First Report of Soybean vein necrosis-associated virus in Ohio Soybean Fields.

Soybean vein necrosis-associated virus (SVNaV), a newly discovered tospovirus that infects soybean, was first described as widespread in a number of southern and midwestern states, but so far has not been reported in Ohio (1). Here we describe its occurrence in six different soybean leaf samples collected from five Ohio counties: Champaign, Hardin, Sandusky, Seneca, and Wyandot. Specifically, SVNaV was initially identified through a comprehensive survey during the summer of 2011 that used high throughput sequencing to detect genome sequences of viruses present in a pool of 110 field samples collected from 24 Ohio counties. Three assembled contigs, with sizes of 7,551, 4,937, and 1,554 nucleotides (nt) respectively, share 99% nt identity with the three SVNaV genomic RNAs (L, M, and S), and thus constitute partial sequences of the SVNaV Ohio (OH) isolate. The distribution of this virus was further delineated using reverse transcription (RT)-PCR with primers SVNaV-1734F (5' CCATCTTTCTTTCCAGGCATTTCA 3') and SVNaV-S-2421R (5' GATTCAAGTTCAGCGAGTTCTACAA 3'). All plants from which the SVNaV-positive samples were collected showed typical virus symptoms, including systemic mosaic accompanied by leaf deformation, chlorosis, vein necrosis, and rusty spots on mature leaves. These symptoms are largely consistent with the previous report by Zhou and colleagues (1). Intriguingly, further analysis with RT-PCR revealed that five out of the six SVNaV-positive samples also contained a second virus, with Bean pod mottle virus found in four of the samples, and Tobacco ringspot virus in the fifth. Since it is not yet possible to initiate SVNaV infection mechanically, it is difficult to determine whether the co-infecting viruses contribute to the disease symptoms and yield losses. It should be noted that SVNaV may have been in Ohio for some time since symptoms similar to those reported by Zhou and colleagues (1) have been observed in soybean fields of this state since at least 2009. Furthermore, while in 2011 these symptoms were observed in only a few fields, as reflected by the detection of SVNaV in six of the 110 samples, the 2012 growing season has seen a big jump of symptomatic plants and fields. The current report confirms its presence with molecular evidence and lays the groundwork for further assessment of its impact on soybean production. Reference: (1) J. Zhou et al. Virus Genes 43:289, 2011.

First Report of Alfalfa mosaic virus and Soybean dwarf virus on Soybean in North Dakota.

Soybean (Glycine max L.) is the major oilseed crop in North Dakota, with production concentrated in the eastern half of the state. Only one virus, Soybean mosaic virus, has been reported from soybean in North Dakota (4). In July and August of 2010, 200 soybean fields from 25 counties were surveyed for Alfalfa mosaic virus (AMV) and Soybean dwarf virus (SbDV). AMV and SbDV have been detected infecting soybean in multiple Midwestern states and are reported to reduce yields in soybean (1,3). Each field was sampled with a grid pattern across the area with at least 8 km between fields. From each field, leaves were collected from 20 plants without regard for symptoms along a transect of approximately 170 m. Leaves from each field were bulked and sap was extracted in phosphate buffer and stored at -80°C until tested using double-antibody sandwich (DAS)-ELISA with positive controls and reagents and protocols from Agdia Inc. (Elkhart, IN). Using DAS-ELISA, AMV was detected in eight of the 200 soybean fields. For sequence-based virus detection, total RNA was extracted from all field samples using a Qiagen RNeasy Plant Mini Kit (Germantown, MD), pooled, depleted of ribosomal RNA (RiboZero Epicentre, Madison, WI), reverse transcribed, sequenced using an Illumina HiSeq2000 (San Diego, CA), and compared to all available viral amino acid and nucleotide sequences. The analysis detected AMV and SbDV sequences in the pool of 200 fields. The presence of AMV and SbDV was confirmed by quantitative real-time reverse transcription (qRT)-PCR (1,3). For AMV, total RNA extracted from bulked leaves from each of the 200 fields was tested using AMVspecific primers (5'-ATGCTACCCAGGCATGTATATTT-3' and 5'-GCTGCATCTTTCGCCAGAA-3') and a FAM-labeled minor-groove binding TaqMan probe (5'-TGGACGTTACCCCCGGA-3'). One field sample from Cass county positive for AMV by ELISA was also positive for AMV by qRT-PCR, confirming the presence of AMV in the field sample. For SbDV, an RNA pool representing all 200 fields, subpools, and individual field samples was analyzed by qRT-PCR (1) and DAS-ELISA. One field sample from Grand Forks County tested positive for SbDV by qRT-PCR and DAS-ELISA, confirming the presence of SbDV in the field sample. Because leaf samples were collected and pooled prior to analysis, the symptom phenotypes of individual field plants could not be correlated with positive ELISA or qRT-PCR results. AMV was reported by the American Phytopathological Society Virus Working Group (2007 to 2008) to be widely prevalent in North Dakota, but we found no peer-reviewed reports of verified AMV identification on any crop in the state. To our knowledge, this is the first confirmed report of AMV and SbDV infecting soybean in North Dakota. Serious infestations by the soybean aphid, Aphis glycines, requiring chemical control, have occurred in recent years in North Dakota. Because A. glycines is a vector for both viruses (1,2), the distribution, incidence, and agronomic impact of AMV and SbDV could be affected in years when A. glycines infestations are high. In addition, AMV is seedborne in soybean and may cause seed mottling, a concern for the food-grade soybean industry where production is primarily for export. References: (1) V. D. Damsteegt et al. Plant Dis. 95:945, 2011 (2) J. H. Hill et al. Plant Dis. 85:561, 2001. (3) H. A. Hobbs et al. Plant Health Progress doi:10.1094/PHP-2010-0827-01-BR, 2010. (4) B. D. Nelson and L. L. Domier. Plant Dis. 93:760, 2009.

