Interactions of small molecules with DNA junctions.

The four natural DNA bases (A, T, G and C) associate in base pairs (A=T and G≡C), allowing the attached DNA strands to assemble into the canonical double helix of DNA (or duplex-DNA, also known as B-DNA). The intrinsic supramolecular properties of nucleobases make other associations possible (such as base triplets or quartets), which thus translates into a diversity of DNA structures beyond B-DNA. To date, the alphabet of DNA structures is ripe with approximately 20 letters (from A- to Z-DNA); however, only a few of them are being considered as key players in cell biology and, by extension, valuable targets for chemical biology intervention. In the present review, we summarise what is known about alternative DNA structures (what are they? When, where and how do they fold?) and proceed to discuss further about those considered nowadays as valuable therapeutic targets. We discuss in more detail the molecular tools (ligands) that have been recently developed to target these structures, particularly the three- and four-way DNA junctions, in order to intervene in the biological processes where they are involved. This new and stimulating chemical biology playground allows for devising innovative strategies to fight against genetic diseases.

Probing a Major DNA Weakness: Resolving the Groove and Sequence Selectivity of the Diimine Complex Λ-[Ru(phen)2 phi]2.

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen)2 phi]2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG)2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence.

Increasing the π-Expansive Ligands in Ruthenium(II) Polypyridyl Complexes: Synthesis, Characterization, and Biological Evaluation for Photodynamic Therapy Applications.

Lack of selectivity is one of the main issues with currently used chemotherapies, causing damage not only to altered cells but also to healthy cells. Over the last decades, photodynamic therapy (PDT) has increased as a promising therapeutic tool due to its potential to treat diseases like cancer or bacterial infections with a high spatiotemporal control. Ruthenium(II) polypyridyl compounds are gaining attention for their application as photosensitizers (PSs) since they are generally nontoxic in dark conditions, while they show remarkable toxicity after light irradiation. In this work, four Ru(II) polypyridyl compounds with sterically expansive ligands were studied as PDT agents. The Ru(II) complexes were synthesized using an alternative route to those described in the literature, which resulted in an improvement of the synthesis yields. Solid-state structures of compounds [Ru(DIP)2phen]Cl2 and [Ru(dppz)2phen](PF6)2 have also been obtained. It is well-known that compound [Ru(dppz)(phen)2]Cl2 binds to DNA by intercalation. Therefore, we used [Ru(dppz)2phen]Cl2 as a model for DNA interaction studies, showing that it stabilized two different sequences of duplex DNA. Most of the synthesized Ru(II) derivatives showed very promising singlet oxygen quantum yields, together with noteworthy photocytotoxic properties against two different cancer cell lines, with IC50 in the micro- or even nanomolar range (0.06-7 µM). Confocal microscopy studies showed that [Ru(DIP)2phen]Cl2 and [Ru(DIP)2TAP]Cl2 accumulate preferentially in mitochondria, while no mitochondrial internalization was observed for the other compounds. Although [Ru(dppn)2phen](PF6)2 did not accumulate in mitochondria, it interestingly triggered an impairment in mitochondrial respiration after light irradiation. Among others, [Ru(dppn)2phen](PF6)2 stands out for its very good IC50 values, correlated with a very high singlet oxygen quantum yield and mitochondrial respiration disruption.

Correction: Time-resolved infra-red studies of photo-excited porphyrins in the presence of nucleic acids and in HeLa tumour cells: insights into binding site and electron transfer dynamics.

Correction for 'Time-resolved infra-red studies of photo-excited porphyrins in the presence of nucleic acids and in HeLa tumour cells: insights into binding site and electron transfer dynamics' by Páraic M. Keane et al., Phys. Chem. Chem. Phys., 2022, 24, 27524-27531, https://doi.org/10.1039/D2CP04604K.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Time-resolved infra-red studies of photo-excited porphyrins in the presence of nucleic acids and in HeLa tumour cells: insights into binding site and electron transfer dynamics.

