genes. Here we show that SaPI derepression is effected by a specific, non-essential phage protein that binds to Stl, disrupting the Stl-DNA complex and thereby initiating the excision-replication-packaging cycle of the island. Because SaPIs require phage proteins to be packaged, this strategy assures that SaPIs will be transferred once induced. Several different SaPIs are induced by helper phage 80alpha and, in each case, the SaPI commandeers a different non-essential phage protein for its derepression. The highly specific interactions between different SaPI repressors and helper-phage-encoded antirepressors represent a remarkable evolutionary adaptation involved in pathogenicity island mobilization.

An SOS Regulon under Control of a Noncanonical LexA-Binding Motif in the Betaproteobacteria.

UNLABELLED: The SOS response is a transcriptional regulatory network governed by the LexA repressor that activates in response to DNA damage. In the Betaproteobacteria, LexA is known to target a palindromic sequence with the consensus sequence CTGT-N8-ACAG. We report the characterization of a LexA regulon in the iron-oxidizing betaproteobacterium Sideroxydans lithotrophicus. In silico and in vitro analyses show that LexA targets six genes by recognizing a binding motif with the consensus sequence GAACGaaCGTTC, which is strongly reminiscent of the Bacillus subtilis LexA-binding motif. We confirm that the closely related Gallionella capsiferriformans shares the same LexA-binding motif, and in silico analyses indicate that this motif is also conserved in the Nitrosomonadales and the Methylophilales. Phylogenetic analysis of LexA and the alpha subunit of DNA polymerase III (DnaE) reveal that the organisms harboring this noncanonical LexA form a compact taxonomic cluster within the Betaproteobacteria. However, their lexA gene is unrelated to the standard Betaproteobacteria lexA, and there is evidence of its spread through lateral gene transfer. In contrast to other reported cases of noncanonical LexA-binding motifs, the regulon of S. lithotrophicus is comparable in size and function to that of many other Betaproteobacteria, suggesting that a convergent SOS regulon has reevolved under the control of a new LexA protein. Analysis of the DNA-binding domain of S. lithotrophicus LexA reveals little sequence similarity with that of other LexA proteins targeting similar binding motifs, suggesting that network structure may limit site evolution or that structural constrains make the B. subtilis-type motif an optimal interface for multiple LexA sequences. IMPORTANCE: Understanding the evolution of transcriptional systems enables us to address important questions in microbiology, such as the emergence and transfer potential of different regulatory systems to regulate virulence or mediate responses to stress. The results reported here constitute the first characterization of a noncanonical LexA protein regulating a standard SOS regulon. This is significant because it illustrates how a complex transcriptional program can be put under the control of a novel transcriptional regulator. Our results also reveal a substantial degree of plasticity in the LexA recognition domain, raising intriguing questions about the space of protein-DNA interfaces and the specific evolutionary constrains faced by these elements.

A super-family of transcriptional activators regulates bacteriophage packaging and lysis in Gram-positive bacteria.

The propagation of bacteriophages and other mobile genetic elements requires exploitation of the phage mechanisms involved in virion assembly and DNA packaging. Here, we identified and characterized four different families of phage-encoded proteins that function as activators required for transcription of the late operons (morphogenetic and lysis genes) in a large group of phages infecting Gram-positive bacteria. These regulators constitute a super-family of proteins, here named late transcriptional regulators (Ltr), which share common structural, biochemical and functional characteristics and are unique to this group of phages. They are all small basic proteins, encoded by genes present at the end of the early gene cluster in their respective phage genomes and expressed under cI repressor control. To control expression of the late operon, the Ltr proteins bind to a DNA repeat region situated upstream of the terS gene, activating its transcription. This involves the C-terminal part of the Ltr proteins, which control specificity for the DNA repeat region. Finally, we show that the Ltr proteins are the only phage-encoded proteins required for the activation of the packaging and lysis modules. In summary, we provide evidence that phage packaging and lysis is a conserved mechanism in Siphoviridae infecting a wide variety of Gram-positive bacteria.

RinA controls phage-mediated packaging and transfer of virulence genes in Gram-positive bacteria.