Acquisition and Transmissibility of U.S. Soybean dwarf virus Isolates by the Soybean Aphid, Aphis glycines.

Soybean dwarf virus (SbDV) exists as several distinct strains based on symptomatology, vector specificity, and host range. Originally characterized Japanese isolates of SbDV were specifically transmitted by Aulacorthum solani. More recently, additional Japanese isolates and endemic U.S. isolates have been shown to be transmitted by several different aphid species. The soybean aphid, Aphis glycines, the only aphid that colonizes soybean, has been shown to be a very inefficient vector of some SbDV isolates from Japan and the United States. Transmission experiments have shown that the soybean aphid can transmit certain isolates of SbDV from soybean to soybean and clover species and from clover to clover and soybean with long acquisition and inoculation access periods. Although transmission of SbDV by the soybean aphid is very inefficient, the large soybean aphid populations that develop on soybean may have epidemiological potential to produce serious SbDV-induced yield losses.

Evaluation of Soybean for Resistance to Neohyadatothrips variabilis (Thysanoptera: Thripidae) Noninfected and Infected With Soybean Vein Necrosis Virus.

Soybean vein necrosis virus (SVNV) was first identified in Arkansas and Tennessee in 2008 and is now known to be widespread in the United States and Canada. Multiple species of thrips transmit this and other tospoviruses with Neohydatothrips variabilis (Beach) (soybean thrips) cited as the most efficient vector for SVNV. In this study, 18 soybean, Glycine max (L.) Merr., genotypes were evaluated in four experiments by infesting plants with noninfected and SVNV-infected thrips using choice and no-choice assays. In both choice experiments with noninfected and SVNV-infected thrips, the lowest number of immature soybean thrips occurred on plant introductions (PIs) 229358 and 604464 while cultivars Williams 82 and Williamsfield Illini 3590N supported higher counts of mature thrips. The counts between the two assays (noninfected and SVNV-infected thrips) were positively correlated. In both no-choice experiments with noninfected and SVNV-infected thrips, counts of thrips did not differ by soybean genotypes. Further studies are needed to characterize the inheritance and mechanisms involved in the resistance found in the choice assay.

Sequence diversity of readthrough proteins of Soybean dwarf virus isolates from the Midwestern United States.

The amino acid sequence diversity of readthrough proteins (RTPs) of 24 dwarfing isolates of Soybean dwarf virus (SbDV) from Wisconsin and Illinois was analyzed. The RTP, a minor component of viral capsids, has a significant role in specificity of aphid transmission of luteovirids. Among the isolates, nucleotide sequence identities ranged from 95 to 100%. The predicted amino acid sequences differed at 56 amino acid positions in the 54 kDa RTD compared to only five positions in the 22 kDa CP. Phylogenetic analysis of both amino acid and nucleotide sequences showed three distinct clusters of SbDV isolates.

