First Report of Grapevine leaf roll-associated virus-2 and -3 in Ohio Vineyards.

Grapevine leaf roll-associated viruses (GLRaVs) are a group of nine closely related viruses belonging to the Closteroviridae family that cause grapevine leaf roll disease in vineyards across the world (3). Within the continental United States, GLRaVs have been reported in the states of California, Michigan, Missouri, New York, Oregon, Washington, and Wisconsin, but not in Ohio (2,3). During 2012, grapevines with typical leaf roll symptoms were reported by owners of several Ohio vineyards. The symptoms included small, red leaves and downwardly rolled leaf margins, accompanied by tiny grape clusters with few fruits. A total of 20 symptomatic leaf samples were collected from two sites about 300 miles apart within Ohio, namely Valley Vineyards (cultivars Vidal Blanc and Fronterac) and South River Winery (cultivar Cabernet Franc). Total RNA was extracted from the samples using a previously reported procedure (1) and subjected to reverse transcription (RT)-PCR using specific primers for five known grapevine viruses including GLRaV-1 (1F: 5'-ACCTGGTTGAACGAGATCGCTT and 1R: 5'-GTAAACGGGTGTTCTTCAATTCTCT), GLRaV-2 [2F(FQ): 5'-GCTCCTAACGAGGGTATAGAAG and 2R(FQ): 5'-AGAGCGTACATACTCGCGAACAT], GLRaV-3 [3F(FQ): CAAGTGCTCTAGTTAAGGTCAG and 3R(FQ): 5'-CGGAACGTCGGTTCATTTAGA], Grapevine fan leaf virus (GFLVR1-F: 5'-TGAGATTAGTCATGGAGCAGCTT and GFLVR1-R: 5'-GGATAGACGTCTGGTTGATTTTG), and Tobacco ring spot virus (TRSVR1-1255F: 5'-GAGTGTTGTGCAATTATCT-GCATA and TRSVR1-1844R: 5'-CAAAGATGCCAAGAAAAGTTGCAAG). A 295-bp fragment of a grapevine actin cDNA (primers VvACT-F: 5'-ATCTCCATGTCAACCAAACTGAG and VvACT-R: 5'-GACAGAATGAGCAAGGAAATCAC) was used as a positive control for RT-PCR. The samples tested negative for GFLV, TRSV, or GLRaV-1 with our primer sets. However, four of the samples were positive for GLRaV-2, and 12 positive for GLRaV-3, as evidenced by the detection of PCR fragments of expected sizes (404 and 344 bp, respectively). All samples positive for GLRaV-2 were from a single field, whereas samples positive for GLRaV-3 were from both vineyards examined. The identities of GLRaV-2 and -3 were further confirmed by directly sequencing one GLRaV-2 and two GLRaV-3 (one from each location) PCR fragments from both ends. The 404 bp GLRaV-2-specific fragment shared 95 to 98% sequence identity with various GLRaV-2 isolates whose sequences were deposited at the GenBank. Similarly, the two 344-bp GLRaV-3 fragments share a 95 to 97% identity with known GLRaV-3 isolates. Notably, the sequences of the two GLRaV-3-specific fragments derived from two vineyards are not identical (97% identity), suggesting these two isolates might have different origins. As these viruses are known to be recalcitrant to mechanical transmission, we did not attempt to transmit these viruses to healthy plants. In summary, our results report for the first time the detection of GLRaV-2 and -3 in Ohio, suggesting that these two viruses are associated with the observed leaf roll symptoms, hence should be part of an effective management plan for grapevine viral diseases in the state. References: (1) C. Louime et al. Eur. J. Sci. Res. 22:232, 2008. (2) S. Lunden and W. Qiu. Plant Dis. 96:462, 2012. (3) A. M. Sharma et al. PLoS One 6:e26227, 2011.

Effects of Temperature and Wetness Duration on the Sporulation Rate of Phomopsis viticola on Infected Grape Canes.