Phage-mediated transfer of microbial genetic elements plays a crucial role in bacterial life style and evolution. In this study, we identify the RinA family of phage-encoded proteins as activators required for transcription of the late operon in a large group of temperate staphylococcal phages. RinA binds to a tightly regulated promoter region, situated upstream of the terS gene, that controls expression of the morphogenetic and lysis modules of the phage, activating their transcription. As expected, rinA deletion eliminated formation of functional phage particles and significantly decreased the transfer of phage and pathogenicity island encoded virulence factors. A genetic analysis of the late promoter region showed that a fragment of 272 bp contains both the promoter and the region necessary for activation by RinA. In addition, we demonstrated that RinA is the only phage-encoded protein required for the activation of this promoter region. This region was shown to be divergent among different phages. Consequently, phages with divergent promoter regions carried allelic variants of the RinA protein, which specifically recognize its own promoter sequence. Finally, most Gram-postive bacteria carry bacteriophages encoding RinA homologue proteins. Characterization of several of these proteins demonstrated that control by RinA of the phage-mediated packaging and transfer of virulence factor is a conserved mechanism regulating horizontal gene transfer.

Host-pathogen interaction: Enterobacter cloacae exerts different adhesion and invasion capacities against different host cell types.

New antibiotics are urgently needed due to the huge increase of multidrug-resistant bacteria. The underexplored gram-negative bacterium Enterobacter cloacae is known to cause severe urinary tract and lung infections (UTIs). The pathogenicity of E. cloacae in UTI has only been studied at the bioinformatic level, but until now not within systematic in vitro investigations. The present study assesses different human cell lines for monitoring the early steps of host-pathogen interaction regarding bacterial adhesion to and invasion into different host cells by flow cytometric adhesion assay, classical cell counting assay, gentamicin invasion assay, and confocal laser scanning microscopy. To our knowledge, this is the first report in which E. cloacae has been investigated for its interaction with human bladder, kidney, skin, and lung cell lines under in vitro conditions. Data indicate that E. cloacae exerts strong adhesion to urinary tract (bladder and kidney) and lung cells, a finding which correlates with the clinical relevance of the bacterium for induction of urinary tract and lung infections. Furthermore, E. cloacae ATCC 13047 barely adheres to skin cells (A-431) and shows no relevant interaction with intestinal cells (Caco-2, HT-29), even in the presence of mucin (HT29 MTX). In contrast, invasion assays and confocal laser scanning microscopy demonstrate that E. cloacae internalizes in all tested host cells, but to a different extent. Especially, bladder and kidney cells are being invaded to the highest extent. Defective mutants of fimH and fimA abolished the adhesion of E. cloacae to T24 cells, while csgA deletion had no influence on adhesion. These results indicate that E. cloacae has different pattern for adhesion and invasion depending on the target tissue, which again correlates with the clinical relevance of the pathogen. For detailed investigation of the early host-pathogen interaction T24 bladder cells comprise a suitable assay system for evaluation the bacterial adhesion and invasion.

Salmonella biofilm development depends on the phosphorylation status of RcsB.

The Rcs phosphorelay pathway is a complex signaling pathway involved in the regulation of many cell surface structures in enteric bacteria. In response to environmental stimuli, the sensor histidine kinase (RcsC) autophosphorylates and then transfers the phosphate through intermediary steps to the response regulator (RcsB), which, once phosphorylated, regulates gene expression. Here, we show that Salmonella biofilm development depends on the phosphorylation status of RcsB. Thus, unphosphorylated RcsB, hitherto assumed to be inactive, is essential to activate the expression of the biofilm matrix compounds. The prevention of RcsB phosphorylation either by the disruption of the phosphorelay at the RcsC or RcsD level or by the production of a nonphosphorylatable RcsB allele induces biofilm development. On the contrary, the phosphorylation of RcsB by the constitutive activation of the Rcs pathway inhibits biofilm development, an effect that can be counteracted by the introduction of a nonphosphorylatable RcsB allele. The inhibition of biofilm development by phosphorylated RcsB is due to the repression of CsgD expression, through a mechanism dependent on the accumulation of the small noncoding RNA RprA. Our results indicate that unphosphorylated RcsB plays an active role for integrating environmental signals and, more broadly, that RcsB phosphorylation acts as a key switch between planktonic and sessile life-styles in Salmonella enterica serovar Typhimurium.

Analysis of the SOS response of Vibrio and other bacteria with multiple chromosomes.