First Report of Soybean mosaic virus on Soybean in North Dakota.

Soybean, Glycine max L, is grown on 1,420,000 ha in North Dakota and is the most important oilseed crop in the state. Viruses in soybean have not previously been reported from North Dakota (2). In July and August of 2007, 64 soybean fields in Cass, Richland, and Sargent counties in southeastern North Dakota were surveyed for Soybean mosaic virus (SMV). These counties have a high concentration of soybean hectares, a long history of soybean production, and soybean aphid infestations that were observed in 2004 and 2006. Fields were sampled with a grid pattern across the area with at least 8 km (5 miles) between fields. A transect of approximately 60 m through each field was made and 20 leaves were collected at random. Sap was extracted in phosphate buffer and stored at -80°C until tested first using double antibody sandwich (DAS)-ELISA with positive controls and reagents and protocol from Agdia Inc. (Elkhart, IN). Using DAS-ELISA, SMV was detected in 19 of the 64 soybean fields sampled. To confirm the presence of SMV, 12 samples that were positive for SMV by DAS-ELISA also were tested by reverse transcription (RT)-PCR. RNA was extracted from sap by a Qiagen RNeasy Plant Mini Kit (Germantown, MD), reverse transcribed, and amplified with SuperScrip III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen Inc., Carlsbad, CA) and SMV-specific primers (5'-TTCAGCACAATGGGTGAGGATG-3' and 5'-AATTCTGTGTGGCTTGATGTTGC-3') (1). Eight of the twelve ELISA-positive samples were positive for SMV by RT-PCR, confirming the presence of SMV in the samples. To our knowledge, this is the first report of SMV infecting soybean in North Dakota. References: (1) L. L. Domier et al. (Abstr.). Phytopathology 98(suppl.):S47, 2008. (2) B. D. Nelson and G. Danielson. (Abstr.). Phytopathology 95(suppl.):S164, 2005.

First Report of Soybean yellow mottle mosaic virus in Soybean in North America.

Soybean yellow mottle mosaic virus (SYMMV) is a soybean-infecting virus recently discovered in Korea that initially induces bright yellow mosaic on leaves followed by stunting and reduced growth of older leaves (1). Nucleotide sequence analysis of genomic RNA of the Korean SYMMV isolate suggested that the virus is a new member of the genus Carmovirus in the family Tombusviridae. To determine whether SYMMV is present in the United States, single leaflets were collected without regard for symptoms from 7 to 10 plants in each of 136 plots in August 2008 from a research field in Stoneville, MS that contained 16 plant introductions (including five from Korea) and 'Williams 82'. Samples were grouped into 10 pools of 100 leaves from which total RNA was extracted with the Qiagen RNeasy Plant Mini Kit (Germantown, MD), reverse transcribed, and amplified with SuperScript III Platinum SYBR Green One-Step Quantitative Real-time Reverse Transcriptase-PCR Kit (Invitrogen, Carlsbad, CA) and two pairs of oligonucleotide primers (5'-CGTCTGCCAGGGTTTAATACTA-3', and 5'-GATTAGCATGTCAGGGTGGTCG-3'; and 5'-ACTGAGTCCCCTGCTTAT-3' and 5'-CATCACTAGCGTCYGGATCA-3') that were designed from regions conserved between SYMMV and Cowpea mottle virus (CPMoV; a related and seed-transmitted carmovirus). Six 100-leaflet pools were positive with both primer sets and four pools were negative with both primer sets. Total RNA extracted from one positive pool was reverse transcribed using SuperScript II reverse transcriptase and a primer complementary to nt 4,000 to 4,009 of the SYMMV genome and amplified using iProof DNA polymerase (Bio-Rad, Hercules, CA) as two overlapping DNA fragments using primers corresponding to nt 1 to 21 and complementary to nt 3,483 to 3,508 and corresponding to nt 3,366 to 3,391 and complementary to nt 4,000 to 4,009. DNA fragments were sequenced using a BigDye Terminator Cycle Sequencing Kit and ABI 3730XL capillary sequencers (Applied Biosystems, Foster City, CA). The 4,009-nt sequence of the Mississippi SYMMV isolate (GenBank Accession No. FJ707484) was 96% identical to the Korean SYMMV isolate and 65% identical to CPMoV. Because of the sampling techniques used, it was not possible to associate SYMMV-positive plants with disease symptoms in Mississippi. To our knowledge, this is the first report of SYMMV in North America. Reference: (1) M. Nam et al. Online publication. doi:10.1077/s00705-009-0480. Arch. Virol., 2009.