Controlled-environment studies were conducted to examine effects of temperature (T) and wetness duration (W) on the sporulation rate of Phomopsis viticola on infected grape canes and to determine effects of interrupted wetness duration (IWD) on sporulation. A split-plot design was used to determine T and W effects, with T (5, 12, 15, 18, 20, 22, 25, 28, and 35°C) as the whole-plot and W (11, 23, 35, 47, and 71 h) as the subplot. Linear and nonlinear mixed models were fitted to the data. Lower and upper limits of sporulation were estimated to be 4 and 36°C, respectively, based on the modeling results, optimum sporulation was near 21°C, and sporulation increased monotonically with increasing wetness duration. Of the examined models, a generalization of the Analytis Beta model fit the data best, based on a collection of goodness-of-fit statistical criteria. To determine effects of IWD, a split-plot was used, with T (12, 15, and 20°C) as the whole-plot and IWD (0, 2, 4, 8, 12, and 24 h) as the subplot. Generally, sporulation declined with increasing IWD. An IWD of 8 h or more resulted in significantly and substantially less sporulation compared to the control (0 h IWD) (P < 0.01). Temporal patterns of spore density in the field were determined using a repeated-measures design, in which spore density and environmental data were measured in the vineyard during and following individual rain events over 3 years. The developed model from the controlled-environment study, coupled with a time-of-season weight function and a dispersal index (based on total rain per rain episode), predicted the trend in spore density over time reasonably well, although the total magnitude of spore density could not be predicted because the density of lesions was not known. Results can be used for improving the accuracy of a disease warning system that currently only considers infection of grapes by P. viticola.

Temporal Patterns of Sporulation Potential of Phomopsis viticola on Infected Grape Shoots, Canes, and Rachises.

Phomopsis cane and leaf spot on Vitis spp. (grape) is currently understood to be monocyclic, with primary inoculum only being produced early in the growing season. However, of the few published studies pertaining to sporulation of Phomopsis viticola, none specifically examined rachises, and none were designed to determine when infected tissues become capable of sporulation. The objective of these studies was to determine when grape shoots, canes, and rachises infected with P. viticola develop the capacity to sporulate, and to determine the time period during which those tissues remain capable of sporulation. Starting in 2009 and 2010, infected first-year shoots and rachises were collected biweekly throughout the growing season, into the dormant season, and into the following growing season. Tissues were collected from 'Catawba,' 'Concord,' and 'Reliance' vineyards. Samples were observed for sporulation after 48 h of incubation in a moist chamber at 23°C; the magnitude of the conidia production under these optimal conditions was considered the sporulation potential. For infections that occurred in 2009 and 2010, the production of conidia was not observed until after harvest. In the year following infection, sporulation potential was found from about bud break until shortly after the end of bloom. There was a generally consistent temporal pattern to relative sporulation potential across sampled vineyards, years, and grape tissues (rachises and canes), described by a modified ß model, with peak sporulation potential occurring around 16 May. These results confirmed that Phomopsis cane and leaf spot is a monocyclic disease and support control recommendations for use of fungicides in spring.

Space geodetic evidence for rapid strain rates in the New Madrid seismic zone of central USA.

In the winter of 1811-1812, near the town of New Madrid in the central United States and more than 2,000 km from the nearest plate boundary, three earthquakes within three months shook the entire eastern half of the country and liquefied the ground over distances far greater than any historic earthquake in North America. The origin and modern significance of these earthquakes, however, is highly contentious. Geological evidence demonstrates that liquefaction due to strong ground shaking, similar in scale to that generated by the New Madrid earthquakes, has occurred at least three and possibly four times in the past 2,000 years (refs 4-6), consistent with recurrence statistics derived from regional seismicity. Here we show direct evidence for rapid strain rates in the area determined from a continuously operated global positioning system (GPS) network. Rates of strain are of the order of 10(-7) per year, comparable in magnitude to those across active plate boundaries, and are consistent with known active faults within the region. These results have significant implications for the definition of seismic hazard and for processes that drive intraplate seismicity.

Influenza M2 proton channel activity selectively inhibits trans-Golgi network release of apical membrane and secreted proteins in polarized Madin-Darby canine kidney cells.

