The complete genome sequence of a putative novel cytorhabdovirus identified in Chelidonium majus in China.

A new cytorhabdovirus, tentatively named "chelidonium yellow mottle associated virus" (CheYMaV), was identified in Chelidonium majus with yellow mottle symptoms by high-throughput sequencing and RT-PCR. Its genome is 12,121 nucleotides in length and contains eight open reading frames (ORFs) in the order 3'-N-P'-P-P3-M-G-P6-L-5'. Amino acid sequence comparisons between the putative proteins of CheYMaV and the corresponding proteins of other cytorhabdoviruses showed that it shares the highest sequence similarity with Trifolium pratense virus A (TpVA, MH982250) and Glehnia littoralis virus 1 (GllV1, BK014304), but with sequence identity values below the species demarcation threshold for cytorhabdoviruses (< 80%). Phylogenetic analysis showed that CheYMaV is most closely related to TpVA and GllV1. CheYMaV should therefore be considered a new member of the genus Cytorhabdovirus. This is the first report of a cytorhabdovirus identified in Chelidonium majus.

First report of Hibiscus latent Singapore virus and Hibiscus latent Fort Pierce virus infecting Lantana camara in China.

Hibiscus latent Singapore virus (HLSV) and Hibiscus latent Fort Pierce virus (HLFPV) both belong to the genus Tobamovirus in the family Virgaviridae. The genomes of both HLSV and HLFPV consist of a linear positive sense single-stranded RNA of about 6.3 kb. HLSV is the causal agent of hibiscus leaf crinkle disease. Infections of HLSV in hibiscus (Hibiscus rosa-sinensis) have so far only been reported in Singapore, Japan and Malaysia (Srinivasan et al., 2002; Yoshida et al., 2018; Yusop et al., 2021). In 2017, leaf curling and chlorosis symptoms of lantana (Lantana camara) plants were found in Chenshan Botanical Garden, Shanghai, China. To detect potential virus(es) in these lantana samples, leaves from one lantana plant were collected and total RNA was extracted with RNAiso Plus (TaKaRa). A cDNA library was prepared by TruSeq RNA Sample Prep Kit (Illumina) after removing ribosomal RNA by Ribo-ZeroTM rRNA Removal Kit (Epicentre). The paired-end sequencing was then performed on an Illumina NovaSeq 6000. A total of 61,085,018 high quality reads were obtained and de novo assembly by StringTie revealed 124,516 contigs (greater than 50 bp, N50=719 bp) with an average length of 537 bp. BLASTx analyses in the National Center for Biotechnology Information (NCBI) database showed that 1 long contig of 6,305 bp, assembled of 1794 clean reads, shared significant nucleotide similarities with the genomic sequence of HLSV, and 1 contig of 6,271 bp, assembled of 3174 clean reads, shared significant similarities with the genomic sequence of HLFPV, yielding an average coverage of the whole genome at 42.65 and 75.83 per million reads, respectively. To obtain the complete genome of the viral RNA in this lantana sample, eleven overlapping regions covering the entire HLSV viral genome, and nine overlapping regions covering the entire HLFPV viral genome were amplified by reverse transcription-PCR (RT-PCR) and sequenced. In addition, the exact 5' and 3' ends of the genomic RNA of each virus were determined by rapid amplification of the cDNA ends (RACE) (Wang et al. 2020). The complete genome of the identified HLSV, deposited in GenBank: MZ020960, is 6,486 nt in length and shows 98.4% nucleotide sequence identity with HLSV Singapore isolate (GenBank: AF395898). Similar to other HLSV isolates, this virus isolate possesses an internal poly(A) tract of 87 nucleotides, which is crucial to virus replication (Niu et al., 2015). The complete genome of the Lantana HLFPV isolate is 6,463 nt (GenBank MZ020961) including a 73 nt internal poly(A) tract, and has 98.4% nt identity to HLFPV-Japan (AB917427). In two other lantana plants from the same site, the presence of HLSV and HLFPV was confirmed by RT-PCR using the primer pairs (5'-GCATCTGCATAACACGGTTG-3'/5'-ACGTTGTAGTAGACGTTGTTGTAG-3' and 5'-GGACCTTGCTAATCCGCTAAAGTTG-3'/5'-GGTCCATGTCCATCCAGATGCAATC-3'). In addition to the HLSV and HLFPV genomes, BLASTx analysis of three contigs of 3,006 bp, 2,845 bp and 2,200 bp, assembled of 1328, 352 and 2280 clean reads respectively, showed high identity to RNAs 1 (MG182148), 2 (DQ412731) and 3 (KY794710) of cucumber mosaic virus. To the best of our knowledge, this is the first report of L. camara as a new natural host of HLSV and HLFPV, and first identification of a mixed infection of HLSV and HLFPV.

