Nanotechnology-based electrochemical biosensors for monitoring breast cancer biomarkers.

Breast cancer is categorized as the most widespread cancer type among women globally. On-time diagnosis can decrease the mortality rate by making the right decision in the therapy procedure. These features lead to a reduction in medication time and socioeconomic burden. The current review article provides a comprehensive assessment for breast cancer diagnosis using nanomaterials and related technologies. Growing use of the nano/biotechnology domain in terms of electrochemical nanobiosensor designing was discussed in detail. In this regard, recent advances in nanomaterial applied for amplified biosensing methodologies were assessed for breast cancer diagnosis by focusing on the advantages and disadvantages of these approaches. We also monitored designing methods, advantages, and the necessity of suitable (nano) materials from a statistical standpoint. The main objective of this review is to classify the applicable biosensors based on breast cancer biomarkers. With numerous nano-sized platforms published for breast cancer diagnosis, this review tried to collect the most suitable methodologies for detecting biomarkers and certain breast cancer cell types.

Sensitive electrochemical recognition of α-synuclein protein in human plasma samples using bioconjugated gold nanoparticles: An innovative immuno-platform to assist in the early stage identification of Parkinson's disease by biosensor technology.

This research work explains the development of an electrochemical immunosensor for the selective recognition of SNCA in human biofluids. An innovative protocol was proposed for the green synthesis of gold nanoparticle-supported dimethylglyoxime (AuNPs@DMGO) using one-step electrogeneration method. Also, the application of AuNPs@DMGO for the sensitive quantification of α-Synuclein (SNCA) protein and its biomedical analysis. So, an innovative sandwich immunosensor was designed for the sensitive identification of SNCA antigen in an aqueous solution. The gold nanoparticles (AuNPs) were decorated on the surface of the glassy carbon electrode by chronoamperometry technique to provide appropriate immobilization surface with a large number of active sites for immobilization of specific biotinylated antibody (Ab1) and against SNCA protein. Then, the sandwich-type immuno-platform was completed by the attachment of secondary antibody (HRP conjugated Ab [Ab2]) to the primary complexes on the surface of the electrode. For the first time, α-Synuclein protein was measured with an acceptable linear range of 4-64 ng/mL and a lower limit of quantification of 4 ng/mL. Benefiting from the simplicity and high sensitivity, the proposed method shows a potential of employment in clinical applications and high-throughput screening of Parkinson's disease using POC.

Sensitive recognition of prostate-specific antigen using biotinylated antibody encapsulated on D-penicillamine decorated wrinkled silicate nanoparticles (WSN): An innovative sandwich-type biosensor toward diagnosis of prostate cancer.

In this study, a new sandwich-type biosensor was developed to specific recognition of prostate-specific antigen (PSA) and early-stage diagnosis of prostate cancer using encapsulation of biotinylated antibody (Ab1) of prostate-specific antigen on D-penicillamine decorated wrinkled silicate nanoparticles (WSN). For the first time, KCC-1-NH-DPA was synthesized and used to immobilization of biomacromolecules. So, fabricated immunosensor was performed by on sandwich-type strategy. After fabrication of immunosensor, cyclic voltammetry, differential pulse voltammetry, and square wave voltammetry techniques were used to electrochemical evaluation of immune-platform for PSA detection. The proposed biocompatibility immune-platform provided a novel interface toward sensitive bioanalysis of PSA biomarker in human plasma samples. Due to the use of gold nanoparticles functionalized Cysteamine (Cys A) in the structure of the secondary antibody (Ab2 [HRP-Ab2]), the intensity of the electrochemical signal has increased, resulting in a more accurate detection of the target molecules. Under the right conditions, the engineering immunosensor provides good bioanalytical performance for determining the PSA biomarker in the linear range of 0.002 to 60 µg L-1 which low limit of quantification was 0.002 µg L-1 . As a result, it is suggested to use these immune-devices in the clinical pre-diagnosis of prostate cancer.

Quantification of quetiapine fumarate based on electrochemical analysis by reduced graphene oxide modified nano-silica functionalized with polydopamine and gold nanostars: A novel pharmaceutical analysis strategy.