Soybean mosaic virus: a successful potyvirus with a wide distribution but restricted natural host range.

TAXONOMY: Soybean mosaic virus (SMV) is a species within the genus Potyvirus, family Potyviridae, which includes almost one-quarter of all known plant RNA viruses affecting agriculturally important plants. The Potyvirus genus is the largest of all genera of plant RNA viruses with 160 species. PARTICLE: The filamentous particles of SMV, typical of potyviruses, are about 7500 Å long and 120 Å in diameter with a central hole of about 15 Å in diameter. Coat protein residues are arranged in helices of about 34 Å pitch having slightly less than nine subunits per turn. GENOME: The SMV genome consists of a single-stranded, positive-sense, polyadenylated RNA of approximately 9.6 kb with a virus-encoded protein (VPg) linked at the 5' terminus. The genomic RNA contains a single large open reading frame (ORF). The polypeptide produced from the large ORF is processed proteolytically by three viral-encoded proteinases to yield about 10 functional proteins. A small ORF, partially overlapping the P3 cistron, pipo, is encoded as a fusion protein in the N-terminus of P3 (P3N + PIPO). BIOLOGICAL PROPERTIES: SMV's host range is restricted mostly to two plant species of a single genus: Glycine max (cultivated soybean) and G. soja (wild soybean). SMV is transmitted by aphids non-persistently and by seeds. The variability of SMV is recognized by reactions on cultivars with dominant resistance (R) genes. Recessive resistance genes are not known. GEOGRAPHICAL DISTRIBUTION AND ECONOMIC IMPORTANCE: As a consequence of its seed transmissibility, SMV is present in all soybean-growing areas of the world. SMV infections can reduce significantly seed quantity and quality (e.g. mottled seed coats, reduced seed size and viability, and altered chemical composition). CONTROL: The most effective means of managing losses from SMV are the planting of virus-free seeds and cultivars containing single or multiple R genes. KEY ATTRACTIONS: The interactions of SMV with soybean genotypes containing different dominant R genes and an understanding of the functional role(s) of SMV-encoded proteins in virulence, transmission and pathogenicity have been investigated intensively. The SMV-soybean pathosystem has become an excellent model for the examination of the genetics and genomics of a uniquely complex gene-for-gene resistance model in a crop of worldwide importance.

First Report of Soybean dwarf virus in Soybean in Northern Illinois.

Soybean dwarf virus (SbDV), a member of the Luteoviridae, is transmitted persistently by colonizing aphids and causes significant yield losses in soybean (Glycine max L.) in Japan. In the United States, SbDV is endemic in red and white clover (Trifolium pratense L. and T. repens L.) (1,3). Even so, SbDV has been detected in soybean only in Virginia (2) and Wisconsin (4). A study conducted in Illinois during 2001 and 2002 detected SbDV in clover but not soybean (3). During August of 2006, two surveys for virus diseases in soybean were conducted in Illinois. In the first survey, 30 soybean leaf samples were collected without regard for symptoms from each of 10 fields in each of five northern Illinois counties (Carroll, Jo Daviess, Ogle, Stephenson, and Winnebago). In the second survey, 10 random soybean leaf samples and 10 samples with virus-like symptoms were collected from each of 30 soybean rust sentinel plots spread throughout Illinois. Total RNA was extracted from pools of 90 to 100 plants and analyzed by quantitative real-time reverse transcriptase (QRT)-PCR using a fluorescently labeled minor groove binding probe (VIC-5'-AGCATATCCAAAGACGC-3'-MGBNFQ, nt 2358-2374) and flanking primers (5'-TGGCTATTATAGAATGGTGCGTAAAC-3', nt 2327-2351; and 5'-GCCATGGAAATGAGGGAATG-3', nt 2395-2376). From the first survey, pools from Carroll, Jo Daviess, and Ogle were positive for SbDV. Analysis of individual leaf samples from positive pools by double-antibody sandwich-ELISA (Agdia, Elkhart, IN) showed that one sample in each county was positive for SbDV. On the basis of the number of randomly sampled plants, the incidence of SbDV infection in northern Illinois was approximately 0.3%. In the second survey, SbDV was detected in one pool containing symptomatic plants from five soybean rust sentinel plots. Further QRT-PCR analysis showed that the sentinel plot in Bureau County was positive for SbDV. Because of the sampling protocols used, it was not possible to determine symptom phenotypes of SbDV-positive samples. Sequence analysis of the combined coat protein (CP) and readthrough domain (RTD) encoding region (nt 3019-5094) of SbDV isolates from Bureau (GenBank Accession No. EU095847) and Carroll (GenBank Accession No. EU095846) counties showed that the predicted amino acid sequences were 96 and 95% identical to a Japanese dwarfing isolate of SbDV (GenBank Accession No. AB038150), respectively. The predicted CP amino acid sequences of the Illinois isolates were identical and RTD amino acid sequences differed at six positions. To our knowledge, this is the first report of infection of soybean plants in Illinois with SbDV. References: (1) V. D. Damsteegt et al. Phytopathology 89:374, 1999. (2) A. Fayad et al. Phytopathology (Abstr.) 90(suppl.):S132, 2000. (3) B. Harrison et al. Plant Dis. 89:28, 2005. (4) A. Phibbs et al. Plant Dis. 88:1285, 2004.