First report of cucumber green mottle mosaic virus infecting Cynanchum rostellatum in China.

Cucumber green mottle mosaic virus (CGMMV) was first discovered on cucumber in the United Kingdom in 1935 (Ainsworth, 1935), and has spread worldwide except to Antarctica (Jones, 2021). Given its extensive damage, it is considered an important pathogen on global cucurbit plants and fruit crops. In China, CGMMV was first reported on pumpkin in Guangxi Province in 2003 (Qin et al., 2005), and occurred on 34 plants species across 23 provinces (Liu et al., 2016). Cynanchum rostellatum is a member of the family Apocynaceae. In July 2021, leaves of C. rostellatum exhibiting virus-like symptoms (yellowing, severe crinkling, deformation) were observed and collected in Liaoning Province, China. Aphids were also observed on the leaves and stems (Fig. S1) of the plants and were collected. Total RNA was extracted from diseased leaves following the CTAB method, followed by the depletion of ribosomal RNAs (rRNA) with TIANSeq rRNA Depletion Kit (Tiangen, China). The RNAs were, then processed into a DNBSEQ LncRNA-Seq library, and sequenced on the MGISEQ-2000 platform at BGI Genomics (Wuhan, China). A total of 106.98 M clean reads were obtained after data filtering using SOAPnuke software (BGI, China). The clean reads were assembled into contigs using CLC Genomics Workbench 11 (Qiagen, USA) and Trinity v2.0.6 (Haas et al., 2013). A contig (4,760 reads, average coverage:73.76) of 6,391 nucleotides was found to share the highest sequence identity (99.83%) with CGMMV isolate GDLZ (MK933286), irrespective of other virus-like contigs related to Polerovirus and Totivirus. Based on the genome of GDLZ isolate, seven specific primers (Table S1) were designed to amplify the full viral genomic sequences using a PrimeScriptTM One-Step RT-PCR Kit. Seven expected amplicons were obtained, cloned, and sequenced. The complete genome was determined to be 6,423 nucleotides (GenBank accession number OR854819) in length and designated as LNMJ isolate. LNMJ shared 96.8%-99.7% nucleotide sequence identities with CGMMV isolates from China. Phylogenetic analysis based on the complete genome sequences showed that LNMJ clustered together with CGMMV isolates hn (GenBank accession number KC851866), GDLZ (GenBank accession number MK933286), and JD8 (GenBank accession number KM873784) from China. The specific primers LM-TJ-3F/3R were designed to determine the virus-symptom association for LNMJ, and all twelve symptomatic C. rostellatum plants collected from fields tested positive for LNMJ. Two out of six randomly selected aphids from the diseased plants also tested positive. To further prove its infectivity, LNMJ was inoculated mechanically onto ten healthy Nicotiana benthamiana plants, and the results indicated a high infection rate of 80% (8/10), at 30 days post-inoculation despite no distinct symptoms observed. To our knowledge, this is the first report of the natural infection of C. rostellatum plants with CGMMV. C. rostellatum is a widespread herb in China (Wei et al., 2019) and more surveys are needed to determine the distribution of CGMMV. The habitats of C. rostellatum span diverse agroecological zones, and thus our study underscores the potential spillover of CGMMV to neighboring crops as a significant risk.

Annual (2023) taxonomic update of RNA-directed RNA polymerase-encoding negative-sense RNA viruses (realm Riboviria: kingdom Orthornavirae: phylum Negarnaviricota).

In April 2023, following the annual International Committee on Taxonomy of Viruses (ICTV) ratification vote on newly proposed taxa, the phylum Negarnaviricota was amended and emended. The phylum was expanded by one new family, 14 new genera, and 140 new species. Two genera and 538 species were renamed. One species was moved, and four were abolished. This article presents the updated taxonomy of Negarnaviricota as now accepted by the ICTV.