BACKGROUND: The SOS response is a well-known regulatory network present in most bacteria and aimed at addressing DNA damage. It has also been linked extensively to stress-induced mutagenesis, virulence and the emergence and dissemination of antibiotic resistance determinants. Recently, the SOS response has been shown to regulate the activity of integrases in the chromosomal superintegrons of the Vibrionaceae, which encompasses a wide range of pathogenic species harboring multiple chromosomes. Here we combine in silico and in vitro techniques to perform a comparative genomics analysis of the SOS regulon in the Vibrionaceae, and we extend the methodology to map this transcriptional network in other bacterial species harboring multiple chromosomes. RESULTS: Our analysis provides the first comprehensive description of the SOS response in a family (Vibrionaceae) that includes major human pathogens. It also identifies several previously unreported members of the SOS transcriptional network, including two proteins of unknown function. The analysis of the SOS response in other bacterial species with multiple chromosomes uncovers additional regulon members and reveals that there is a conserved core of SOS genes, and that specialized additions to this basic network take place in different phylogenetic groups. Our results also indicate that across all groups the main elements of the SOS response are always found in the large chromosome, whereas specialized additions are found in the smaller chromosomes and plasmids. CONCLUSIONS: Our findings confirm that the SOS response of the Vibrionaceae is strongly linked with pathogenicity and dissemination of antibiotic resistance, and suggest that the characterization of the newly identified members of this regulon could provide key insights into the pathogenesis of Vibrio. The persistent location of key SOS genes in the large chromosome across several bacterial groups confirms that the SOS response plays an essential role in these organisms and sheds light into the mechanisms of evolution of global transcriptional networks involved in adaptability and rapid response to environmental changes, suggesting that small chromosomes may act as evolutionary test beds for the rewiring of transcriptional networks.

A New Variant of the aadE-sat4-aphA-3 Gene Cluster Found in a Conjugative Plasmid from a MDR Campylobacter jejuni Isolate.

Campylobacter jejuni is a foodborne pathogen causing bacterial gastroenteritis, with the highest incidence reported in Europe. The prevalence of antibiotic resistance in C. jejuni, as well as in many other bacterial pathogens, has increased over the last few years. In this report, we describe the presence of a plasmid in a multi-drug-resistant C. jejuni strain isolated from a gastroenteritis patient. Mating experiments demonstrated the transference of this genetic element (pCjH01) among C. jejuni by plasmid conjugation. The pCjH01 plasmid was sequenced and assembled, revealing high similarity (97% identity) with pTet, a described tetracycline resistance encoding plasmid. pCjH01 (47.7 kb) is a mosaic plasmid composed of a pTet backbone that has acquired two discrete DNA regions. Remarkably, one of the acquired sequences carried an undescribed variant of the aadE-sat4-aphA-3 gene cluster, providing resistance to at least kanamycin and gentamycin. Aside from the antibiotic resistance genes, the cluster also carries genes coding for putative regulators, such as a sigma factor of the RNA polymerase and an antisigma factor. Homology searches suggest that Campylobacter exchanges genetic material with distant G-positive bacterial genera.

The SOS response promotes qnrB quinolone-resistance determinant expression.

The qnr genes are plasmid-borne fluoroquinolone-resistance determinants widespread in Enterobacteriaceae. Three families of qnr determinants (qnrA, B and S) have been described, but little is known about their expression and regulation. Two new determinants, qnrC and qnrD, have been found recently. Here, we describe the characterization of the qnrB2 promoter and the identification of a LexA-binding site in the promoter region of all qnrB alleles. LexA is the central regulator of the SOS response to DNA damage. We show that qnrB2 expression is regulated through the SOS response in a LexA/RecA-dependent manner, and that it can be induced by the quinolone ciprofloxacin, a known inducer of the SOS system. This is the first description of direct SOS-dependent regulation of an antibiotic-resistance mechanism in response to the antibiotic itself.

Relevance of DNA alkylation damage repair systems in Salmonella enterica virulence.

Systematic inactivation of pathways involved in DNA alkylation damage repair demonstrated that inactivation of the ada, ogt, tag, uvrA, and mfd genes is required to detect a Salmonella enterica virulence decrease. Furthermore, the fitness of S. enterica, defective in these genes, is lowered only when the bacterium is orally, but not intraperitoneally, inoculated.

Overexpression of the recA gene decreases oral but not intraperitoneal fitness of Salmonella enterica.