Green Stem Disorder of Soybean.

Green stem disorder of soybean (Glycine max) is characterized by delayed senescence of stems with normal pod ripening and seed maturation. Three different field research approaches were designed to determine the relationship of green stem disorder to Bean pod mottle virus (BPMV) and other potential factors that may be involved in causing this disorder. The first research approach surveyed green stem disorder and BPMV in individual plants monitored in several commercial soybean fields during three growing seasons. Leaf samples from maturing plants (growth stage R6) were tested by enzyme-linked immunosorbent assay (ELISA) for BPMV. The percentage of monitored plants infected with BPMV at growth stage R6 in some fields was higher than the incidence of green stem disorder at harvest maturity. Many plants infected with BPMV did not develop green stem disorder, and conversely, many plants that had green stem disorder were not infected with BPMV. According to a chi-square test of independence, the data indicated that green stem disorder was independent of BPMV infection at growth stage R6 (P = 0.98). A second research approach compared green stem disorder incidence in an identical set of soybean entries planted in two locations with different levels of natural virus infection. Despite differences in virus infection, including BPMV incidence, 20 of 24 entries had similar green stem disorder incidence at the two locations. A third research approach completed over two growing seasons in field cages showed that green stem disorder developed without BPMV infection. BPMV infection did not increase green stem disorder incidence in comparison to controls. Bean leaf beetle, leaf hopper, or stinkbug feeding did not have an effect on the incidence of green stem disorder. The cause of the green stem disorder remains unknown.

Identification and map location of TTR1, a single locus in Arabidopsis thaliana that confers tolerance to tobacco ringspot nepovirus.

The interaction between Arabidopsis and the nepovirus tobacco ringspot virus (TRSV) was characterized. Of 97 Arabidopsis lines tested, all were susceptible when inoculated with TRSV grape strain. Even though there was systemic spread of the virs, there was a large degree of variation in symptoms as the most sensitive lines died 10 days after inoculation, while the most tolerant lines either were symptomless or developed only mild symptoms. Four lines were selected for further study based on their differential reactions to TRSV. Infected plants of line Col-0 and Col-0 gl1 flowered and produced seeds like noninfected plants, while those of lines Estland and H55 died before producing seeds. Symptoms appeared on sensitive plants approximately 5 to 6 days after inoculation. Serological studies indicated that in mechanically inoculated seedlings, the virus, as measured by coat protein accumulation, developed at essentially the same rates and to the same levels in each of the four lines, demonstrating that differences in symptom development were not due to a suppression of virus accumulation. Two additional TRSV strains gave similar results when inoculated on the four lines. Genetic studies with these four Arabidopsis lines revealed segregation of a single incompletely dominant locus controlling tolerance to TRSV grape strain. We have designated this locus TTR1. By using SSLP and CAPS markers, TTR1 was mapped to chromosome V near the nga129 marker. Seed transmission frequency of TRSV for Col-0 and Col-0 gl1 was over 95% and their progeny from crosses all had seed transmission frequencies of over 83%, which made it possible to evaluate the segregation of TTR1 in F2 progeny from infected F1 plants without inoculating F2 plants. Seed transmission of TRSV will be further exploited to streamline selection of individuals for fine mapping the TTR1 gene. The identification of tolerant and sensitive interactions between TRSV and A. thaliana lines provides a model system for genetic and molecular analysis of plant tolerance to virus infection.