Viromics unveils extraordinary genetic diversity of the family Closteroviridae in wild citrus.

Our knowledge of citrus viruses is largely skewed toward virus pathology in cultivated orchards. Little is known about the virus diversity in wild citrus species. Here, we used a metatranscriptomics approach to characterize the virus diversity in a wild citrus habitat within the proposed center of the origin of citrus plants. We discovered a total of 44 virus isolates that could be classified into species Citrus tristeza virus and putative species citrus associated ampelovirus 1, citrus associated ampelovirus 2, and citrus virus B within the family Closteroviridae, providing important information to explore the factors facilitating outbreaks of citrus viruses and the evolutionary history of the family Closteroviridae. We found that frequent horizontal gene transfer, gene duplication, and alteration of expression strategy have shaped the genome complexity and diversification of the family Closteroviridae. Recombination frequently occurred among distinct Closteroviridae members, thereby facilitating the evolution of Closteroviridae. Given the potential emergence of similar wild-citrus-originated novel viruses as pathogens, the need for surveillance of their pathogenic and epidemiological characteristics is of utmost priority for global citrus production.

Characterization of a putative novel higrevirus infecting Phellodendron amurense Rupr. in China.

Phellodendron-associated higre-like virus (PaHLV) was identified in Phellodendron amurense Rupr. in China. Three near-full-length sequences of the viral genomic RNAs (RNA1-RNA3) were first obtained by RNA-seq, and their complete sequences were then determined by RT-PCR, 5'-RACE, and 3'-RACE. RNA1-3 of PaHLV were determined to be 8,183, 3,062, and 3,998 nucleotides (nt) in length, respectively, excluding the poly(A) tail. All of the viral proteins encoded by PaHLV shared the highest amino acid sequence identity (44.8-78.1%) with the unclassified kitavirid pistachio virus X (PiVX, MT334618-MT334620) from Iranian pistachio. Sequence comparisons and phylogenetic analysis also showed PiVX to be the closest relative of PaHLV and supported their inclusion in the genus Higrevirus, family Kitaviridae. Thus, PaHLV is proposed to be a member of a new species in this genus, for which we suggest the binomial name "Higrevirus amur".

Detection and characterization of a putative emaravirus infecting Clematis brevicaudata DC. in China.

A novel emaravirus, tentatively named "clematis yellow mottle associated virus" (CYMaV), was identified through transcriptome sequencing and RT-PCR analysis of yellow-mottled leaf samples from Clematis brevicaudata DC. The genome of CYMaV consists of five viral RNAs: RNA1 (6591 nucleotides, nt), RNA2 (1982 nt), RNA3a (1301 nt), RNA3b (1397 nt), and RNA4 (1192 nt). The 13-nt sequences at the 5'- and 3'-termini of the CYMaV RNAs are conserved and have reverse complementary, as typically seen in emaraviruses. The proteins encoded by CYMaV shared the highest amino acid sequence similarity with those of the unclassified Karaka Okahu purepure emaravirus (KOPV), with 60.2% identity in the RNA-dependent RNA polymerase (RdRp), 44.4% in the glycoprotein precursor, and 46.9% in the nucleocapsid protein. A phylogenetic tree based on amino acid sequences of the RdRp revealed that CYMaV is most closely related to KOPV and clusters with ChMaV (chrysanthemum mosaic-associated virus, LC576445) and PCLSaV (pear chlorotic leaf spot-associated virus, MK602177) in one distinct clade. Transmission electron microscopy observation of negatively stained samples from C. brevicaudata revealed spherical virus-like particles (VLPs) approximately 100 nm in diameter. Five primers, specific for each viral RNA, were used to detect CYMaV in 11 symptomatic and two asymptomatic C. brevicaudata samples, but the results failed to show a consistent association of viral infection with symptoms. CYMaV can be considered a putative new member in the genus Emaravirus, and this marks the first report of an emaravirus found infecting C. brevicaudata plants.

Molecular characterization of a novel amalgavirus infecting lilium spp. in China.