The function of acidification in protein sorting along the biosynthetic pathway has been difficult to elucidate, in part because reagents used to alter organelle pH affect all acidified compartments and are poorly reversible. We have used a novel approach to examine the role of acidification in protein sorting in polarized Madin-Darby canine kidney (MDCK) cells. We expressed the influenza virus M2 protein, an acid-activated ion channel that equilibrates lumenal and cytosolic pH, in polarized MDCK cells and examined the consequences on the targeting and delivery of apical and basolateral proteins. M2 activity affects the pH of only a subset of acidified organelles, and its activity can be rapidly reversed using ion channel blockers (Henkel, J.R., G. Apodaca, Y. Altschuler, S. Hardy, and O.A. Weisz. 1998. Mol. Biol. Cell. 8:2477-2490; Henkel, J.R., J.L. Popovich, G.A. Gibson, S.C. Watkins, and O.A. Weisz. 1999. J. Biol. Chem. 274:9854-9860). M2 expression significantly decreased the kinetics of cell surface delivery of the apical membrane protein influenza hemagglutinin, but not of the basolaterally delivered polymeric immunoglobulin receptor. Similarly, the kinetics of apical secretion of a soluble form of gamma-glutamyltranspeptidase were reduced with no effect on the basolaterally secreted fraction. Interestingly, M2 activity had no effect on the rate of secretion of a nonglycosylated protein (human growth hormone [hGH]) that was secreted equally from both surfaces. However, M2 slowed apical secretion of a glycosylated mutant of hGH that was secreted predominantly apically. Our results suggest a role for acidic trans-Golgi network pH in signal-mediated loading of apical cargo into forming vesicles.

Reconciling short recurrence intervals with minor deformation in the new madrid seismic zone.

At least three great earthquakes occurred in the New Madrid seismic zone in 1811 and 1812. Estimates of present-day strain rates suggest that such events may have a repeat time of 1000 years or less. Paleoseismological data also indicate that earthquakes large enough to cause soil liquefaction have occurred several times in the past 5000 years. However, pervasive crustal deformation expected from such a high frequency of large earthquakes is not observed. This suggests that the seismic zone is a young feature, possibly as young as several tens of thousands of years old and no more than a few million years old.

First Report of Peronospora sparsa Causing Downy Mildew (Dryberry) of Rubus fruticosus in Mexico.

Michoacan State is the largest producer of blackberries (Rubus fruticosus) in Mexico with more than 4,000 ha in production. During the rainy season of 2007 (July to September), purple, angular, vein-delimited leaf spots along the midrib and major veins were observed. Affected young fruit lost their shine, became shriveled, and later dried. Some fruit split. Symptomatic leaflets from cv. Tupy were collected from the field in Tangancicuaro and Los Reyes counties. In the laboratory, 20 detached leaflets were washed with 10% bleach for 2 min, rinsed with sterile distilled water, and placed into sterile petri dishes containing 0.5% water agar. To promote sporulation of fungi, leaflets were incubated at 17°C with a 12-h photoperiod in a growth chamber. Sporangia and sporangiophores, which developed 20 days later on the underside of the leaves, were transferred to the underside of detached healthy leaves of the same cultivar with a sterile needle, and incubated as previously described. A set of noninoculated leaves were included as controls. Sporangiophores and sporangia developed on the underside of angular purple lesions on leaves 15 to 22 days after inoculation. Symptoms were identical to those observed on leaves in the field. The pathogenicity test was repeated twice with the same results. Sporangia were light brown, ovoid to elliptical, and measured 14 to 22 × 11 to 18 µm. Sporangiophores were dichotomously branched with slender curved ends. Symptoms on the leaves and fruit and oomycete morphology were similar to those described for downy mildew (2). To confirm pathogen identity, a product of ~500 bp of the nuclear ITS-rRNA was amplified from total DNA from symptomatic and asymptomatic leaves and fruit by nested PCR. The primers sets PS3/PS1 and PR3/PR4 were used for the first and second reaction, respectively (1,3). PCR products were sequenced in both directions and sequences were deposited in GenBank under Accession Nos. EU601168, EU601169, EU601170, and EU601171. Consensus sequences obtained in this study were compared with the same region of Peronospora sparsa (GenBank Accession Nos. EU391654 from Denmark and AF266783 from the UK). Similarity among these sequences varied between 99 and 100%. To our knowledge, this is the first report of downy mildew (dryberry) of blackberry caused by P. sparsa in Mexico. References: (1) B. J. Aegerter et al. Plant Dis. 86:1363, 2002. (2) W. D. Gubler. Page 15 in: Compendium of Raspberry and Blackberry Diseases and Insects. M. A. Ellis et al., eds. The American Phytopathological Society, St Paul MN, 1998. (3) H. Lindqvist et al. Plant Dis. 82:1304, 1998.

