Lack of peptide YY signaling in mice disturbs gut microbiome composition in response to high-fat diet.

Peptide YY (PYY), produced by endocrine L cells in the gut, is known for its critical role in regulating gastrointestinal functions as well as satiety. However, how these processes are integrated with maintaining a healthy gut microbiome composition is unknown. Here, we show that lack of PYY in mice leads to distinct changes in gut microbiome composition that are diet-dependent. While under chow diet only slight differences in gut microbiome composition could be observed, high-fat diet (HFD) aggravated these differences. Specifically an increased abundance of the Bacteroidetes phylum with a corresponding decrease of the Firmicutes/Bacteroidetes ratio could be detected in Pyy-knockout (KO) mice in response to HFD. Detailed analysis of the Bacteroidetes phylum further revealed that the Alistipes genus belonging to the Rikenellaceae family, the Parabacteroides belonging to the Tannerellaceae family, as well as Muribaculum were increased in Pyy-KO mice. In order to investigate whether these changes are associated with changed markers of gut barrier and immunity, we analyzed the colonic expression of various pro-inflammatory cytokines, as well as tight junction proteins and mucin 2, and identified increased mRNA expression of the tight junction proteins Cldn2 and Ocel1 in Pyy-KO mice, while pro-inflammatory cytokine expression was not significantly altered. Together these results highlight a critical gene-environment interaction between diet and the gut microbiome and its impact on homeostasis of the intestinal epithelium under conditions of reduced PYY signaling which is commonly seen under obese conditions.

Anhedonia induced by high-fat diet in mice depends on gut microbiota and leptin.

Objectives: Imbalanced nutrition and obesity are risk factors for depression, a relationship that in rodents can be modeled by depression-like behavior in response to high-fat diet (HFD). In this work, we examined the role of the intestinal microbiota and the adipocytokine leptin as potential mediators of the effects of HFD to induce anhedonia-like behavior and reduce self-care in mice.Methods: Male mice were fed a control diet or HFD (60 kJ% from fat) for a period of 4 weeks, after which behavioral tests and molecular analyses (gut microbiome composition, intestinal metabolome, fecal fatty acids, plasma hormone levels) were performed. The role of the intestinal microbiota was addressed by selective depletion of gut bacteria with a combination of non-absorbable antibiotics, while the implication of leptin was examined by the use of leptin-deficient ob/ob mice.Results: Antibiotic treatment reduced the HFD-induced weight gain and adiposity and prevented HFD-induced anhedonia-like behavior and self-care reduction. These effects were associated with a decrease in fecal fatty acids and intestinal microbiota-related metabolites including short-chain fatty acids, glucose and amino acids. Gut microbiota depletion suppressed the HFD-induced rise of plasma leptin, and the circulating leptin levels correlated with the anhedonia-like behavior and reduced self-care caused by HFD. The anhedonic effect of HFD was absent in leptin-deficient ob/ob mice although these animals gained more weight and adiposity in response to HFD than wild-type mice.Discussion: The results indicate that anhedonia-like behavior induced by HFD in mice depends on the intestinal microbiome and involves leptin as a signaling hormone.

Further delineation of putative ACTB loss-of-function variants: A 4-patient series.

ACTB encodes ß-cytoplasmic actin, an essential component of the cytoskeleton. Based on chromosome 7p22.1 deletions that include the ACTB locus and on rare truncating ACTB variants, a phenotype resulting from ACTB haploinsufficiency was recently proposed. We report putative ACTB loss-of-function variants in four patients. To the best of our knowledge, we report the first 7p22.1 microdeletion confined to ACTB and the second ACTB frameshifting mutation that predicts mRNA decay. A de-novo ACTB p.(Gly302Ala) mutation affects ß-cytoplasmic actin distribution. All four patients share a facial gestalt that is distinct from that of individuals with dominant-negative ACTB variants in Baraitser-Winter cerebrofrontofacial syndrome. Two of our patients had strikingly thin and sparse scalp hair. One patient had sagittal craniosynostosis and hypospadias. All three affected male children have attention deficits and mild global developmental delay. Mild intellectual disability was present in only one patient. Heterozygous ACTB deletion can allow for normal psychomotor function.

Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome.

PURPOSE: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure. METHODS: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts. RESULTS: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery. CONCLUSIONS: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.

Amyloid-beta impairs insulin signaling by accelerating autophagy-lysosomal degradation of LRP-1 and IR-ß in blood-brain barrier endothelial cells in vitro and in 3XTg-AD mice.

Aberrant insulin signaling constitutes an early change in Alzheimer's disease (AD). Insulin receptors (IR) and low-density lipoprotein receptor-related protein-1 (LRP-1) are expressed in brain capillary endothelial cells (BCEC) forming the blood-brain barrier (BBB). There, insulin may regulate the function of LRP-1 in Aß clearance from the brain. Changes in IR-ß and LRP-1 and insulin signaling at the BBB in AD are not well understood. Herein, we identified a reduction in cerebral and cerebrovascular IR-ß levels in 9-month-old male and female 3XTg-AD (PS1M146V, APPSwe, and tauP301L) as compared to NTg mice, which is important in insulin mediated signaling responses. Reduced cerebral IR-ß levels corresponded to impaired insulin signaling and LRP-1 levels in brain. Reduced cerebral and cerebrovascular IR-ß and LRP-1 levels in 3XTg-AD mice correlated with elevated levels of autophagy marker LC3B. In both genotypes, high-fat diet (HFD) feeding decreased cerebral and hepatic LRP-1 expression and elevated cerebral Aß burden without affecting cerebrovascular LRP-1 and IR-ß levels. In vitro studies using primary porcine (p)BCEC revealed that Aß peptides 1-40 or 1-42 (240 nM) reduced cellular levels and interaction of LRP-1 and IR-ß thereby perturbing insulin-mediated signaling. Further mechanistic investigation revealed that Aß treatment accelerated the autophagy-lysosomal degradation of IR-ß and LRP-1 in pBCEC. LRP-1 silencing in pBCEC decreased IR-ß levels through post-translational pathways further deteriorating insulin-mediated responses at the BBB. Our findings indicate that LRP-1 proves important for insulin signaling at the BBB. Cerebral Aß burden in AD may accelerate LRP-1 and IR-ß degradation in BCEC thereby contributing to impaired cerebral and cerebromicrovascular insulin effects.

A step ahead: Exploring the gut microbiota in inpatients with bipolar disorder during a depressive episode.

OBJECTIVES: There is evidence that the gut microbiota plays a major role in the pathogenesis of diseases of the central nervous system through the gut-brain axis. The aim of the present study was to analyze gut microbiota composition in bipolar disorder (BD) and its relation to inflammation, serum lipids, oxidative stress, tryptophan (TRP)/kynurenine (KYN) levels, anthropometric measurements and parameters of metabolic syndrome. Further, microbial community differences of individuals with BD compared with healthy controls (HC) were explored. METHODS: In this cross-sectional study, we performed 16S rRNA gene sequencing of stool samples from 32 BD individuals and 10 HC. Laboratory parameters included inflammatory markers, serum lipids, KYN, oxidative stress and anthropometric measures. Microbial community analysis and correlation to clinical parameters was performed with QIIME, differential abundance analysis of taxa encompassed linear discriminant analysis effect size (LEfSe). RESULTS: We found a negative correlation between microbial alpha-diversity and illness duration in BD (R = -0.408, P = 0.021). Furthermore, we identified bacterial clades associated with inflammatory status, serum lipids, TRP, depressive symptoms, oxidative stress, anthropometrics and metabolic syndrome in individuals with BD. LEfSe identified the phylum Actinobacteria (LDA= 4.82, P = 0.007) and the class Coriobacteria (LDA= 4.75, P = 0.010) as significantly more abundant in BD when compared with HC, and Ruminococcaceae (LDA= 4.59, P = 0.018) and Faecalibacterium (LDA= 4.09, P = 0.039) as more abundant in HC when compared with BD. CONCLUSIONS: The present findings suggest that causes and/or consequences of BD may also lie outside the brain. Exploratory research of the gut microbiota in affective disorders like BD may identify previously unknown underlying causes, and offer new research and therapeutic approaches to mood disorders.

