RESUMO
Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.
RESUMO
Objective: The present study was designed to establish and evaluate an early prediction model of epilepsy after encephalitis in childhood based on electroencephalogram (ECG) and clinical features. Methods: 255 patients with encephalitis were randomly divided into training and verification sets and were divided into postencephalitic epilepsy (PE) and no postencephalitic epilepsy (no-PE) according to whether epilepsy occurred one year after discharge. Univariate and multivariate logistic regression analyses were used to screen the risk factors for PE. The identified risk factors were used to establish and verify a model. Results: This study included 255 patients with encephalitis, including 209 in the non-PE group and 46 in the PE group. Univariate and multiple logistic regression analysis showed that hemoglobin (OR = 0.968, 95% CI = 0.951-0.958), epilepsy frequency (OR = 0.968, 95% CI = 0.951-0.958), and ECG slow wave/fast wave frequency (S/F) in the occipital region were independent influencing factors for PE (P < 0.05).The prediction model is based on the above factors: -0.031 × hemoglobin -2.113 × epilepsy frequency + 7.836 × occipital region S/F + 1.595. In the training set and the validation set, the area under the ROC curve (AUC) of the model for the diagnosis of PE was 0.835 and 0.712, respectively. Conclusion: The peripheral blood hemoglobin, the number of epileptic seizures in the acute stage of encephalitis, and EEG slow wave/fast wave frequencies can be used as predictors of epilepsy after encephalitis.
RESUMO
The bean bug (Riptortus pedestris), one of the most important pests of soybean, causes staygreen syndrome, delaying plant maturation and affecting pod development, resulting in severe crop yield loss. However, little is known about the underlying mechanism of this pest. In this study, we found that a salivary secretory protein, Rp614, induced cell death in nonhost Nicotiana benthamiana leaves. NbSGT1 and NbNDR1 are involved in Rp614-induced cell death. Tissue specificity analysis showed that Rp614 is mainly present in salivary glands and is highly induced during pest feeding. RNA interference experiments showed that staygreen syndrome caused by R. pedestris was significantly attenuated when Rp614 was silenced. Together, our results indicate that Rp614 plays an essential role in R. pedestris infestation and provide a promising RNA interference target for pest control.
Assuntos
Glycine max , Heterópteros , Animais , Glycine max/genética , Heterópteros/genéticaRESUMO
Riptortus pedestris (Fabricius), one of the major piercing-sucking insects in soybeans, causes delayed plant senescence and abnormal pods, known as staygreen syndrome. Recent research has shown that direct feeding of this insect is the major cause of soybean staygreen syndrome. However, it remains unclear whether R. pedestris salivary proteins play vital roles in insect infestation. Here, we found that 4 secretory salivary proteins can induce cell death in Nicotiana benthamiana by transient heterologous expression. The cell death induced by Rp2155 relies on the nucleotide-binding leucine-rich repeat helper, HSP90. Tissue-specificity assays indicated that Rp2155 is specifically expressed in the salivary gland of R. pedestris and is significantly induced during insect feeding. The expression of salicylic acid (SA)-, jasmonic acid (JA)-related genes was increased in soybean when fed by Rp2155-silenced R. pedestris. More importantly, soybean staygreen symptoms caused by R. pedestris were significantly alleviated when Rp2155 was silenced. Together, these results suggest that the salivary effector Rp2155 is involved in promoting insect infestation by suppressing the JA and SA pathways, and it can be considered as a potential RNA interference target for insect control.
Assuntos
Glycine max , Heterópteros , Animais , Reguladores de Crescimento de Plantas , Heterópteros/fisiologia , Transdução de Sinais , Proteínas e Peptídeos SalivaresRESUMO
Insect-specific virus (ISV) is one of the most promising agents for the biological control of insects, which is abundantly distributed in hematophagous insects. However, few ISVs have been reported in Riptortus pedestris (Fabricius), one of the major pests threatening soybeans and causing great losses in yield and quality. In this work, field Riptortus pedestris was collected from six soybean-producing regions in China, and their virome was analyzed with the metatranscriptomic approach. Altogether, seven new insect RNA viruses were identified, three of which had complete RNA-dependent RNA polymerase (RdRp) and nearly full-length genome sequences, which were named Riptortus pedestris alphadrosrha-like virus 1 (RpALv1), Riptortus pedestris alphadrosrha-like virus 2 (RpALv2) and Riptortus pedestris almendra-like virus (RiALv). The three identified novel ISVs belonged to the family Rhabdoviridae, and phylogenetic tree analysis indicated that they were clustered into new distinct clades. Interestingly, the analysis of virus-derived small-interfering RNAs (vsiRNAs) indicated that only RiALv-derived siRNAs exhibited 22 nt length preference, whereas no clear 21 or 22 nt peaks were observed for RpALv1 and RpALv2, suggesting the complexity of siRNA-based antiviral immunity in R. pedestris. In conclusion, this study contributes to a better understanding of the microenvironment in R. pedestris and provides viral information for the development of potential soybean insect-specific biocontrol agents.
Assuntos
Heterópteros , Vírus de Insetos , Vírus de RNA , Animais , Vírus de Insetos/genética , Filogenia , Heterópteros/genética , Vírus de RNA/genética , Glycine maxRESUMO
The artificial photocatalytic degradation of organic pollutants has emerged as a promising approach to purifying the water environment. The core issue of this ongoing research is to construct efficient but easily recyclable photocatalysts without quadratic harm. Here, we report an eco-friendly photocatalyst with in situ generated TiO2 quantum dots (TQDs) on natural cotton cellulose (CC) by a simple one-step hydrothermal method. The porous fine structure and abundant hydroxyl groups control the shape growth and improve the stability of nanoparticles, making natural CC suitable for TQDs. The TQDs/CC photocatalyst was synthesized without the chemical modification of the TQDs. FE-SEM and TEM results showed that 5-6 nm TQDs are uniformly decorated on the CC surface. The long-term stability in photocatalytic activity and structure of more than ten cycles directly demonstrates the stability of CC on TQDs. With larger CC sizes, TQDs are easier to recycle. The TQDs/CC photocatalysts show impressive potential in the photocatalytic degradation of anionic methyl orange (MO) dyes and cationic rhodamine B (RhB) dyes.