First report of Grapevine asteroid mosaic associated virus in grapevine in Spain.

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

First Detection and Molecular Characterization of Apple Stem Grooving Virus, Apple Chlorotic Leaf Spot Virus, and Apple Hammerhead Viroid in Loquat in Spain.

Loquat (Eriobotrya japonica) is an important crop in Spain. To date, only one viral species, apple stem pitting virus (ASPV), has been detected in Spanish loquat orchards. In this study, the presence of additional viruses infecting this crop in Spain was investigated. RT-PCR and high-throughput sequencing (HTS) of symptomatic loquat plants led to first-time detection and characterization of apple stem grooving virus (ASGV), also known as citrus tatter leaf virus (CTLV), and apple chlorotic leaf spot virus (ACLSV) from Spain with description of nearly complete genomic sequences. The frequency of ACLSV infection was the highest, with over 30% of the samples testing positive and were also detected as coinfections with ASGV and ASPV, although most of the samples infected were symptomless. Studies on all the full-length sequences available in the databases were performed in order to establish the phylogenetic relationships of the Spanish isolates of these two viral species. Moreover, apple hammerhead viroid (AHVd) was also detected to infect loquat, the first host different from apple reported for this viroid to date.

Characterization of Spanish Olive Virome by High Throughput Sequencing Opens New Insights and Uncertainties.

The use of high throughput sequencing (HTS) for the analysis of Spanish olive trees showing leaf yellowing discoloration, defoliation, and/or decline has provided new insights into the olive viruses present in Spain and has opened discussions about the pros and cons of these technologies for diagnostic purposes. In this study, we report for the first time in Spanish orchards the presence of olive leaf yellowing-associated virus (OLYaV), for which the second full coding sequence has been determined. This virus has also been detected in a putative vector, the psyllid Euphyllura olivina. In addition, the presence in Spain of Olea europaea geminivirus (OEGV), recently reported in Italy, has been confirmed, and the full-length sequence of two isolates was obtained by HTS and Sanger sequencing. These results, as well as the detection of other viral sequences related to olive latent virus 3 (OLV-3) and olive viral satellite RNA, raises questions on the biological significance of the findings, about the requirement of standardization on the interpretation of HTS results, and the necessity of additional tests to confirm the relevance of the HTS detection of viral sequences.

Loquat (Eriobotrya japonica) is a New Natural Host of Apple Stem Pitting Virus.

Loquat (Eriobotrya japonica) is a minor but important woody crop cultivated in Asia and Europe. High-throughput sequencing (HTS) analysis of an asymptomatic loquat plant using RNAseq Illumina technology has allowed the detection for the first time of apple stem pitting virus (ASPV), the type species of the genus Foveavirus in the family Betaflexiviridae, infecting this crop. A nearly complete genome of 9303 nts (ASPV-SL61) reconstructed bioinformatically shows the typical genomic structure of this viral species and a highest nucleotide identity (85.9%) with the Chinese ASPV isolate YLX from pear. A close phylogenetic relationship between ASPV-SL61 and ASPV-YLX has been confirmed by the sequence analysis of full-length ASPV genomic sequences available in the databases. In fact, a phylogenetic study based on a partial CP N-terminal sequence previously proposed to be involved in host adaptation has shown that ASPV-SL61 loquat isolate is more closely related to ASPV pear isolates. The presence of ASPV in loquat has been further confirmed by RT-PCR and Sanger sequencing and DAS-ELISA. An incidence of 15% was determined in one of the loquat Spanish growing areas. The sequence analysis of the partial CP sequences amplified by RT-PCR has shown a high level of variability between loquat isolates. To our knowledge, this is the first record of loquat as a natural host of ASPV.

Molecular Characterization of the Complete Coding Sequence of Olive Leaf Yellowing-Associated Virus.