Influence of 4-week multi-strain probiotic administration on resting-state functional connectivity in healthy volunteers.

PURPOSE: Experimental investigations in rodents have contributed significantly to our current understanding of the potential importance of the gut microbiome and brain interactions for neurotransmitter expression, neurodevelopment, and behaviour. However, clinical evidence to support such interactions is still scarce. The present study used a double-blind, randomized, pre- and post-intervention assessment design to investigate the effects of a 4-week multi-strain probiotic administration on whole-brain functional and structural connectivity in healthy volunteers. METHODS: Forty-five healthy volunteers were recruited for this study and were divided equally into three groups (PRP: probiotic, PLP: placebo, and CON: control). All the participants underwent resting-state functional MRI and diffusion MRI brain scans twice during the course of study, at the beginning (time point 1) and after 4 weeks (time point 2). MRI data were acquired using a 3T whole-body MR system (Magnetom Skyra, Siemens, Germany). RESULTS: Functional connectivity (FC) changes were observed in the default mode network (DMN), salience network (SN), and middle and superior frontal gyrus network (MFGN) in the PRP group as compared to the PLP and CON groups. PRP group showed a significant decrease in FC in MFGN (in frontal pole and frontal medial cortex) and in DMN (in frontal lobe) as compared to CON and PLP groups, respectively. Further, significant increase in FC in SN (in cingulate gyrus and precuneus cortex) was also observed in PRP group as compared to CON group. The significance threshold was set to p < 0.05 FWE corrected. No significant structural differences were observed between the three groups. CONCLUSIONS: This work provides new insights into the role of a multi-strain probiotic administration in modulating the behaviour, which is reflected as changes in the FC in healthy volunteers. This study motivates future investigations into the role of probiotics in context of major depression and stress disorders.

High-fat diet induces depression-like behaviour in mice associated with changes in microbiome, neuropeptide Y, and brain metabolome.

Objectives: The biological mechanisms linking diet-related obesity and depression remain unclear. Therefore, we examined the impact of high-fat diet (HFD) on murine behaviour, intestinal microbiome, brain metabolome, neuropeptide Y (NPY) expression, and dipeptidyl peptidase-4 (DPP-4) activity.Methods: Male C57Bl/6J mice were fed an HFD (60 kJ% from fat) or control diet (12 kJ% from fat) for 8 weeks, followed by behavioural phenotyping. Caecal microbiome was analysed by 16S rDNA sequencing, brain metabolome by 1H nuclear magnetic resonance, NPY expression by PCR and immunoassay, and dipeptidyl peptidase-4 (DPP-4) activity by enzymatic assay. The effect of a 4-week treatment with imipramine (7 mg/kg/day) and the DPP-4 inhibitor sitagliptin (50 mg/kg/day) on HFD-induced behavioural changes was also tested.Results: HFD led to a depression-like phenotype as revealed by reduced sociability and sucrose preference. In the caecum, HFD diminished the relative abundance of Bacteroidetes and increased the relative abundance of Firmicutes and Cyanobacteria. In the brain, HFD modified the metabolome of prefrontal cortex and striatum, changing the relative concentrations of molecules involved in energy metabolism (e.g. lactate) and neuronal signalling (e.g. γ-aminobutyric acid). The expression of NPY in hypothalamus and hippocampus was decreased by HFD, whereas plasma NPY and DPP-4-like activity were increased. The HFD-induced anhedonia remained unaltered by imipramine and sitagliptin.Discussion: The depression-like behaviour induced by prolonged HFD in mice is associated with distinct alterations of intestinal microbiome, brain metabolome, NPY system, and DPP-4-like activity. Importantly, the HFD-evoked behavioural disturbance remains unaltered by DPP-4 inhibition and antidepressant treatment with imipramine.