A novel plant virus with a double-stranded (ds) RNA genome was detected in Lilium spp. in China by high-throughput sequencing and tentatively named "lily amalgavirus 2" (LAV2). The genomic RNA of LAV2 is 3432 nucleotides (nt) in length and contains two open reading frames (ORFs) that putatively encode a '1 + 2' fusion protein of 1053 amino acids (aa), generated by a '+1' programmed ribosomal frameshift (PRF). ORF1 encodes a putative 386-aa protein of unknown function, and ORF2 overlaps ORF1 by 350 nt and encodes a putative 783-aa protein with conserved RNA-dependent RNA polymerase (RdRp) motifs. The '+1' ribosomal frameshifting motif, UUU_CGN, which is highly conserved among amalgaviruses, is also found in LAV2. Sequence analysis showed that the complete genome shared 46.04%-51.59% nucleotide sequence identity with those of members of the genus Amalgavirus and had the most similarity (51.59% sequence identity) to lily amalgavirus 1 (accession no. OM782323). Phylogenetic analysis based on RdRp amino acid sequences showed that LAV2 clustered with members of the genus Amalgavirus. Overall, our data suggest that LAV2 is a new member of the genus Amalgavirus.

Identification and molecular characterization of a novel cytorhabdovirus from rose plants (Rosa chinensis Jacq.).

A novel negative-sense single-stranded RNA virus, tentatively named "rose-associated cytorhabdovirus" (RaCV), was identified by high-throughput sequencing. RaCV is 16,067 nucleotides in length and contains eight open reading frames (ORFs 1-8) encoding a nucleocapsid protein (N), a putative phosphoprotein (P), a putative P3 protein (P3), a putative P4 protein (P4), a putative matrix protein (M), a glycoprotein (G), a putative P7 protein (P7), and an RNA-dependent RNA polymerase (L), respectively. The coding genes are flanked by a 3' leader sequence (228 nt) and a 5' trailer sequence (251 nt) and are separated by conserved intergenic junctions (3'-AUUCUUUUUG(N)nCUN-5'). Phylogenetic analysis showed that RaCV clustered with yerba mate virus A (YmVA) within the cytorhabdovirus clade, and it exhibited low a degree of nt sequence similarity (<40% identity) to other rhabdoviruses. Amino acid sequence comparisons between the putative proteins of RaCV and the corresponding proteins of other cytorhabdoviruses showed that the sequence identity levels were far below the species demarcation cutoff of 80% for cytorhabdoviruses. These results suggest that RaCV should be classified as a new member of the genus Cytorhabdovirus.

Virus classification based on in-depth sequence analyses and development of demarcation criteria using the Betaflexiviridae as a case study.

Currently, many viruses are classified based on their genome organization and nucleotide/amino acid sequence identities of their capsid and replication-associated proteins. Although biological traits such as vector specificities and host range are also considered, this later information is scarce for the majority of recently identified viruses, characterized only from genomic sequences. Accordingly, genomic sequences and derived information are being frequently used as the major, if not only, criteria for virus classification and this calls for a full review of the process. Herein, we critically addressed current issues concerning classification of viruses in the family Betaflexiviridae in the era of high-throughput sequencing and propose an updated set of demarcation criteria based on a process involving pairwise identity analyses and phylogenetics. The proposed framework has been designed to solve the majority of current conundrums in taxonomy and to facilitate future virus classification. Finally, the analyses performed herein, alongside the proposed approaches, could be used as a blueprint for virus classification at-large.

Complete genome sequence of a distinct rosadnavirus isolated from Viola plants in China.

In 2019, plants of the genus Viola showing yellow mottling symptoms were collected in Liaoning, China. RNA sequencing and PCR both confirmed the presence of a reverse-transcribing DNA virus. The novel virus was named "viola yellow mottle virus" (VYMV), and its 9,872-bp genome was found to contain eight open reading frames. The polymerase (RT + RNase H) gene shared the most similarity (31.6% nucleotide and 41.6% amino acid sequence identity) with that of rose yellow vein virus (RYVV, NC_020999), which is currently the only member of the genus Rosadnavirus. Phylogenetic analysis indicated a close relationship between these viruses, suggesting that VYMV should be considered a new member of the genus Rosadnavirus.