Cationic porphyrins based on the 5,10,15,20-meso-(tetrakis-4-N-methylpyridyl) core (TMPyP4) have been studied extensively over many years due to their strong interactions with a variety of nucleic acid structures, and their potential use as photodynamic therapeutic agents and telomerase inhibitors. In this paper, the interactions of metal-free TMPyP4 and Pt(II)TMPyP4 with guanine-containing nucleic acids are studied for the first time using time-resolved infrared spectroscopy (TRIR). In D2O solution (where the metal-free form exists as D2TMPyP4) both compounds yielded similar TRIR spectra (between 1450-1750 cm-1) following pulsed laser excitation in their Soret B-absorption bands. Density functional theory calculations reveal that vibrations centred on the methylpyridinium groups are responsible for the dominant feature at ca. 1640 cm-1. TRIR spectra of D2TMPyP4 or PtTMPyP4 in the presence of guanosine 5'-monophosphate (GMP), double-stranded {d(GC)5}2 or {d(CGCAAATTTGCG)}2 contain negative-going signals, 'bleaches', indicative of binding close to guanine. TRIR signals for D2TMPyP4 or PtTMPyP bound to the quadruplex-forming cMYC sequence {d(TAGGGAGGG)}2T indicate that binding occurs on the stacked guanines. For D2TMPyP4 bound to guanine-containing systems, the TRIR signal at ca. 1640 cm-1 decays on the picosecond timescale, consistent with electron transfer from guanine to the singlet excited state of D2TMPyP4, although IR marker bands for the reduced porphyrin/oxidised guanine were not observed. When PtTMPyP is incorporated into HeLa tumour cells, TRIR studies show protein binding with time-dependent ps/ns changes in the amide absorptions demonstrating TRIR's potential for studying light-activated molecular processes not only with nucleic acids in solution but also in biological cells.

Caught in the Loop: Binding of the [Ru(phen)2 (dppz)]2+ Light-Switch Compound to Quadruplex DNA in Solution Informed by Time-Resolved Infrared Spectroscopy.

Ultrafast time-resolved infrared (TRIR) is used to report on the binding site of the [Ru(phen)2 (dppz)]2+ "light-switch" complex with both bimolecular (Oxytricha nova telomere) and intramolecular (human telomere) guanine-quadruplex structures in both K+ and Na+ containing solutions. TRIR permits the simultaneous monitoring both of the "dark" and "bright" states of the complex and of the quadruplex nucleobase bases, the latter via a Stark effect induced by the excited state of the complex. These data are used to establish the contribution of guanine base stacking and loop interactions to the binding site of this biologically relevant DNA structure in solution. A particularly striking observation is the strong thymine signal observed for the Na+ form of the human telomere sequence, which is expected to be in the anti-parallel conformation.

Spectro-electrochemical Studies on [Ru(TAP)2(dppz)]2+-Insights into the Mechanism of its Photosensitized Oxidation of Oligonucleotides.

[Ru(TAP)2(dppz)]2+ (TAP = 1,4,5,8-tetraazaphenanthrene; dppz = dipyrido[3,2- a:2',3'- c]phenazine) is known to photo-oxidize guanine in DNA. Whether this oxidation proceeds by direct photoelectron transfer or by proton-coupled electron transfer is still unknown. To help distinguish between these mechanisms, spectro-electrochemical experiments have been carried out with [Ru(TAP)2(dppz)]2+ in acetonitrile. The UV-vis and mid-IR spectra obtained for the one-electron reduced product were compared to those obtained by picosecond transient absorption and time-resolved infrared experiments of [Ru(TAP)2(dppz)]2+ bound to guanine-containing DNA. An interesting feature of the singly reduced species is an electronic transition in the near-IR region (with λmax at 1970 and 2820 nm). Density functional and time-dependent density functional theory simulations of the vibrational and electronic spectra of [Ru(TAP)2(dppz)]2+, the reduced complex [Ru(TAP)2(dppz)]+, and four isomers of [Ru(TAP)(TAPH)(dppz)]2+ (a possible product of proton-coupled electron transfer) were performed. Significantly, these predict absorption bands at λ > 1900 nm (attributed to a ligand-to-metal charge-transfer transition) for [Ru(TAP)2(dppz)]+ but not for [Ru(TAP)(TAPH)(dppz)]2+. Both the UV-vis and mid-IR difference absorption spectra of the electrochemically generated singly reduced species [Ru(TAP)2(dppz)]+ agree well with the transient absorption and time-resolved infrared spectra previously determined for the transient species formed by photoexcitation of [Ru(TAP)2(dppz)]2+ intercalated in guanine-containing DNA. This suggests that the photochemical process in DNA proceeds by photoelectron transfer and not by a proton-coupled electron transfer process involving formation of [Ru(TAP)(TAPH)(dppz)]2+, as is proposed for the reaction with 5'-guanosine monophosphate. Additional infrared spectro-electrochemical measurements and density functional calculations have also been carried out on the free TAP ligand. These show that the TAP radical anion in acetonitrile also exhibits strong broad near-IR electronic absorption (λmax at 1750 and 2360 nm).