Deletion of Monoglyceride Lipase in Astrocytes Attenuates Lipopolysaccharide-induced Neuroinflammation.

Monoglyceride lipase (MGL) is required for efficient hydrolysis of the endocannabinoid 2-arachidonoylglyerol (2-AG) in the brain generating arachidonic acid (AA) and glycerol. This metabolic function makes MGL an interesting target for the treatment of neuroinflammation, since 2-AG exhibits anti-inflammatory properties and AA is a precursor for pro-inflammatory prostaglandins. Astrocytes are an important source of AA and 2-AG, and highly express MGL. In the present study, we dissected the distinct contribution of MGL in astrocytes on brain 2-AG and AA metabolism by generating a mouse model with genetic deletion of MGL specifically in astrocytes (MKO(GFAP)). MKO(GFAP) mice exhibit moderately increased 2-AG and reduced AA levels in brain. Minor accumulation of 2-AG in the brain of MKO(GFAP) mice does not cause cannabinoid receptor desensitization as previously observed in mice globally lacking MGL. Importantly, MKO(GFAP) mice exhibit reduced brain prostaglandin E2 and pro-inflammatory cytokine levels upon peripheral lipopolysaccharide (LPS) administration. These observations indicate that MGL-mediated degradation of 2-AG in astrocytes provides AA for prostaglandin synthesis promoting LPS-induced neuroinflammation. The beneficial effect of astrocyte-specific MGL-deficiency is not fully abrogated by the inverse cannabinoid receptor 1 agonist SR141716 (Rimonabant) suggesting that the anti-inflammatory effects are rather caused by reduced prostaglandin synthesis than by activation of cannabinoid receptors. In conclusion, our data demonstrate that MGL in astrocytes is an important regulator of 2-AG levels, AA availability, and neuroinflammation.

Diverse action of lipoteichoic acid and lipopolysaccharide on neuroinflammation, blood-brain barrier disruption, and anxiety in mice.

Microbial metabolites are known to affect immune system, brain, and behavior via activation of pattern recognition receptors such as Toll-like receptor 4 (TLR4). Unlike the effect of the TLR4 agonist lipopolysaccharide (LPS), the role of other TLR agonists in immune-brain communication is insufficiently understood. We therefore hypothesized that the TLR2 agonist lipoteichoic acid (LTA) causes immune activation in the periphery and brain, stimulates the hypothalamic-pituitary-adrenal (HPA) axis and has an adverse effect on blood-brain barrier (BBB) and emotional behavior. Since LTA preparations may be contaminated by LPS, an extract of LTA (LTAextract), purified LTA (LTApure), and pure LPS (LPSultrapure) were compared with each other in their effects on molecular and behavioral parameters 3h after intraperitoneal (i.p.) injection to male C57BL/6N mice. The LTAextract (20mg/kg) induced anxiety-related behavior in the open field test, enhanced the circulating levels of particular cytokines and the cerebral expression of cytokine mRNA, and blunted the cerebral expression of tight junction protein mRNA. A dose of LPSultrapure matching the amount of endotoxin/LPS contaminating the LTAextract reproduced several of the molecular and behavioral effects of LTAextract. LTApure (20mg/kg) increased plasma levels of tumor necrosis factor-α (TNF-α), interleukin-6 and interferon-γ, and enhanced the transcription of TNF-α, interleukin-1ß and other cytokines in the amygdala and prefrontal cortex. These neuroinflammatory effects of LTApure were associated with transcriptional down-regulation of tight junction-associated proteins (claudin 5, occludin) in the brain. LTApure also enhanced circulating corticosterone, but failed to alter locomotor and anxiety-related behavior in the open field test. These data disclose that TLR2 agonism by LTA causes peripheral immune activation and initiates neuroinflammatory processes in the brain that are associated with down-regulation of BBB components and activation of the HPA axis, although emotional behavior (anxiety) is not affected. The results obtained with an LTA preparation contaminated with LPS hint at a facilitatory interaction between TLR2 and TLR4, the adverse impact of which on long-term neuroinflammation, disruption of the BBB and mental health warrants further analysis.