Quetiapine fumarate (QF) is an antipsychotic drug that has been most widely prescribed as an antipsychotic. In this regard, sensitive recognition of QF in bodily fluids must be done accurately. In this work, an electrochemical sensor for QF detection was fabricated, using GNSs-PDA@SiO2 modified rGO stabilized on glassy carbon electrode. According to the electrical nature of gold nanoparticles (GNPs), polydopamine (PDA), and its composition with nano-silica, the proposed hybrid material is able to enhance the electro-oxidation signals of QF toward its sensitive detection in complex biological media. The morphology of synthesized polymeric nanocomposites and various surfaces of electrodes were investigated using Field Emission Scanning Electron Microscopy and Energy-Dispersive X-Ray Spectroscopy methods. Using the square wave voltammetry technique, the fabricated electrochemical sensor could detect QF in the linear range of 500 µM to 3 mM, which low limit of quantification was obtained as 500 µM, indicating the sensor's appropriate sensitivity. For the first time, the application of novel hybrid material (GNSs-PDA@SiO2 ) for pharmaceutical analysis in human plasma was studied using electrochemical sensor technology. Based on the obtained analytical results, engineered nano-surface led to entrapment and oxidation of QF in real samples. So, a novel and efficient method for the analysis of QF was designed and validated, which opens a new horizon for pharmaceutical analysis and therapeutic drug monitoring.

An innovative fluorometric bioanalysis strategy towards recognition of DNA methylation using opto-active polymer: A new platform for DNA damage studies by genosensor technology.

Efficient pharmacotherapy of cancer is related to accurate recognition of genetic mutations and epigenetic alterations in the early-stage diagnosis. In the present study, a novel optical genosensor based on toluidine blue as photonic probe was developed to detection of DNA methylation using hybridization of pDNA with cDNA. Biomedical analysis was performed using UV-vis and fluorometric methods. For the first time, this strategy was applied for the distinction of methylated DNA from unmethylated-DNA-based on the interaction of optical probe with methylated-DNA and unmethylated DNA. Fluorescence spectroscopic data showed that poly-toluidine blue could be bind to DNA sequences and lead to different fluorescence patterns and could be used as an efficient geno-platform for the sensitive bioassay of mutation. The excitation and emission wavelengths were 580 and 630 nm, respectively. Non-binding of mismatch sequences with the optical probe was used as negative control. Under optimal conditions, linear range was 1 zM to 0.2 pm and the lower limit of quantitation was obtained as target concentrations ranging 1 zM. The designed genosensor showed high capability to distinct methylation from un-methylated. Therefore, the designed DNA-based bioassay could detect DNA methylation significantly. Finally, bioanalysis of real samples showed that the designed genosensor could use to detect DNA methylation which is a new platform for point of care analysis.

Reliable recognition of DNA methylation using bioanalysis of hybridization on the surface of Ag/GQD nanocomposite stabilized on poly (ß-cyclodextrin): A new platform for DNA damage studies using genosensor technology.

Due to the role of DNA methylation in causing cancer in the present study, an innovative and inexpensive method was designed for the sensitive detection of DNA methylation. The silver-graphene quantum dots (Ag/GQDs) nano ink with high electrical conductivity was used as a substrate for genosensor fabrication toward identification of DNA hybridization. Also, poly (ß-cyclodextrin) (p[ß-CD]) has been used as a biointerface for the stabilization of Ag/GQD nano ink. The thiolated pDNA strand (5'-SH-TCCGCTTCCCGACCCGCACTCCGC-3') (as bioreceptor element) was fixed on the substrate and hybridized with methylated (5'-GC(M)GGAGTGC(M)GGGTC(M)GGGAAGC(M)GGA-3') and unmethylated (5'-GCGGAGTGCGGGTCGGGAAGCGGA-3') cDNAs, as target sequences were studied using electroanalysis methods. Under optimal conditions and using electrochemical techniques, the linear range was 1 am to 1 pm with LLOQ of 1aM. Finally, the designed DNA genosensor was used for detection of DNA methylation in human plasma samples and can be used to detect methylation in patient samples. It is expected that the designed DNA-based biodevice will be used to early stage diagnosis of cancer using monitoring of DNA methylation. Also, this type of genosensor can be used for epigenetic studies in the near future.

An innovative electrically conductive biopolymer based on poly(ß-cyclodextrin) towards recognition of ascorbic acid in real sample: Utilization of biocompatible advanced materials in biomedical analysis.