A rapid chemiluminescent detection method for barley yellow dwarf virus.

Barley yellow dwarf virus (BYDV-PAV-IL) was detected with biotinylated in vitro transcript cDNA using a chemiluminescent substrate on nylon membranes. Signals were detected on X-ray film and quantified using either a densitometer or an ELISA plate reader. The time required for sample preparation was reduced so that the entire protocol could be completed in two days. The in vitro transcript probes could detect 1 ng of purified virus and as little as 1 microliter of sap extracts prepared from infected oat shoots.

Identification of quantitative Loci for tolerance to barley yellow dwarf virus in oat.

ABSTRACT Molecular markers linked to quantitative trait loci conditioning tolerance to barley yellow dwarf virus (BYDV) were identified in oat (Avena sativa) using amplified fragment length polymorphism (AFLP) analysis. Near-isogenic and recombinant inbred lines (NILs and RILs, respectively) derived from a cross of Clintland64 (BYDV-sensitive) and IL86-5698 (BYDV-tolerant) were evaluated for their responses to an Illinois isolate of the PAV strain of BYDV. Individual markers identified in the analysis of the NILs explained up to 35% of the variability seen in the tolerance response. Single-point analysis of the marker data from the RIL population identified 24 markers in three linkage groups that were associated with tolerance to BYDV infection at P /= 3.0. These loci explained about 50% total of the variation in BYDV tolerance in multimarker regression analysis in both years. The BYDV tolerance loci A, C, E, and R were mapped to hexaploid oat restriction fragment length polymorphism linkage groups 2, 8, 36, and 5, respectively, by analyzing the segregation of the AFLP markers in the Kanota x Ogle RIL population.

Amplified fragment length polymorphism markers linked to a major quantitative trait locus controlling scab resistance in wheat.

ABSTRACT Scab is a destructive disease of wheat. To accelerate development of scab-resistant wheat cultivars, molecular markers linked to scab resistance genes have been identified by using recombinant inbred lines (RILs) derived by single-seed descent from a cross between the resistant wheat cultivar Ning 7840 (resistant to spread of scab within the spike) and the susceptible cultivar Clark. In the greenhouse, F(5), F(6), F(7), and F(10) families were evaluated for resistance to spread of scab within a spike by injecting about 1,000 conidiospores of Fusarium graminearum into a central spikelet. Inoculated plants were kept in moist chambers for 3 days to promote initial infection and then transferred to greenhouse benches. Scab symptoms were evaluated four times (3, 9, 15, and 21 days after inoculation). The frequency distribution of scab severity indicated that resistance to spread of scab within a spike was controlled by a few major genes. DNA was isolated from both parents and F(9) plants of the 133 RILs. A total of 300 combinations of amplified fragment length polymorphism (AFLP) primers were screened for polymorphisms using bulked segregant analysis. Twenty pairs of primers revealed at least one polymorphic band between the two contrasting bulks. The segregation of each of these bands was evaluated in the 133 RILs. Eleven AFLP markers showed significant association with scab resistance, and an individual marker explained up to 53% of the total variation (R(2)). The markers with high R(2) values mapped to a single linkage group. By interval analysis, one major quantitative trait locus for scab resistance explaining up to 60% of the genetic variation for scab resistance was identified. Some of the AFLP markers may be useful in marker-assisted breeding to improve resistance to scab in wheat.

In Situ Localization of Barley Yellow Dwarf Virus-PAV 17-kDa Protein and Nucleic Acids in Oats.

ABSTRACT Barley yellow dwarf virus strain PAV (BYDV-PAV) RNA and the 17-kDa protein were localized in BYDV-PAV-infected oat cells using in situ hybridization and in situ immunolocalization assays, respectively. The in situ hybridization assay showed labeling of filamentous material in the nucleus, cytoplasm, and virus-induced vesicles with both sense and antisense nucleic acid probes, suggesting that the filamentous material found in BYDV-PAV-infected cells contains viral RNA. BYDV-PAV negative-strand RNA was detected before virus particles were observed, which indicates that RNA replication is initiated before synthesis of viral coat protein in the cytoplasm. The 17-kDa protein was associated with filamentous material in the cytoplasm, nucleus, and virus-induced vesicles. The labeling densities observed using antibodies against the 17-kDa protein were similar in the nucleus and cytoplasm. No labeling of the 17-kDa protein was observed in plasmodesmata, but filaments in the nuclear pores occasionally were labeled. Since BYDV-PAV RNA and 17-kDa protein colocalized within infected cells, it is possible that single-stranded viral RNA is always associated with the 17-kDa protein in vivo. The 17-kDa protein may be required for viral nucleic acid filaments to traverse the nuclear membrane or other membrane systems.