Complete genome sequence of Edgeworthia chrysantha mosaic-associated virus, a tentative new member of the genus Coguvirus (family Phenuiviridae).

A new negative-strand RNA (nsRNA) virus genome was discovered in Edgeworthia chrysantha Lindl. This virus, tentatively named "Edgeworthia chrysantha mosaic-associated virus" (ECMaV), has a bipartite genome that comprises (i) a nsRNA1, encoding the viral RNA-dependent RNA polymerase (RdRp), and (ii) an ambisense RNA2, coding for the putative movement protein (MP) and nucleocapsid protein (NP), with the open reading frames separated by a long AU-rich intergenic region (IR). Sequence comparisons and phylogenetic analysis showed that the RdRp is closely related to those of other recently discovered plant-infecting nsRNA viruses in the new genus Coguvirus and that ECMaV can be classified as a member of a novel species.

A putative new emaravirus isolated from Ailanthus altissima (Mill.) Swingle with severe crinkle symptoms in China.

A putative new emaravirus, named "ailanthus crinkle leaf-associated emaravirus" (ACrLaV), was detected in Ailanthus altissima with severe crinkle symptoms by RNA-Seq and RT-PCR. Four viral segments associated with ACrLaV were identified and fully sequenced, except for a few nucleotides at the genomic termini. The RNA-dependent RNA polymerase (RNA1), glycoprotein (RNA2), nucleocapsid protein (RNA3), and movement protein (RNA4), showed 26.5%-57%, 17%-49.9%, 14.4%-40.4%, and 14.1%-65.9% amino acid sequence identity, respectively, to those of known emaraviruses. All four ACrLaV genomic RNA segments are most closely related to those of common oak ringspot-associated virus from Germany, as supported by sequence comparisons and phylogenetic analysis. ACrLaV is considered a distinct member of the genus Emaravirus, and this is the first report of an emaravirus in A. altissima.

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China.

Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.

Viromics Reveals the Viral Diversity in Cultivated and Wild Kiwifruit.

China, the center of origin of kiwifruit, has the largest kiwifruit cultivation and production area worldwide, and Shaanxi Province is the major kiwifruit-growing region in China. However, our knowledge of kiwifruit viruses is largely skewed toward their pathology in cultivated orchards, and little is known about viral diversity in wild kiwifruit. To determine the viral diversity in cultivated and wild kiwifruit, 32 cultivated kiwifruit samples from Shaanxi Province and 30 wild kiwifruit samples from the Qinling Mountains were collected and subjected to high-throughput sequencing in this study. Eleven known viruses were found among the 32 cultivated kiwifruit samples, and 8 known viruses and 2 new viruses were found among the 30 wild kiwifruit samples. One of the two new viruses, Actinidia yellowing virus 3 (AcYV3), a member of the genus Idaeovirus, may be associated with severe yellowing of kiwifruit leaves. In addition, more than 50 nearly full-length genome sequences of known viruses were obtained. The detection rates, recombination, and molecular variation of these viruses were further analyzed. The results obtained in this study provide valuable information for understanding the virome of cultivated and wild kiwifruit.

Watermelon crinkle leaf-associated virus 1 and watermelon crinkle leaf-associated virus 2 have a bipartite genome with molecular signatures typical of the members of the genus Coguvirus (family Phenuiviridae).

Watermelon crinkle leaf-associated virus 1 and watermelon crinkle leaf-associated virus 2 (WCLaV-1 and WCLaV-2), two unclassified members of the order Bunyavirales, are phylogenetically related to members of the genus Coguvirus (family Phenuiviridae). The genome of both viruses was reported previously to be composed of three RNA segments. However, the terminal sequences of two genomic RNA segments, namely those encoding the putative movement protein (MP) and the nucleocapsid (NP) protein, remained undetermined. High-throughput sequencing of total RNA and small RNA preparations, combined with reverse transcription PCR amplification followed by sequencing, revealed that the WCLaV-1 and WCLaV-2 possess a bipartite genome consisting of a negative-sense RNA1, encoding the RNA-dependent RNA polymerase, and an ambisense RNA2, encoding the putative movement (MP) and nucleocapsid (NP) proteins. The two open reading frames of RNA2 are in opposite orientations and are separated by a long AU-rich intergenic region (IR) that may assume a hairpin conformation. RNA1 and RNA2 of both viruses share almost identical 5' and 3' termini, which are complementary to each other up to 20 nt. This genome organization is typical of members of the genus Coguvirus, with which WCLaV-1 and WCLaV-2 also share similar terminal 5' and 3' sequences of RNA1 and RNA2. These molecular features, together with phylogenetic reconstructions support the classification of WCLaV-1 and WCLaV2 as members of two new species in the genus Coguvirus.