Time-domain optimized near-field estimator for ultrasound imaging: initial development and results.

For nearly four decades, adaptive beamforming (ABF) algorithms have been applied in RADAR and SONAR signal processing. These algorithms reduce the contribution of undesired off-axis signals while maintaining a desired response along a specific look direction. Typically, higher resolution and contrast is attainable using adaptive beamforming at the price of an increased computational load. In this paper, we describe a novel ABF designed for medical ultrasound, named the Time-domain Optimized Near-field Estimator (TONE). We performed a series of simulations using synthetic ultrasound data to test the performance of this algorithm and compared it to conventional, data independent, delay and sum beamforming (CBF) method. We also performed experiments using a Philips SONOS 5500 phased array imaging system. CBF was applied using the default parameters of the Philips scanner, whereas TONE was applied on per channel, unfocused data using an unfocused transmit beam. TONE images were reconstructed at a sampling of 67 microm laterally and 19 microm axially. The results obtained for a series of five 20-microm wires in a water tank show a significant improvement in spatial resolution when compared to CBF. We also analyzed the performance of TONE as a function of speed of sound errors and array sparsity, finding it robust to both.

Variation in Disease Incidence of Phomopsis Cane and Leaf Spot of Grape in Commercial Vineyards in Ohio.

A statewide survey for incidence of Phomopsis cane and leaf spot of grape (caused by Phomopsis viticola) was conducted during the 2002 to 2004 growing seasons. Over the 3 years, disease was observed in all surveyed vineyards, and mean disease incidence for leaves and internodes was 42 and 50%, respectively. A hierarchical linear mixed model was used to evaluate effects of region, farm within region, vineyard within farm, sampling site (i.e., vine) within vineyard, and shoot (i.e., cane) within vine on disease incidence. Region of the state did not have a significant effect on incidence but there was significant variation at all other levels of the hierarchy (P < 0.05); the greatest variation was at the lowest scale (shoots within vines). The potential effects of weather and management practices on disease risk at the vineyard scale were determined by using nonparametric correlation and binary logistic analyses after first classifying mean incidence per vineyard as being below or above 20% (D20 = 0,1) and 40% (D40 = 0,1). Overall results indicated that variables for predicted number of moderate infection events (DM; based on ambient temperature and hours when either there was measured rainfall or relative humidity above 90%), the extent of fungicide application (C) during early- and mid-May (M1 and M2, respectively), and the use of a dormant-period application of fungicide (DOR) were the key factors in predicting disease risk (for either D20 or D40). Accuracy (percentage of high and low disease vineyards correctly predicted) and area under the receiver operating characteristic curve (an overall measure of the accuracy of a model) for a generic model combining these predictor variables were 74 and 0.84, respectively, for D40 and 87 and 0.97, respectively, for D20. Models based on management practices were as accurate as those that incorporated weather variables. Although the degree of control of this disease is inadequate in Ohio, based on the survey results for incidence, the results from the risk-model analysis showed that improved management might be obtained by applying fungicide early during the growing season.

Control of renal hemodynamics and glomerular filtration rate in chronic hypercalcemia. Role of prostaglandins, renin-angiotensin system, and calcium.