First Report of Soybean dwarf virus on Soybean in Wisconsin.

Soybean dwarf virus (SbDV) causes widespread economic losses on soybean (Glycine max (L.) Merr.) in Japan (4), and has been reported on soybean in Virginia (2), in various legumes in the southeastern United States (1), and in peas in California (3). During late July and early August of 2003, soybean plants in Wisconsin were surveyed for SbDV. In 286 soybean fields at the R2-R4 growth stage, the uppermost fully unfurled leaf was collected from 10 plants at each of five sites. Samples were collected at random without regard to symptoms. SbDV symptom information was not recorded. Samples were stored on ice until frozen at -80°C. Five fields in four Wisconsin counties (Columbia, Lafayette, Sauk, and Waushara) tested positive for SbDV using double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). DAS-ELISA testing was conducted with reagents from Agdia, Inc (Elkhart, IN) following the manufacturer's protocol. Absorbance was read at 405 nm with a Stat Fax 2100 microplate reader (Awareness Technology, Inc., Palm City, FL) or visually evaluated. DAS-ELISA did not discriminate between strains of SbDV. The presence of SbDV was confirmed, and strain identity was inferred as dwarfing strain using reverse transcription-polymerase chain reaction (RT-PCR). Total RNA was extracted from homogenized leaf tissue, reverse transcribed, and amplified with the SuperScript One Step RT-PCR System (Invitrogen, Carlsbad, CA) and SbDV-specific primers (5'-CTGCTTCTGGTGATTACACTGCCG-3' and 5'-CGCTTTCATTTAACGYCATCAAAGGG-3'). Size of the RT-PCR products (110 bp) was consistent with the dwarfing strain, SbDV-D. All locations that tested positive for SbDV showed soybean aphids, Aphis glycines Matsumura (Homoptera: Aphididae), on 100% of soybean plants. Several aphid species have been reported to vector SbDV, but at this time, vector relations in the Wisconsin infections are unknown. To our knowledge, this is the first report of SbDV infecting soybean in Wisconsin. References: (1) V. D. Damsteegt et al. Plant Dis. 79:48, 1995. (2) A. Fayad et al. Phytopathology (Abstr.) 90(Suppl.):S132, 2000. (3) G. R. Johnstone et al. Phytopathology (Abstr.) 74:795(A43), 1984. (4) T. Tamada et al. Ann. Phytopathol. Soc. Jpn. 35:282, 1969.

Occurrence of Seed Coat Mottling in Soybean Plants Inoculated with Bean pod mottle virus and Soybean mosaic virus.

Soybean seed coat mottling often has been a problematic symptom for soybean growers and the soybean industry. The percentages of seed in eight soybean lines with seed coat mottling were evaluated at harvest after inoculating plants during the growing season with Bean pod mottle virus (BPMV), Soybean mosaic virus (SMV), and both viruses inside an insect-proof cage in the field. Results from experiments conducted over 2 years indicated that plants infected with BPMV and SMV, alone or in combination, produced seed coat mottling, whereas noninoculated plants produced little or no mottled seed. BPMV and SMV inoculated on the same plants did not always result in higher percentages of mottled seed compared with BPMV or SMV alone. There was significant virus, line, and virus-line interaction for seed coat mottling. The non-seed-coat-mottling gene (Im) in Williams isoline L77-5632 provided limited, if any, protection against mottling caused by SMV and none against BPMV. The Peanut mottle virus resistance gene Rpv1 in Williams isoline L85-2308 did not give any protection against mottling caused by SMV, whereas the SMV resistance gene Rsv1 in Williams isoline L78-379 and the resistance gene or genes in the small-seeded line L97-946 gave high levels of protection against mottling caused by SMV. The correlations (r = 0.77 for year 2000 and r = 0.89 for year 2001) between virus infection of the parent plant and seed coat mottling were significant (P = 0.01), indicating that virus infection of plants caused seed coat mottling.