Gut microbiota and body composition in anorexia nervosa inpatients in comparison to athletes, overweight, obese, and normal weight controls.

OBJECTIVES: Anorexia nervosa (AN) is a heterogeneous eating disorder associated with alterations of body structure and the gut microbiome. We aimed to investigate the gut microbiota composition of a large female cohort including different BMI groups and activity levels along with body composition parameters. METHOD: 106 female participants were included in this cross-sectional study: AN patients (n = 18), athletes (n = 20), normal weight (n = 26), overweight (n = 22), and obese women (n = 20). DNA was extracted from stool samples and subjected to 16S rRNA gene analysis. The software Quantitative Insights Into Microbial Ecology (QIIME) was used to analyze data. Additionally, we performed anthropometric assessments, ultrasound measurements of subcutaneous adipose tissue thickness, bioimpedance analysis, administered depression inventories, and ascertained laboratory parameters and dietary intakes. RESULTS: Alpha diversity was particularly lower in AN patients and obese participants compared to other groups, while athletes showed highest alpha diversity. Several categories significantly associated with community structure were identified: body fat parameters, serum lipids, CRP, depression scales and smoking. Comparative analysis revealed Coriobacteriaceae as the only enriched phylotype in AN compared to other entities (LDA score >3.5). DISCUSSION: This study provides further evidence of intestinal dysbiosis in AN and sheds light on characteristics of the gut microbiome in different BMI and physical activity groups. These insights point to new modulation possibilities of the gut microbiota which could improve the standard therapy of AN.

Vitamin D deficiency as a risk factor for dementia: a systematic review and meta-analysis.

BACKGROUND: Sunlight exposure and high vitamin D status have been hypothesised to reduce the risk of developing dementia. The objective of our research was to determine whether lack of sunlight and hypovitaminosis D over time are associated with dementia. METHODS: We systematically searched MEDLINE (via PubMed), Cochrane Library, EMBASE, SCOPUS, Web of Science, ICONDA, and reference lists of pertinent review articles from 1990 to October 2015. We conducted random effects meta-analyses of published and unpublished data to evaluate the influence of sunlight exposure or vitamin D as a surrogate marker on dementia risk. RESULTS: We could not identify a single study investigating the association between sunlight exposure and dementia risk. Six cohort studies provided data on the effect of serum vitamin D concentration on dementia risk. A meta-analysis of five studies showed a higher risk for persons with serious vitamin D deficiency (<25 nmol/L or 7-28 nmol/L) compared to persons with sufficient vitamin D supply (≥50 nmol/L or 54-159 nmol/L) (point estimate 1.54; 95% CI 1.19-1.99, I2 = 20%). The strength of evidence that serious vitamin D deficiency increases the risk of developing dementia, however, is very low due to the observational nature of included studies and their lack of adjustment for residual or important confounders (e.g. ApoE ε4 genotype), as well as the indirect relationship between Vitamin D concentrations as a surrogate for sunlight exposure and dementia risk. CONCLUSIONS: The results of this systematic review show that low vitamin D levels might contribute to the development of dementia. Further research examining the direct and indirect relationship between sunlight exposure and dementia risk is needed. Such research should involve large-scale cohort studies with homogeneous and repeated assessment of vitamin D concentrations or sunlight exposure and dementia outcomes.

GAL3 receptor KO mice exhibit an anxiety-like phenotype.