The role of prostaglandins (PG), renin-angiotensin system (RAS) and calcium (Ca) in the control of renal hemodynamics and glomerular filtration rate (GFR) in chronic hypercalcemia (serum Ca 12.8 mg%) was studied. Renal blood flow (RBF, 6.39 ml/min per gram kidney weight [gkw]) and GFR (0.52 ml/min per gkw) were significantly decreased in hypercalcemic rats when compared with normocalcemic rats (7.15, P < 0.001 and 0.74, P < 0.05, respectively). These changes in RBF and GFR occurred independent of any significant alterations in systemic hemodynamics, blood and plasma volume. Inhibition of the renal PG with indomethacin resulted in marked decrements in both RBF (6.39-4.12 ml/min per gkw, P < 0.01) and GFR (0.52-0.19 ml/min per gkw, P < 0.01) in hypercalcemic rats, whereas there was no significant alterations in normocalcemic rats. Inhibition of the RAS with captopril resulted in marked increments in both RBF (6.39-7.35 ml/min per gkw, P < 0.05) and GFR (0.52-0.74 ml/min per gkw, P < 0.05) in hypercalcemic rats. In fact, there was no significant difference from the RBF and GFR of similarly treated normocalcemic rats. Similar results were also obtained with the competitive angiotensin II (AII) antagonist (sarcosyl(1)-isoleucyl(5)-glycyl(8)) AII. Since both the renal PG and the RAS are involved in the control of RBF and GFR in hypercalcemia, the role of each is best revealed in the absence of the other. Hence, comparison of the RBF and GFR in the PG-inhibited hypercalcemic rats in the presence of AII (4.12 and 0.19 ml/min per gkw, respectively) and absence of AII (5.99 and 0.53 ml/min per gkw, P < 0.01 for both) reveals the vasoconstrictive role for AII in hypercalcemia. On the other hand, comparison of the RBF and GFR in the AII-inhibited hypercalcemic rats in the presence of PG (7.35 and 0.74 ml/min per gkw, respectively) and absence of PG (5.99 and 0.53 ml/min per gkw, P < 0.01 and P < 0.05, respectively) reveals the vasodilatory role for PG in hypercalcemia. Finally, comparison of the RBF and GFR in both PG- and AII-inhibited hypercalcemic rats (5.99 and 0.53 ml/min per gkw, respectively) with similarly treated normocalcemic rats (7.30 and 0.94 ml/min per gkw, P < 0.001 and P < 0.005, respectively) reveals the vasoconstrictive role for Ca in chronic hypercalcemia. Our study therefore demonstrates that in chronic hypercalcemia the RBF and GFR are controlled by an active interplay of the vasoconstrictive effect of AII, the vasodilatory effect of renal PG, and the direct vasoconstrictive effect of Ca, independent of either AII or PG. The sum total of these forces produces a modest but significant decrease in RBF and GFR.

Pre- and Post-Infection Activity of Azoxystrobin, Pyraclostrobin, Mefenoxam, and Phosphite Against Leather Rot of Strawberry, Caused by Phytophthora cactorum.

Pre- and post-infection activity of azoxystrobin, pyraclostrobin, mefenoxam, and phosphite against leather rot of strawberry, caused by Phytophthora cactorum, was determined under greenhouse conditions. Strawberry plants (cv. Honeoye) were grown in pots, and attached fruit at the green-to-white stage of development were used in evaluations. Plants and fruit were sprayed to runoff with the above-mentioned fungicides either before (protectant) or after (curative) inoculation with a zoospore suspension (105 zoospores/ml) of P. cactorum. Inoculated plants with fruit were placed in a mist chamber for 12 h to ensure infection. Fungicides were applied at either 2, 4, or 7 days before inoculation or 13, 24, 36, or 48 h after inoculation. Incidence (proportion of diseased fruit) was recorded 6 days after inoculation. Azoxystrobin and pyraclostrobin provided protectant activity for up to 7 days before inoculation, but only slight curative activity when applied 13 h after inoculation. Phosphite and mefenoxam also provided protection for up to 7 days, as well as curative activity of at least 36 h. There were no significant differences in protectant activity among the QoI fungicides azoxystrobin and pyraclostrobin, phosphite and mefenoxam.

Baseline and Differential Sensitivity to Two QoI Fungicides Among Isolates of Phytophthora cactorum That Cause Leather Rot and Crown Rot on Strawberry.