Transcription of the Salmonella enterica recA gene is negatively controlled by the LexA protein, the repressor of the SOS response. The introduction of a mutation (recAo6869) in the LexA binding site, in the promoter region of the S. enterica ATCC 14028 recA gene, allowed the analysis of the effect that RecA protein overproduction has on the fitness of this virulent strain. The fitness of orally but not intraperitoneally inoculated recAo6869 cells decreased dramatically. However, the SOS response of this mutant was induced normally, and there was no increase in the sensitivity of the strain toward DNA-damaging agents, bile salts, or alterations in pH. Nevertheless, S. enterica recAo6869 cells were unable to swarm and their capacity to cross the intestinal epithelium was significantly reduced. The swarming deficiency in recAo6869 cells is independent of the flagellar phase. Moreover, swimming activity of the recAo6869 strain was not diminished with respect to the wild type, indicating that the flagellar synthesis is not affected by RecA protein overproduction. In contrast, swarming was recovered in a recAo6869 derivative that overproduced CheW, a protein known to be essential for this function. These data demonstrate that an equilibrium between the intracellular concentrations of RecA and CheW is necessary for swarming in S. enterica. Our results are the first to point out that the SOS response plays a critical role in the prevention of DNA damage by abolishing bacterial swarming in the presence of a genotoxic compound.

Control by Fur of the nitrate respiration regulators NarP and NarL in Salmonella enterica.

Anaerobic metabolism is controlled by several transcriptional regulators, including ArcA, Fnr, NarP, and NarL, with the Fnr and ArcA proteins sensitive to the cell's redox status. Specifically, the two-component ArcAB system is activated in response to the oxidation state of membrane-bound quinones, which are the central electron carriers of respiration. Fnr, by contrast, directly senses cellular oxidation status through the [4Fe-4S] cluster present in its own structure. In this study, a third additional redox-associated pathway that controls the nitrate respiration regulators NarL and NarP was identified. The results showed that, in Salmonella enterica, the expression of these two transcriptional regulators is under the control of Fur, a metalloregulator that senses the presence of Fe2+ and regulates the homeostasis of this cation inside the cell. Thus, the Fur- Fe2+ complex increases the expression of narL and represses that of narP. Furthermore, studies of S. enteric mutants defective in the Fur-regulated sRNA RfrA and RfrB showed that those sRNA control both narP and narL expression. These results confirm Fur as a global regulator based on its involvement not only in iron uptake and detoxification but also in the control of nitrate/nitrite respiration by sensing cellular redox status.

A novel strategy for screening-out raw milk contaminated with Mycobacterium bovis on dairy farms by double-tagging PCR and electrochemical genosensing.

SUMMARY: A highly sensitive assay for rapidly screening-out Mycobacterium bovis in contaminated samples was developed based on electrochemical genosensing. The assay consists of specific amplification and double-tagging of the IS6110 fragment, highly related to M. bovis, followed by electrochemical detection of the amplified product. PCR amplification was carried out using a labeled set of primers and resulted in a amplicon tagged at each terminus with both biotin and digoxigenin. Two different electrochemical platforms for the detection of the double-tagged amplicon were evaluated: (i) an avidin biocomposite (Av-GEB) and (ii) a magneto sensor (m-GEC) combined with streptavidin magnetic beads. In both cases, the double- tagged amplicon was immobilized through its biotinylated end and electrochemically detected, using an antiDig-HRP conjugate, through its digoxigenin end. The assay was determined to be highly sensitive, based on the detection of 620 and 10 fmol of PCR amplicon using the Av-GEB and m-GEC strategies, respectively. Moreover, the m-GEC assay showed promising features for the detection of M. bovis on dairy farms by screening for the presence of the bacterium's DNA in milk samples. The obtained results are discussed and compared with respect to those of inter-laboratory PCR assays and tuberculin skin testing.

The Interaction of RecA With Both CheA and CheW Is Required for Chemotaxis.

Salmonella enterica is the most frequently reported cause of foodborne illness. As in other microorganisms, chemotaxis affords key physiological benefits, including enhanced access to growth substrates, but also plays an important role in infection and disease. Chemoreceptor signaling core complexes, consisting of CheA, CheW and methyl-accepting chemotaxis proteins (MCPs), modulate the switching of bacterial flagella rotation that drives cell motility. These complexes, through the formation of heterohexameric rings composed of CheA and CheW, form large clusters at the cell poles. RecA plays a key role in polar cluster formation, impairing the assembly when the SOS response is activated. In this study, we determined that RecA protein interacts with both CheW and CheA. The binding of these proteins to RecA is needed for wild-type polar cluster formation. In silico models showed that one RecA molecule, attached to one signaling unit, fits within a CheA-CheW ring without interfering with the complex formation or array assembly. Activation of the SOS response is followed by an increase in RecA, which rises up the number of signaling complexes associated with this protein. This suggests the presence of allosteric inhibition in the CheA-CheW interaction and thus of heterohexameric ring formation, impairing the array assembly. STED imaging demonstrated that all core unit components (CheA, CheW, and MPCs) have the same subcellular location as RecA. Activation of the SOS response promotes the RecA distribution along the cell instead of being at the cell poles. CheA- and CheW- RecA interactions are also crucial for chemotaxis, which is maintained when the SOS response is induced and the signaling units are dispersed. Our results provide new molecular-level insights into the function of RecA in chemoreceptor clustering and chemotaxis determining that the impaired chemoreceptor clustering not only inhibits swarming but also modulates chemotaxis in SOS-induced cells, thereby modifying bacterial motility in the presence of DNA-damaging compounds, such as antibiotics.