In this study, a sensitive platform was designed for the electrocatalytical oxidation and recognition of ascorbic acid (AA) based on poly(ß-cyclodextrin) modified glassy carbon electrode (p(ß-CD-GCE). Electropolymerization of ß-CD on the surface of GCE was performed on the potential range of -1 to 1.5 V. So, a novel biopolymer was prepared on the surface of GCE towards sensitive recognition of AA in human plasma samples. The developed platform has good sensitivity and accuracy for electrooxidation and detection of AA with lower limit of quantification (LLOQ) of 1 nM and linear range of 1 nM to 100 mM. Moreover, the designed electrochemical sensor was employed for the analysis of AA on human plasma samples with high sensitivity. Based on advantages of p(ß-CD) prepared by electropolymerization procedure (green, fast, homogeny, and efficient eletrocatalytical behaviour), this conductive biopolymer showed excellent analytical behaviour towards electrooxidation of AA. It is expected that the prepared polymeric interface is able to use in the analysis of biological species in clinical samples.

Chemical binding of horseradish peroxidase enzyme with poly beta-cyclodextrin and its application as molecularly imprinted polymer for the monitoring of H2 O2 in human plasma samples.

In this study, a selective and sensitive molecular imprinting-based electrochemical sensors, for horseradish peroxidase (HRP) entrapment was fabricated using electro polymerization of ß-Cyclodextrin (ß-CD) on the surface of glassy carbon electrode. Poly beta-cyclodextrin P(ß-CD) provide efficient surface area for self-immobilization of HRP as well as improve imprinting efficiency. The proposed imprinted biosensor successfully utilized for detection of HRP with excellent analytical results which linear range is 0.1 mg/mL to 10 ng/mL with LOD of 2.23 ng/mL. Furthermore, electrocatalytical activity of the prepared biosensor toward the reduction of hydrogen peroxide was investigated in the ranges of 1 to 15 µM with a detection limit of 0.4 µM by using chronoamperometry technique. The developed biosensor was used for the detection of hydrogen peroxide in unprocessed human plasma sample.

Chemical binding of molecular-imprinted polymer to biotinilated antibody: Utilization of molecular imprinting polymer as intelligent synthetic biomaterials toward recognition of carcinoma embryonic antigen in human plasma sample.

In this study, a novel biosensor based on molecular imprinting polymer (MIP) methodology was fabricated toward recognition of carcinoembryonic antigen (CEA). For this purpose, poly (toluidine blue) (PTB) was electropolymerized on the surface of gold electrode in the absence and presence of CEA. So, the target molecules were entrapped into the imprinted specific cavities of MIP. Obtained results show that, the binding affinity of the MIP system was significantly higher than that of revealed for the nonimprinted polymer (NIP) system, MIP-based biosensor revealed linear response from (0.005 to 75 µg/L) and low limit of quantification of (0.005 µg/L) by using chronoamperometry technique, leading to CEA monitoring in real and clinical samples. Thus, a novel technique for rapid, simple, sensitive and affordable monitoring of CEA (LLOQ = 0.005 µg/L) has provided through developed biosensor. From a future perspective, moreover, this method can be considered as an applicable candidate in biomedical and clinical analysis for point-of-care usages.

Chemical binding of pyrrolidinyl peptide nucleic acid (acpcPNA-T9) probe with AuNPs toward label-free monitoring of miRNA-21: A novel biosensing platform for biomedical analysis and POC diagnostics.

miRNAs are attractive factors in cancer research studies due to their important roles for regulating of gene expression. Because of miRNA-21 expression surplus in many types of cancers, so accurate identification is important. Increasing efforts have caused different methods to improve the sensitivity and specificity of detection. Present study is an attempt to report a new electrochemical label-free PNA-based bioassay for detection of miRNA-21. In this study, gold electrode was modified by gold nanoparticles to improve a functional PNA-based biosensor. The EDS and field emission scanning electron microscope (FE-SEM) were used to detect fabrication of biosensor. The electrochemical behavior of sensor was evaluated after inserting of acpcPNA probes and miRNA-21 on the stucture of electrode and analyzed essential parameters such as various concentration of target miRNA, hybridization time, reproducibility, stability, and applicability. The results of study demonstrated that engineered biosensor was successfully fabricated. The findings showed the highest amount of current in 5 minutes hybridization time, with suitable reproducibility and stability. This innovative miRNA-based biosensor presents a sensitive and specific method in fast and may be lab-on chip assay in future.