Sensitivities of 89 isolates of Phytophthora cactorum, the causal agent of crown rot and leather rot on strawberry plants, from seven states (Florida, Maine, North Carolina, Ohio, Oregon, South Carolina, and New York) to the QoI fungicide azoxystrobin were determined based on mycelium growth and zoospore germination. Radial growth of mycelia on lima bean agar amended with azoxystrobin at 0.001, 0.01, 0.1, 1.0, 10, and 30 µg/ml and salicylhydroxamic acid (SHAM) at 100 µg/ml was measured after 6 days. Effect on zoospore germination was evaluated in aqueous solutions of azoxystrobin at 0.005, 0.01, 0.05, 0.1, 0.5, and 1.0 µg/ml in 96-well microtiter plates by counting germinated and nongerminated zoospores after 4 h at room temperature. SHAM was not used to evaluate zoospore sensitivity. The effective dose to reduce mycelium growth by 50% (ED50) ranged from 0.16 to 12.52 µg/ml for leather rot isolates and 0.10 to 15 µg/ml for crown rot isolates. The Kolmogorov-Smirnov test showed significant differences (P < 0.001) between the two distributions. Zoospores were much more sensitive to azoxystrobin than were mycelia. Differences between sensitivity distributions for zoospores from leather rot and crown rot isolates were significant at P = 0.05. Estimated ED50 values ranged from 0.01 to 0.24 µg/ml with a median of 0.04 µg/ml. Experiments with pyraclostrobin, another QoI fungicide, demonstrated that both mycelia and zoospores of P. cactorum were more sensitive to pyraclostrobin than to azoxystrobin. Sensitivities to azoxystrobin and pyraclostrobin were moderately but significantly correlated (r = 0.60, P = 0.0001).

Benchmarking of three-dimensional multicomponent lattice Boltzmann equation.

We present a challenging validation of phase field multicomponent lattice Boltzmann equation (MCLBE) simulation against the Re=0 Stokes flow regime Taylor-Einstein theory of dilute suspension viscosity. By applying a number of recent advances in the understanding and the elimination of the interfacial microcurrent artefact, extending to a three-dimensional class of stability-enhancing multiple relaxation time collision models (which require no explicit collision matrix, note) and developing new interfacial interpolation schemes, we are able to obtain data that show that MCLBE may be applied in new flow regimes. Our data represent one of the most stringent tests yet attempted on LBE-one which received wisdom would preclude on grounds of overwhelming artefact flow.

Effects of Application of Fungicide During the Dormant Period on Phomopsis Cane and Leaf Spot of Grape Disease Intensity and Inoculum Production.

Efficacy of application of the fungicides calcium polysulfide or fixed copper during the dormant period on control of Phomopsis cane and leaf spot of grape (Vitis spp.), caused by Phomopsis viticola, was examined under field conditions during the 2003 and 2004 growing seasons in Ohio. Dormant-period fungicide applications were made either in the fall (after leaf drop and periderm tissue formation on the first-year canes, mid-November), or spring (at bud-swell, mid-April), or both. Disease incidence and severity on leaves and internodes were examined. In addition, effects of dormant-period application on sporulation of P. viticola were determined by examining the number of conidia in rain-splashed water in the spring and formation of mature pycnidia on cane sections in the winter. Fall-and-spring and spring applications of calcium poly-sulfide provided 12 to 88% reduction in disease intensity (incidence or severity), whereas calendar-based protectant mancozeb applications reduced overall disease intensity by 47 to 100%. Fixed-copper applications did not provide a consistent reduction of the disease. Fall applications of dormant-period fungicide provided little or no effect by itself. There was a significantly lower number of conidia observed in collected splashed rain water from vines treated with fall-and-spring applications of calcium polysulfide than in rain water from nonsprayed vines. Fall-and-spring and spring applications of calcium polysulfide provided a significant reduction in the number of mature pycnidia formed on incubated cane sections compared with the nonsprayed control (5 versus 10 pycnidia/cm2), whereas fixed copper did not provide a significant reduction.

Evaluation of a Disease Warning System for Phomopsis Cane and Leaf Spot of Grape: A Field Study.