Magneto immunoseparation of pathogenic bacteria and electrochemical magneto genosensing of the double-tagged amplicon.

A rapid and sensitive method for the detection of food pathogenic bacteria is reported. In this approach, the bacteria are captured and preconcentrated from food samples with magnetic beads by immunological reaction with the specific antibody against Salmonella. After the lysis of the captured bacteria, further amplification of the genetic material by PCR with a double-tagging set of primers is performed to confirm the identity of the bacteria. Both steps are rapid alternatives to the time-consuming classical selective enrichment and biochemical/serological tests. The double-tagged amplicon is then detected by electrochemical magneto genosensing. The "IMS/double-tagging PCR/m-GEC electrochemical genosensing" approach is used for the first time for the sensitive detection of Salmonella artificially inoculated into skim milk samples. A limit of detection of 1 CFU mL(-1) was obtained in 3.5 h without any pretreatment, in LB broth and in milk diluted 1/10 in LB. If the skim milk is pre-enriched for 6 h, the method is able to feasibly detect as low as 0.04 CFU mL(-1) (1 CFU in 25 g of milk) with a signal-to-background ratio of 20. Moreover, the method is able to clearly distinguish between pathogenic bacteria such as Salmonella and Escherichia coli. The features of this approach are discussed and compared with classical culture methods and PCR-based assay.

Double-tagging polymerase chain reaction with a thiolated primer and electrochemical genosensing based on gold nanocomposite sensor for food safety.

A novel material for electrochemical biosensing based on rigid conducting gold nanocomposite (nano-AuGEC) is presented. Islands of chemisorbing material (gold nanoparticles) surrounded by nonreactive, rigid, and conducting graphite epoxy composite are thus achieved to avoid the stringent control of surface coverage parameters required during immobilization of thiolated oligos in continuous gold surfaces. The spatial resolution of the immobilized thiolated DNA was easily controlled by merely varying the percentage of gold nanoparticles in the composition of the composite. As low as 9 fmol (60 pM) of synthetic DNA were detected in hybridization experiments when using a thiolated probe. Moreover, for the first time a double tagging PCR strategy was performed with a thiolated primer for the detection of Salmonella sp., one of the most important foodborne pathogens affecting food safety. This assay was performed by double-labeling the amplicon during the PCR with a -DIG and -SH set of labeled primers. The thiolated end allows the immobilization of the amplicon on the nano-AuGEC electrode, while digoxigenin allows the electrochemical detection with the antiDIG-HRP reporter in the femtomole range. Rigid conducting gold nanocomposite represents a good material for the improved and oriented immobilization of biomolecules with excellent transducing properties for the construction of a wide range of electrochemical biosensors such as immunosensors, genosensors, and enzymosensors.

Impedimetric detection of double-tagged PCR products using novel amplification procedures based on gold nanoparticles and Protein G.

Double-tagged DNA coming from PCR amplification of a Salmonella spp. sample was detected by an electrochemical impedimetric genosensor based on avidin bulk-modified graphite-epoxy biocomposite (Av-GEB). The double-tagging PCR strategy provided the amplicon with both biotin and digoxigenin (DIG) moieties. The immobilization of the double-tagged DNA was based on its biotin moiety, while the DIG label was used for signal amplification. Impedance spectra were recorded to detect the change in interfacial charge transfer resistance (R(ct)), experimented by the redox marker ferri-/ferro-cyanide after the avidin-biotin fixation of the sample DNA onto the electrode surface. A further step in the genosensing strategy was the amplification of impedimetric signal by the use of an enhancing procedure. The latter was based on the reaction of the DIG moiety belonging to the amplicon with an anti-DIG antibody from mouse. Two different secondary enhancing steps based both on gold nanoparticle-labelled anti-mouse IgG or on Protein G were performed and compared for improving assay sensitivity.

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.