Structural Studies Reveal Enantiospecific Recognition of a DNA G-Quadruplex by a Ruthenium Polypyridyl Complex.

By using X-ray crystallography, we show that the complexes Λ/Δ-[Ru(TAP)2 (11-CN-dppz)]2+ (TAP=1,4,5,8-tetraazaphenanthrene, dppz=dipyridophenazine) bind DNA G-quadruplex in an enantiospecific manner that parallels the specificity of these complexes with duplex DNA. The Λ complex crystallises with the normally parallel stranded d(TAGGGTTA) tetraplex to give the first such antiparallel strand assembly in which syn-guanosine is adjacent to the complex at the 5' end of the quadruplex core. SRCD measurements confirm that the same conformational switch occurs in solution. The Δ enantiomer, by contrast, is present in the structure but stacked at the ends of the assembly. In addition, we report the structure of Λ-[Ru(phen)2 (11-CN-dppz)]2+ bound to d(TCGGCGCCGA), a duplex-forming sequence, and use both structural models to provide insight into the motif-specific luminescence response of the isostructural phen analogue enantiomers.

X-ray Crystal Structures Show DNA Stacking Advantage of Terminal Nitrile Substitution in Ru-dppz Complexes.

The new complexes [Ru(TAP)2 (11-CN-dppz)]2+ , [Ru(TAP)2 (11-Br-dppz)]2+ and [Ru(TAP)2 (11,12-diCN-dppz)]2+ are reported. The addition of nitrile substituents to the dppz ligand of the DNA photo-oxidising complex [Ru(TAP)2 (dppz)]2+ promote π-stacking interactions and ordered binding to DNA, as shown by X-ray crystallography. The structure of Λ-[Ru(TAP)2 (11-CN-dppz)]2+ with the DNA duplex d(TCGGCGCCGA)2 shows, for the first time with this class of complex, a closed intercalation cavity with an AT base pair at the terminus. The structure obtained is compared to that formed with the 11-Br and 11,12-dinitrile derivatives, highlighting the stabilization of syn guanine by this enantiomer when the terminal base pair is GC. In contrast the AT base pair has the normal Watson-Crick orientation, highlighting the difference in charge distribution between the two purine bases and the complementarity of the dppz-purine interaction. The asymmetry of the cavity highlights the importance of the purine-dppz-purine stacking interaction.

Delta chirality ruthenium 'light-switch' complexes can bind in the minor groove of DNA with five different binding modes.

[Ru(phen)2(dppz)]2+ has been studied since the 1990s due to its 'light-switch' properties. It can be used as a luminescent DNA probe, with emission switched on through DNA binding. The luminescence observed is dependent on the solvent accessibility of the pyrazine nitrogen atoms, and therefore is sensitive to changes in both binding site of the cation and chromophore orientation. The compound is also chiral, and there are distinct differences between the enantiomers in terms of the emission behaviour when bound to a variety of DNA sequences. Whilst a number of binary DNA-complex X-ray crystal structures are available, most include the Λ enantiomer and there is very little structural information about binding of the Δ enantiomer. Here, we present the first X-ray crystal structure of a Δ enantiomer bound to well-matched DNA, in the absence of the other, Λ enantiomer. We show how the binding site observed here can be related to a more general pattern of motifs in the crystallographic literature and propose that the Δ enantiomer can bind with five different binding modes, offering a new hypothesis for the interpretation of solution data.

Guanine Can Direct Binding Specificity of Ru-dipyridophenazine (dppz) Complexes to DNA through Steric Effects.