A field evaluation of a warning system for Phomopsis cane and leaf spot of grape (Vitis spp.), caused by Phomopsis viticola, was conducted in Ohio over 3 years (2002 to 2004) by applying fungicides and fungicide-adjuvant combinations based on predicted infection events. Three different criteria for risk-light, moderate, and high-were evaluated with the warning system. The warning system is based on measured weather conditions (temperature and wetness duration following rain) and a model for risk of leaf and internode infection. Vines were sprayed with fungicides based on either the warning system or a calendar-based 7-day protectant program, from 2.5-cm shoot growth (Eichhorn-Lorenz [E-L] stage 7) to the end of the broom (E-L stage 27). Fungicides were tested with or without an adjuvant (JMS Stylet-Oil or Regulaid). In the controls, the mean percentage of leaves and internodes with infections ranged from 36 to 100%, the number of lesions per leaf ranged from 1 to 28, and percentage of internodes covered by lesions ranged from 1 to 12%. Both the calendar-based protectant treatment (based on use of mancozeb) and the warning system treatment based on spraying in response to light or moderate predicted infection events (especially with mancozeb + Regulaid) resulted in significantly less disease incidence and severity compared with the controls. The mean percent control (relative difference in disease between a treatment and the control) was higher for the protectant schedule (˜55% and ˜80% for incidence and severity, respectively, based on application of mancozeb) than for the warning system (˜36% and ˜60% for incidence and severity, respectively, based on application of mancozeb + Regulaid), but there were two to three times more fungicide applications with the protectant schedule than with the warning system.

Characterization of Phomopsis spp. Infecting Grapevines in the Great Lakes Region of North America.

Seventy-five isolates of Phomopsis were obtained from grapes (Vitis spp.) with Phomopsis cane and leaf spot symptoms in Ohio, Michigan, New York, Pennsylvania, Maryland, and Ontario (Canada). Four isolates from California and one from Europe were also included in the study. Isolates were grouped on the basis of DNA sequences from intron regions in the translation elongation factor 1-α and calmodulin genes. According to DNA sequence comparisons with the type isolate, all isolates except two (OH-48 and CAL-5) were determined to be P. viticola, confirming the etiology of this disease in the Great Lakes region. Thirty representative isolates were evaluated for mycelial growth rate in vitro, conidial size, and pathogenicity on grapevine (Vitis interspecific hybrid 'Seyval') leaves and internodes. A subsample of 13 isolates was also evaluated for pathogenicity on fruit and rachises. All isolates of P. viticola caused disease on grape but differed in virulence. Among P. viticola isolates, virulence on leaves and internodes was positively correlated, and virulence on fruit and rachises was positively correlated, but there was no relationship between ratings on vegetative versus reproductive grape tissues. Some isolates that were not virulent on leaves or internodes were highly virulent on fruit and rachises and vice versa, indicating some specialization with respect to host tissues. However, differences were mostly of a quantitative nature, which makes it difficult if not impossible to assign biotypes. Among P. viticola isolates, virulence on fruit and rachises was positively correlated with mycelial growth rate in vitro. For the two isolates that were not P. viticola, the internal transcribed spacer regions of the nuclear ribosomal DNA were sequenced for identification purposes. Based on the best match available in GenBank, CAL-5 was determined to be close to Diaporthe phaseolorum, while the sequence of OH-48 matched that of Phomopsis sp. from Eucommia ulmoides in China. Both isolates had shorter alpha conidia and significantly higher mycelial growth rates than the P. viticola isolates, and were not or only slightly pathogenic to Vitis interspecific hybrid 'Seyval'.

Improved accuracy of sperm motility assessment using a modified Micro-Cell sperm counting chamber.

OBJECTIVE: To assess the effect of modifications made in the Micro-Cell sperm counting chamber on the motility of washed human spermatozoa. DESIGN: In a 2 x 2 experimental design, human sperm samples were washed with or without protein supplementation, loaded into modified or unmodified Micro-Cell chambers, and assessed by automated semen analysis for changes associated with sperm adhesion to the glass chamber surfaces. PARTICIPANTS: Twenty-one men who were undergoing semen analysis and presented with > or = 50% motile sperm, or normal donors. MAIN OUTCOME MEASURES: Reduced motility and elevated lateral head displacement associated with sperm adhesion to glass surfaces were compared using a doubly repeated measures analysis of variance. RESULTS: Addition of protein to the sperm washing solution partially reversed the adhesion of spermatozoa to the glass of unmodified Micro-Cell chambers. Chambers manufactured to reduce cell adhesion to glass surfaces yielded the highest motility and lowest lateral head displacement, whether the sperm were washed in a solution supplemented with or without protein. CONCLUSION: These findings indicate that, as in raw semen, kinematics of washed sperm can be measured reliably in the modified Micro-Cell chamber.