Visual monitoring and optical recognition of digoxin by functionalized AuNPs and triangular AgNPs as efficient optical nano-probes.

In this study, we presented elective, sensitive, and rapid UV-Vis spectrophotometry and calorimetric assay for the recognition of digoxin. Therefore, cysteamine-gold nanoparticles (Cys A-AuNPs) in the presence of cysteine acid amine and Silver nanoparticles in the presence of tetramethyl benzidine and hydrogen peroxide (AgNPs-TMB [3,3',5,5'-tetramethylbenzidine]-H2 O2 ) were synthesized and utilized as the desired probe. Finally, color variation of probes was observed in the absence and presence of digoxin. Obtained results indicate that the color of Cys A-AuNPs changed from dark pink to light in the absence and the presence of digoxin, respectively. Also, the color of AgNPs-TMB-H2 O2 changed from dark blue to light blue, in the absence and the presence of digoxin, respectively. Moreover, UV-Vis spectroscopies results indicate digoxin with a low limit of quantification of 0.125 ppm in human plasma samples which linear range was 0.125 to 11 ppm.

Enzymatic recognition of hydrogen peroxide (H2 O2 ) in human plasma samples using HRP immobilized on the surface of poly(arginine-toluidine blue)- Fe3 O4 nanoparticles modified polydopamine; A novel biosensor.

In this study, an innovative strategy was proposed for the electrocatalytical reduction and enzymatic biosensing of hydrogen peroxide (H2 O2 ) using chronoamperometry technique. For the first time, immobilization of horseradish peroxidase (HRP) in polydopamine-modified magnetic nanoparticles (PDA-MNPs) was successfully performed. Also, poly(l-arginine/toluidine blue) film-modified glassy carbon electrode was constructed through co-electropolymerization of l-arginine and toluidine blue on the surface of GCE using cyclic voltammetry technique. The engineered hybrid thin film provides strong functionalities for efficient grafting of PDA-MNPs which, in turn, enable the covalent immobilization of HRP. The proposed biosensor was used for the detection of H2 O2 in the range of 0.5-30 µM with a low limit of quantification 0.23 µM. It also was successfully applied for the investigation of hydrogen peroxide in human plasma samples.

Utilization of rGO-PEI-supported AgNPs for sensitive recognition of deltamethrin in human plasma samples: A new platform for the biomedical analysis of pesticides in human biofluids.

In this study, the rGO-PEI-AgNPs sensor was designed as a new effective platform to sensitive monitoring of deltamethrin in human plasma samples. For this purpose, reduced graphene oxide (rGO)-supported polyethylenimine (PEI) was used as a suitable substrate for dispersion of silver nanoparticles (AgNPs) as amplification and catalytic element. Therefore, a novel interface (rGO-PEI-AgNPs) was prepared by the fully electrochemical method on the surface of glassy carbon electrodes. The engineered nano-sensor showed a wide dynamic range of 10 nM to 1 mM and low limit of quantification (LLOQ) as 10 nM in human plasma sample, which revealed excellent analytical performance for the recognition of deltamethrin with high sensitivity and reproducibility through differential pulse voltammetry and square wave voltammetry techniques. The results confirm that rGO-PEI-AgNPs as a novel biocompatible interface can provide appropriate, reliable, affordable, rapid, and user-friendly diagnostic tools in the detection of deltamethrin in human real samples.

Trifluralin recognition using touch-based fingertip: Application of wearable glove-based sensor toward environmental pollution and human health control.

Monitoring of herbicides and pesticides in water, food, and the environment is essential for human health, and this requires low-cost, portable devices for widespread deployment of this technology. For the first time, a wearable glove-based electrochemical sensor based on conductive Ag nano-ink was developed for the on-site monitoring of trifluralin residue on the surface of various substrates. Three electrode system with optimal thicknesses was designed directly on the finger surface of a rubber glove. Then, fabricated electrochemical sensor used for the direct detection of trifluralin in the range of 0.01 µM to 1 mM on the surface of tomato and mulberry leaves using square wave voltammetry (SWV) and difference pulse voltammetry technique. The obtained LLOQ was 0.01 µM, which indicates the suitable sensitivity of this sensor. On the other hand, this sensor is portable, easy to use, and has a high environmental capability that can be effective in detecting other chemical threats in the soil and water environment.