X-ray crystal structures of three Λ-[Ru(L)2 dppz]2+ complexes (dppz=dipyridophenazine; L=1,10-phenanthroline (phen), 2,2'-bipyridine (bpy)) bound to d((5BrC)GGC/GCCG) showed the compounds intercalated at a 5'-CG-3' step. The compounds bind through canted intercalation, with the binding angle determined by the guanine NH2 group, in contrast to symmetrical intercalation previously observed at 5'-TA-3' sites. This result suggests that canted intercalation is preferred at 5'-CG-3' sites even though the site itself is symmetrical, and we hypothesise that symmetrical intercalation in a 5'-CG-3' step could give rise to a longer luminescence lifetime than canted intercalation.

Inosine Can Increase DNA's Susceptibility to Photo-oxidation by a RuII Complex due to Structural Change in the Minor Groove.

Key to the development of DNA-targeting phototherapeutic drugs is determining the interplay between the photoactivity of the drug and its binding preference for a target sequence. For the photo-oxidising lambda-[Ru(TAP)2 (dppz)]2+ (Λ-1) (dppz=dipyridophenazine) complex bound to either d{T1 C2 G3 G4 C5 G6 C7 C8 G9 A10 }2 (G9) or d{TCGGCGCCIA}2 (I9), the X-ray crystal structures show the dppz intercalated at the terminal T1 C2 ;G9 A10 step or T1 C2 ;I9 A10 step. Thus substitution of the G9 nucleobase by inosine does not affect intercalation in the solid state although with I9 the dppz is more deeply inserted. In solution it is found that the extent of guanine photo-oxidation, and the rate of back electron-transfer, as determined by pico- and nanosecond time-resolved infrared and transient visible absorption spectroscopy, is enhanced in I9, despite it containing the less oxidisable inosine. This is attributed to the nature of the binding in the minor groove due to the absence of an NH2 group. Similar behaviour and the same binding site in the crystal are found for d{TTGGCGCCAA}2 (A9). In solution, we propose that intercalation occurs at the C2 G3 ;C8 I9 or T2 G3 ;C8 A9 steps, respectively, with G3 the likely target for photo-oxidation. This demonstrates how changes in the minor groove (in this case removal of an NH2 group) can facilitate binding of RuII dppz complexes and hence influence any sensitised reactions occurring at these sites. No similar enhancement of photooxidation on binding to I9 is found for the delta enantiomer.

Long-Lived Excited-State Dynamics of i-Motif Structures Probed by Time-Resolved Infrared Spectroscopy.

UV-generated excited states of cytosine (C) nucleobases are precursors to mutagenic photoproduct formation. The i-motif formed from C-rich sequences is known to exhibit high yields of long-lived excited states following UV absorption. Here the excited states of several i-motif structures have been characterized following 267 nm laser excitation using time-resolved infrared spectroscopy (TRIR). All structures possess a long-lived excited state of ∼300 ps and notably in some cases decays greater than 1 ns are observed. These unusually long-lived lifetimes are attributed to the interdigitated DNA structure which prevents direct base stacking overlap.

Monitoring guanine photo-oxidation by enantiomerically resolved Ru(II) dipyridophenazine complexes using inosine-substituted oligonucleotides.

The intercalating [Ru(TAP)2(dppz)](2+) complex can photo-oxidise guanine in DNA, although in mixed-sequence DNA it can be difficult to understand the precise mechanism due to uncertainties in where and how the complex is bound. Replacement of guanine with the less oxidisable inosine (I) base can be used to understand the mechanism of electron transfer (ET). Here the ET has been compared for both Λ- and Δ-enantiomers of [Ru(TAP)2(dppz)](2+) in a set of sequences where guanines in the readily oxidisable GG step in {TCGGCGCCGA}2 have been replaced with I. The ET has been monitored using picosecond and nanosecond transient absorption and picosecond time-resolved IR spectroscopy. In both cases inosine replacement leads to a diminished yield, but the trends are strikingly different for Λ- and Δ-complexes.

Reversal of a Single Base-Pair Step Controls Guanine Photo-Oxidation by an Intercalating Ruthenium(II) Dipyridophenazine Complex.