The differentiation of NSAIDs and prostaglandin action using a mechanical visceral pain model in the rat.

In order to determine the role of peripheral prostanoids in a newly developed mechanical visceral pain model, several NSAIDs were studied. Systemic acetylsalicylic acid and mefenamic acid, in doses known to produce cyclooxygenase inhibition, produced limited or no analgesia using a duodenal distension model and a behavioral scale for assessment. In contrast, indomethacin at 1 mg/kg, a dose 1/100th of the highest dose of the above compounds, had a marked analgesic effect in the visceral pain model (32% of control response). These data suggest that a duodenal distension stimulus does not have a peripheral prostaglandin E2-mediated nociceptive mechanism. Furthermore, the results obtained with indomethacin support an alternate, possibly central nonprostanoid visceral antinociceptive action.

Reliability and accuracy of visual estimation of phomopsis leaf blight of strawberry.

ABSTRACT Six different individuals (raters) assessed the severity of Phomopsis leaf blight on strawberry leaflets in five experimental repetitions over 2 years by making a direct visual estimation of the percentage of diseased area of each leaflet or by using the Horsfall-Barratt (H-B) disease scale. Intra-rater and inter-rater reliability and accuracy were determined, and then the relationship between visually estimated severity values and actual severity values was evaluated. Agreement in estimated disease severity values between assessment times by the same raters (i.e., intra-rater reliability), and agreement in disease severity values among raters at a single assessment time (i.e., inter-rater reliability), were both high, with most correlation coefficients being greater than 0.85. The intra-class correlation for overall agreement among raters ranged from 0.80 to 0.96 for the five repetitions. Based on the concordance coefficient calculated for each rater in each repetition, agreement between estimated and actual severity (i.e., accuracy) was somewhat lower than reliability. The relationship between estimated and actual severity was linear, and there was a slight trend to overestimate disease severity. The H-B scale was not more reliable or accurate than direct estimation of severity, and the linear relationship between estimated and actual severity did not support the principles underling the H-B scale. Both size of leaflets and number of lesions per leaflet slightly affected the error in estimate of disease severity.

Effects of a Cover Crop on Splash Dispersal of Colletotrichum acutatum Conidia.

ABSTRACT A rain simulator, with generated rains of 11 and 30 mm/h, was used to determine the effect of a cover crop or intercrop on the splash dispersal of Colletotrichum acutatum conidia. Dispersal through sudangrass, which can be used as a 'living mulch', was tested at two planting densities (140 or 280 kg/ha) and two heights (5 and 20 cm) and compared with a control consisting of a bare soil. Dispersal of C. acutatum conidia was assessed by counting colonies formed from spore-bearing splash droplets deposited in sheltered petri plates containing a selective medium. Both a cover crop and rain intensity significantly affected splash dispersal as measured by the interpolated total number of colonies (denoted by Sigma) from 0 to 72 cm from the inoculum source and in a time span of 61 min of generated rain (P < 0.001). However, there was no significant interaction of cover crop and intensity (P > 0.90). Dispersal with a 30-mm/h rain was higher than dispersal with a 11-mm/h rain, and presence of a cover crop significantly reduced dispersal compared with bare soil (P < 0.001). Of the treatments with sudangrass, cover crop planting density did not affect dispersal overall, but there was greater spore dispersal with the taller sudangrass at the higher planting density, due in part to the higher rate of water splashing with the tall grass compared with the short grass. Spore deposition in the petri plates could be functionally related to distance and time using a diffusion-type model, and parameter estimates could be used to explain the effects of cover crop on Sigma. Although the relationship between cover crop properties and splash dispersal is complex, results show the potential beneficial effects of the cover crop on disease management.