Genome organization and phylogenetic relationships of olive leaf yellowing-associated virus (OLYaV) with other members of the Closteroviridae family were determined. The complete coding sequence of OLYaV was obtained by high throughput sequencing of total RNA from a 35-year-old olive tree (cv. Zarzaleña) from Brazil, showing olive leaf yellowing disease and deformations in the wood. This represents the first report of OLYaV in this country. A genomic sequence of 16,700 nt containing 11 open reading frames (ORFs) was recovered, representing the complete virus coding capacity. The knowledge of the nucleotide sequence of the genome including the gene that codes the coat protein will facilitate the development of diagnostic tests, which are limited so far to PCR-based methods targeting the HSP70h gene. Interestingly, a thaumatin-like protein (ORF2), previously reported in other unassigned viruses in the Closteroviridae family, persimmon virus B and actidinia virus 1, was identified in the OLYaV genome. Phylogenetic analysis of shared proteins (ORF1a, ORF1b, HSP70h, HSP90h and CP) with all members of the Closteroviridae family provides new insight into the taxonomic position of these three closteroviruses and suggests they could represent a new genus in the family.

Specific Real-Time PCR for the Detection and Absolute Quantitation of Grapevine Roditis Leaf Discoloration-Associated Virus, an EPPO Alert Pathogen.

Grapevine Roditis leaf discoloration-associated virus (GRLDaV) is an emerging grapevine pathogen included in the European and Mediterranean Plant Protection Organization (EPPO) alert list due to its ability to damage grapevine crops and cause production losses. This work aimed to develop a specific and reliable diagnostic tool that would contribute to preventing the spread of this pathogen. Therefore, a TaqMan real-time quantitative PCR was developed. The method was validated according to EPPO guidelines showing a high degree of analytical sensitivity, analytical specificity, selectivity, and repeatability and reproducibility. The sensitivity of this method is much higher than the sensitivity reached by previously reported methods even when tested in crude extracts, which could allow rapid testing by avoiding nucleic acid extraction steps. The method was also able to detect GRLDaV isolates from all the geographic origins reported so far, despite their high degree of genetic diversity. In addition, this new technique has been successfully applied for the quantitative detection of GRLDaV in plant material and two mealybug species, Planococcus citri and Pseudococcus viburni. In conclusion, the methodology developed herein represents a significant contribution to the diagnosis and control of this emerging pathogen in grapevine.

Efectividad del mousse de sangrecita y nivel de hemoglobina en los niños de 3 años en las instituciones educativas iniciales, Ica-Perú / Effectiveness of sangrecita mousse little blood and hemoglobin level in children from 3 years of age in the initial educational institutions Ica-Peru

El estudio tuvo como Objetivo: Evaluar la efectividad del mousse de sangrecita en los niveles de hemoglobina en los niños de dos instituciones Educativas iniciales. Materiales y métodos: Estudio Experimental con diseño cuasi experimental de corte longitudinal, la población de estudio estuvo conformada por 80 niños los cuales todos participaron (consentimiento de los padres), 52 niños fueron de la IEI de Ica y 28 de la IEI de Comatrana, para la muestra se realizó un muestreo no probabilístico mediante el descarte de anemia utilizando el analizador de hemoglobina (hemoQ), microcubetas, lancetas y demás implementos, de ellos 9 niños tuvieron una hemoglobina <=11gr/dl quienes ingresaron al programa de mousse de sangrecita. Se elaboró una ficha de control. Resultados: Después de 7 semanas de consumir el mousse de sangrecita los 9 niños que ingresaron al programa de las dos IEI, se evidencio un incremento en sus niveles de hemoglobina superior al primer control. Conclusiones: El consumo de mousse de sangrecita es efectiva en el tratamiento de la anemia en niños de la IEI incrementando el nivel de hemoglobina. (AU)

The Objective of the study was to evaluate the effectiveness of blood mousse on hemoglobin levels in children from two initial educational institutions. Materials and Methods: Study experimental Quasi-experimental desing of longitudinal cut, the study population was made up of 80 children who all participated (parental consent), 52 children were from the IEI of Ica and 28 from the IEI of Comatrana, for the sample a non-probability sampling was carried out by discarding anemia using the hemoglobin analyzer (hemoQ), microcuvettes, lancets andother implements, of them 9 children had a hemoglobin < = 11gr / dl who would enter the blood mousse program. A control sheet was drawn up. Results: After 7 weeks of consuming the blood mousse of the 9 children who entered the program of the two IEI, there was evidence of an increase in their hemoglobin levels higher than the first control. Conclusions: The consumption of blood mousse is effective in the treatment of anemia in children with IEI by increasing the level of hemoglobin. (AU)