A stretchable glove sensor toward rapid monitoring of trifluralin: A new platform for the on-site recognition of herbicides based on wearable flexible sensor technology using lab-on-glove.

In this study, a flexible glove-based electrochemical sensor as a wearable point-of-use screening tool has been fabricated for defense and food security applications. To design the wearable glove-based sensor, we drew conductive patterns on the fingers of a rubber glove via gold@silver-modified graphene quantum dots (Au@Ag core-shell/graphene quantum dots [GQDs]) nano-ink with optimal thickness. Then, this platform is combined with a portable electrochemical analyzer for on-site detection of trifluralin pesticide in the range of 10 nM to 1 mM with the low limit of quantification (LLOQ) of 10 nM. The high efficiency and distinction of the trifluralin at specified concentrations in real leaf and apple samples were performed by simply touching with the glove and in spikes solution by immersing of fingertips. With their high sensitivity, selectivity, rapid, and easy operation pesticide analysis, these glove-embedded sensors can also be engaged in on-site monitor of other chemical threats and can be expanded to water and environmental samples.

Identification of DNA methylation by novel optical genosensing: A new platform in epigenetic study using biomedical analysis.

Due to the important role of methylation in cancer, the use of sensitive analytical methods for early diagnosis and efficient clinical pharmacotherapy is highly demanded. In this study, an innovative label-free method has been developed for the recognition of methylated DNA in the promoter area of adenomatous polyposis coli gene (APC gene). Also, differentiation of unmethylated DNA (GCGGAGTGCGGGTCGGGAAGCGGA) from methylated cDNA (GC(M)GGAGTGC(M)GGGTC(M)GGGAAGC(M)GGA) was performed using optical synthesized probe (thionine-based polymer). Hybridization of pDNA (TCCGCTTCCCGACCCGCACTCCGC) with various types of cDNA sequences was studied by UV-visible and fluorescence spectroscopy. Also, some of the mismatch sequences {(GC(M)GGAGTAC(M)GGGTC(M)GGGAAGC(M)GGA) and (GCGGAGTACGGGTCGGGAAGCGGA)} were applied as negative control. For this purpose, The synthesized optical probe was characterized by transmission electron microscopy, atomic force microscopy, dynamic light scattering, zeta potential, energy dispersive X-ray spectroscopy, Fourier transform infrared spectroscopy, UV-Vis, and fluorescence spectroscopy. Under optimal conditions, the analytical performance of engineered DNA-based assay was studied and exhibited excellent dynamic range (1 zM to 3 pM) with low limit of quantitation (LLOQ) of 1 zM. The designed DNA-based assay showed a high capability of discriminating methylation, unmethylated and mismatched sequences. The engineered genosensor is simple and inexpensive and can detect DNA methylation with high sensitivity. Therefore, the designed geno-assay could detect DNA methylation significantly and discriminate from unmethylated DNA. It is expected that the proposed geno-assay could be used for the detection of DNA methylation, genetic mutations, epigenetic alterations, and early stage diagnosis of various cancer toward efficient clinical pharmacotherapy.

Sensitive recognition of ractopamine using GQDs-DPA as organic fluorescent probe.

A novel spectrofluorimetric sensing platform was designed for Ractopamine measurement in aqueous and plasma samples. d-penicillamine functionalized graphene quantum dots (DPA-GQDs) was utilized as a fluorescence probe, which was synthesized through the pyrolysis of citric acid in the presence of DPA. This one-pot down-top strategy causes to high-yield controllable synthesis method. The reaction time and probe concentration were optimized. Then, the fluorescence intensity of aqueous samples containing different Ractopamine concentrations and 500 ppm DPA-GQDs were measured at 25°C with an excitation wavelength of 274 nm. The sensing platform was also applied to detect Ractopamine in untreated plasma samples. The fluorescence spectroscopy technique responses indicated a linear relationship between the peak fluorescence intensity and ractopamine concentration in the range of 0.25-15 ppm with low limit of quantification of 0.25 ppm was for aqueous and plasma samples, respectively.