Distribution of Leaf-Feeding Beetles and Bean pod mottle virus (BPMV) in Illinois and Transmission of BPMV in Soybean.

Bean leaf beetles (BLB; Cerotoma trifurcata) were collected in soybean (Glycine max) fields in 58 and 99 Illinois counties surveyed during the 2000 and 2001 growing seasons, respectively. In 2000, BLB counts were highest in the central portion of the state. BLB counts were lower the following year, but were more uniformly distributed throughout the state. BLB tested positive for Bean pod mottle virus (BPMV) in 37 of 41 counties assayed in 2000. In 2001, BLB tested positive for BPMV in 86 of 99 counties sampled. In 2000 and 2001, western corn rootworm (WCR; Diabrotica virgifera virgifera) adults were abundant in soybean fields only in east central Illinois. WCR adults tested positive for BPMV in 21 of 21 east central Illinois counties in 2000 and 20 of 24 sampled in 2001. BPMV was detected in soybean plants in 38 of 46 counties sampled in 2000. Field-collected WCR adults transmitted BPMV to potted soybean plants at low rates either directly from BPMV-infected soybean fields or with prior feeding on BPMV-infected plants. This is the first report of the distribution of BLB, WCR adults, and BPMV in Illinois and of BPMV transmission by adult WCR.

Expression of multiple eukaryotic genes from a single promoter in Nicotiana.

We engineered an expression unit composed of three eukaryotic genes driven by a single plant-active promoter and demonstrated functional expression in planta. The individual genes were linked as translational fusions to produce a polyprotein using spacer sequences encoding specific heptapeptide cleavage recognition sites for NIa protease of tobacco vein mottling virus (TVMV). The NIa gene itself was included as the second gene of the multi-gene unit. The first and third genes, obtained from the TR region of pTi15955, encoded enzymatic functions associated with the mannityl opine biosynthetic pathway. The mannityl opine conjugase gene (mas2) was the first unit of the construct and provided the native plant-active promoter and 5' untranslated regulatory sequence. The third gene (mas1), encoding the mannityl opine reductase, furnished the native 3' untranslated region. Cis-processing of the polyprotein by the NIa protease domain was demonstrated in vitro using rabbit reticulocyte lysate and wheat germ cell-free translation systems. Tobacco plant cells transformed with the multi-gene unit produced detectable levels of mannopine, mannopinic acid, and their biosynthetic intermediates, deoxyfructosyl-glutamate and deoxyfructosyl-glutamine. This indicates that the polygene construct results in a set of functional enzymatic activities that constitute a complete metabolic pathway.

Quantification of Fusarium solani f. sp. glycines isolates in soybean roots by colony-forming unit assays and real-time quantitative PCR.

Fusarium solani f. sp. glycines (FSG; syn. F. virguliforme Akoi, O'Donnell, Homma & Lattanzi) is a soil-borne fungus that infects soybean roots and causes sudden death syndrome (SDS), a widespread and destructive soybean disease. The goal of this study was to develop and use a real-time quantitative polymerase chain reaction (QPCR) assay to compare the accumulation of genomic DNA among 30 FSG isolates in inoculated soybean roots. Isolates differed significantly (P < or = 0.05) in their DNA accumulation on a susceptible soybean cultivar when detected and quantified using a FSG-specific probe/primers set derived from the sequences of the nuclear-encoded, mitochondrial small subunit ribosomal RNA gene. QPCR results that were normalized as the fold change over the sample collection times after inoculation were significantly (P < or = 0.001) correlated with the log(10) transformed colony-forming unit (CFU) values of FSG obtained from plating of inoculated ground roots on FSG semi-selective agar medium. Several isolates were identified that accumulated more FSG DNA and had higher CFU values than the reference isolate FSG1 (Mont-1). Compared to other isolates, FSG5 was the most aggressive root colonizer based on DNA accumulation and CFU values in infested roots. The described QPCR assay should provide more specificity, greater sensitivity, and less variability than alternatives to the culturing-dependent and time-consuming plating assays. Evaluation of isolate relative DNA differences on host plants using the QPCR approach provides useful information for evaluating isolates based on the extent and/or degree of colonization on soybean roots and for selecting isolates for breeding SDS-resistant soybean lines.