Small changes in DNA sequence can often have major biological effects. Here the rates and yields of guanine photo-oxidation by Λ-[Ru(TAP)2(dppz)](2+) have been compared in 5'-{CCGGATCCGG}2 and 5'-{CCGGTACCGG}2 using pico/nanosecond transient visible and time-resolved IR (TRIR) spectroscopy. The inefficiency of electron transfer in the TA sequence is consistent with the 5'-TA-3' versus 5'-AT-3' binding preference predicted by X-ray crystallography. The TRIR spectra also reveal the differences in binding sites in the two oligonucleotides.

Controlled dehydration of a ruthenium complex-DNA crystal induces reversible DNA kinking.

Hydration-dependent DNA deformation has been known since Rosalind Franklin recognized that the relative humidity of the sample had to be maintained to observe a single conformation in DNA fiber diffraction. We now report for the first time the crystal structure, at the atomic level, of a dehydrated form of a DNA duplex and demonstrate the reversible interconversion to the hydrated form at room temperature. This system, containing d(TCGGCGCCGA) in the presence of Λ-[Ru(TAP)2(dppz)](2+) (TAP = 1,4,5,8-tetraazaphenanthrene, dppz = dipyrido[3,2-a:2',3'-c]phenazine), undergoes a partial transition from an A/B hybrid to the A-DNA conformation, at 84-79% relative humidity. This is accompanied by an increase in kink at the central step from 22° to 51°, with a large movement of the terminal bases forming the intercalation site. This transition is reversible on rehydration. Seven data sets, collected from one crystal at room temperature, show the consequences of dehydration at near-atomic resolution. This result highlights that crystals, traditionally thought of as static systems, are still dynamic and therefore can be the subject of further experimentation.

Structure determination of an intercalating ruthenium dipyridophenazine complex which kinks DNA by semiintercalation of a tetraazaphenanthrene ligand.

We describe a crystal structure, at atomic resolution (1.1 Å, 100 K), of a ruthenium polypyridyl complex bound to duplex DNA, in which one ligand acts as a wedge in the minor groove, resulting in the 51° kinking of the double helix. The complex cation Λ-[Ru(1,4,5,8-tetraazaphenanthrene)(2)(dipyridophenazine)](2+) crystallizes in a 11 ratio with the oligonucleotide d(TCGGCGCCGA) in the presence of barium ions. Each complex binds to one duplex by intercalation of the dipyridophenazine ligand and also by semiintercalation of one of the orthogonal tetraazaphenanthrene ligands into a second symmetrically equivalent duplex. The result is noncovalent cross-linking and marked kinking of DNA.

Re-pairing DNA: binding of a ruthenium phi complex to a double mismatch.

We report a crystal structure at atomic resolution (0.9 Å) of a ruthenium complex bound to a consecutive DNA double mismatch, which results in a TA basepair with flipped out thymine, together with the formation of an adenine bulge. The structure shows a form of metalloinsertion interaction of the Λ-[Ru(phen)2phi]2+ (phi = 9,10-phenanthrenediimine) complex at the bulge site. The metal complex interacts with the DNA via the major groove, where specific interactions between the adenines of the DNA and the phen ligands of the complex are formed. One Δ-[Ru(phen)2phi]2+ complex interacts via the minor groove, which shows sandwiching of its phi ligand between the phi ligands of the other two ruthenium complexes, and no interaction of its phen ligands with DNA. To our knowledge, this binding model represents a new form of metalloinsertion in showing major rather than minor groove insertion.

X-ray crystal structure of rac-[Ru(phen)2dppz]2+ with d(ATGCAT)2 shows enantiomer orientations and water ordering.

We report an atomic resolution X-ray crystal structure containing both enantiomers of rac-[Ru(phen)2dppz](2+) with the d(ATGCAT)2 DNA duplex (phen = phenanthroline; dppz = dipyridophenazine). The first example of any enantiomeric pair crystallized with a DNA duplex shows different orientations of the Λ and Δ binding sites, separated by a clearly defined structured water monolayer. Job plots show that the same species is present in solution. Each enantiomer is bound at a TG/CA step and shows intercalation from the minor groove. One water molecule is directly located on one phenazine N atom in the Δ-enantiomer only.