Providing multicolor plasmonic patterns with graphene quantum dots functionalized d-penicillamine for visual recognition of V(V), Cu (II), and Fe(III): Colorimetric fingerprints of GQDs-DPA for discriminating ions in human urine samples.

In this study, a novel fluorescent probe (graphene quantum dots functionalized d-penicillamine [GQDs-DPA]) was developed for the selective identification of Cu2+ , V5+ , and Fe3+ among 26 types of metal ions, which considerably quench the fluorescence intensity of GQD. So, GQDs-DPA was applied as a simple fluorescent probe for facile metal ions recognition in standard solution. The proposed DPA-GQD supported amino acids respond to Cu2+ , V5+ , and Fe3+ , with high sensitivity. The intensity of the fluorescence histogram of this probe significantly diminished in exposure to metal ions such as Cu(II), V(V), and Fe(III). Moreover, a microfluidic paper-based device (µPAD) was fabricated through a facile and cost-effective protocol. Cu2+ , V5+ , and Fe3+ can be selectively recognized by GQDs-DPA using µPAD by naked eye. Also, GQDs-DPA exhibits a linear response for the detection of ions in concentrations ranging from 0.01 to 1 ppm, with a low limit of quantification of 0.01 ppm in standards samples. The boosted color uniformity, low instrumental needs of the stamp, and disposability of µPADs enable the application of the proposed device for commercial applications in environmental science and technology.

Electrochemical immunoplatform to assist in the diagnosis of oral cancer through the determination of CYFRA 21.1 biomarker in human saliva samples: Preparation of a novel portable biosensor toward non-invasive diagnosis of oral cancer.

In this study, a novel, low-cost, and flexible paper-based electrochemical immunosensor was developed for the bioanalysis of Cyfra 21.1 biomarker in human saliva samples by using stabilization of synthesis Ag nano-ink on the surface of paper using pen-on-paper technology. The employed electrochemical techniques for the evaluation of immunoplatform performance were differential pulse voltammetry and chronoamperometry. Also, the prepared immunosensor showed great ability in the determination of Cyfra21.1 in human saliva specimens. Under the optimized conditions, the obtained linear range was from 0.0025 to 10 ng/mL, and the obtained LLOQ was 0.0025 ng/mL. The developed immunosensor is easy to prepare, sensitive, cost-effective, portable, and simple. So proposed immunoplatform can be an accomplished biodevice in clinical laboratories. The proposed paper-based immunosensor could be a hopefully new and cheap tool for the diagnosis of other biomarkers. Also, the prepared immunosensor showed great ability in the determination of Cyfra21.1 biomarker in human saliva specimens.

Specific monitoring of aflatoxin M1 in real samples using aptamer binding to DNFS based on turn-on method: A novel biosensor.

In the present work, a novel biocompatible scaffold was fabricated for the DNA aptamer immobilization. For the first time, amino-functionalized dendritic fibrous nanosilica (KCC-1-nPr-NH2 ) and gold nanoparticle supported by chitosan (AuNPs-CS) were synthesized and electrodeposited successfully on the surface of the glassy carbon electrode by chronoamperometry technique. Unique oligonucleotide of aflatoxin M1 (5'-ATC CGT CAC ACC TGC TCT GAC GCT GGG GTC GAC CCG GAG AAA TGC ATT CCC CTG TGG TGT TGG CTC CCG TAT) labeled by toluidine blue was immobilization on the prepared interface. Hence, a novel aptamer-based bioassay was formed for highly sensitive quantitation of AFM1 using cyclic voltammetry and differential plus voltammetry. The structure and morphology of GQDs-CS/KCC-1-nPr-NH2 were investigated by Fourier-transform infrared spectroscopy, X-ray diffraction, atomic force, scanning electron microscopy, and energy-dispersive X-ray spectroscopy. The achieved low limit of quantification of apta-assay for detection of AFM1 was 10fM. Also, calibration curve was linear from 0.1µM to 10fM in real samples. The proposed apta-assay has acceptable long-term stability. Designed aptasensor has a lot of remarkable advantages including excellent selectivity, sensitivity, and stability that could be used as facile bio-device for the determination of AFM1 in milk samples.