Complete genome sequence of camellia virus A, a tentative new member of the genus Waikavirus.

A new positive-strand RNA virus genome was discovered in Camellia japonica plants. The complete genome of the virus is 12,570 nt in size, excluding the poly(A) tail, and contains one large open reading frame (ORF1) and two small open reading frames (ORF2, ORF3). ORF1 and ORF2 are homologous to sequences of waikaviruses, while ORF3 has no relatives in the databases. ORF1 encodes a putative polyprotein precursor that is putatively processed into eight smaller proteins, as in typical waikaviruses. Comprehensive analysis, including BLAST searches, genome organization and pairwise sequence comparisons, and phylogeny reconstructions, invariably placed the virus with the waikaviruses. Furthermore, due to lower amino acid sequence identity to known waikaviruses than the threshold species demarcation cutoff, this virus may represent a new species in the genus Waikavirus, family Secoviridae, and we have tentatively named it "camellia virus A" (CamVA). Finally, a field survey was conducted to assess the occurrence of CamVA in camellias and its associated symptoms.

Complete nucleotide sequence of a new carlavirus infecting Aconitum carmichaelii in China.

A novel virus was identified in aconite (Aconitum carmichaelii Debx.) in China by high-throughput sequencing (HTS) and tentatively named "aconite virus A" (AcVA). The genomic RNA of AcVA consists of 8,844 nucleotides, excluding the poly(A) at the 3' end. Analysis of the genomic organization of AcVA indicated that it possesses a genomic structure that is typical of carlaviruses and contains six putative open reading frames (ORFs). Pairwise analysis revealed that the replicase and coat protein of AcVA share the highest amino acid sequence identity (43.78% and 57.01%) with those of coleus vein necrosis virus (CVNV) and butterbur mosaic virus (ButMV), respectively. Based on the current classification criteria for carlaviruses, AcVA should be considered a distinct member of the genus Carlavirus.

Molecular characterization of a novel cytorhabdovirus associated with chrysanthemum yellow dwarf disease.

Deep-sequencing analysis of a chrysanthemum plant with yellow dwarf symptoms led to the discovery of a novel putative cytorhabdovirus, here tentatively named "chrysanthemum yellow dwarf associated virus" (CYDaV). Its negative-sense single-stranded RNA genome comprises 14,086 nucleotides and contains eight open reading frames in the order 3' leader-N-P'-P-P3-M-G-P6-L-5' trailer. CYDaV shares moderate sequence similarity (< 54.2% nucleotide and 51% amino acid sequence identity) with its cytorhabdovirus counterparts in cognate genes. Phylogenetic analysis showed that CYDaV clustered with strong support with alfalfa dwarf virus, raspberry vein chlorosis virus, and strawberry crinkle virus. These findings suggest that CYDaV should be considered a novel member of the genus Cytorhabdovirus, family Rhabdoviridae.

Identification and molecular characterization of a novel carlavirus infecting rose plants (Rosa chinensis Jacq.).

In the present study, the genome sequence of a potential novel virus, tentatively named "rose virus C" (RVC), was mined from publically available transcriptomic data from a Rosa chinensis plant. The complete genome sequence of RVC consists of 8,386 nt, excluding a 3' poly(A) tail, and contains five ORFs. Phylogenetic analysis showed that RVC clustered with members of the genus Carlavirus, family Betaflexiviridae. The replicase gene had 48.8-52.1% nt sequence identity to those of other carlaviruses, while the CP gene had 40.4-45.9% nt sequence identity, which is far below the species demarcation cutoff of 72%. The incidence of RVC in rose plants was low (5.4%). Overall, our data suggest that RVC is a novel atypical virus of the genus Carlavirus.