The neuropeptide galanin (GAL) is widely distributed in the central and peripheral nervous systems. It is a modulator of various physiological and pathological processes, and it mediates its effects via three G protein-coupled receptors (GAL1-3 receptors). A role for GAL as a modulator of mood and anxiety was suggested, because GAL and its receptors are highly expressed in limbic brain structures of rodents. In recent years, numerous studies of animal models have suggested an involvement of GAL and GAL1 and GAL2 receptors in anxiety- and depression-related behavior. However, to date, there is sparse literature implicating GAL3 receptors in behavioral functions. Therefore, we studied the behavior of GAL3 receptor-deficient (GAL3-KO) mice to elucidate whether GAL3 receptors are involved in mediating behavior-associated actions of GAL. The GAL3-KO mouse line exhibited normal breeding and physical development. In addition to behavioral tests, phenotypic characterization included analysis of hematology, amino acid profiles, metabolism, and sudomotor function. In contrast to WT littermates, male GAL3-KO mice exhibited an anxiety-like phenotype in the elevated plus maze, open field, and light/dark box tests, and they were less socially affiliated than WT animals to a stranger mouse in a social interaction test. In conclusion, our data suggest involvement of GAL3 receptors in GAL-mediated effects on mood, anxiety, and behavior, making it a possible target for alternative treatment strategies for mood disorders.

Inhibition of α2A-Adrenoceptors Ameliorates Dextran Sulfate Sodium-Induced Acute Intestinal Inflammation in Mice.

It has been hypothesized that α2-adrenoceptors (α2-ARs) may be involved in the pathomechanism of colitis; however, the results are conflicting because both aggravation and amelioration of colonic inflammation have been described in response to α2-AR agonists. Therefore, we aimed to analyze the role of α2-ARs in acute murine colitis. The experiments were carried out in wild-type, α2A-, α2B-, and α2C-AR knockout (KO) C57BL/6 mice. Colitis was induced by dextran sulfate sodium (DSS, 2%); alpha2-AR ligands were injected i.p. The severity of colitis was determined both macroscopically and histologically. Colonic myeloperoxidase (MPO) and cytokine levels were measured by enzyme-linked immunosorbent assay and proteome profiler array, respectively. The nonselective α2-AR agonist clonidine induced a modest aggravation of DSS-induced colitis. It accelerated the disease development and markedly enhanced the weight loss of animals, but did not influence the colon shortening, tissue MPO levels, or histologic score. Clonidine induced similar changes in α2B- and α2C-AR KO mice, whereas it failed to affect the disease activity index scores and caused only minor weight loss in α2A-AR KO animals. In contrast, selective inhibition of α2A-ARs by BRL 44408 significantly delayed the development of colitis; reduced the colonic levels of MPO and chemokine (C-C motif) ligand 3, chemokine (C-X-C motif) ligand 2 (CXCL2), CXCL13, and granulocyte-colony stimulating factor; and elevated that of tissue inhibitor of metalloproteinases-1. In this work, we report that activation of α2-ARs aggravates murine colitis, an effect mediated by the α2A-AR subtype, and selective inhibition of these receptors reduces the severity of gut inflammation.

Cognitive impairment by antibiotic-induced gut dysbiosis: Analysis of gut microbiota-brain communication.

Emerging evidence indicates that disruption of the gut microbial community (dysbiosis) impairs mental health. Germ-free mice and antibiotic-induced gut dysbiosis are two approaches to establish causality in gut microbiota-brain relationships. However, both models have limitations, as germ-free mice display alterations in blood-brain barrier and brain ultrastructure and antibiotics may act directly on the brain. We hypothesized that the concerns related to antibiotic-induced gut dysbiosis can only adequately be addressed if the effect of intragastric treatment of adult mice with multiple antibiotics on (i) gut microbial community, (ii) metabolite profile in the colon, (iii) circulating metabolites, (iv) expression of neuronal signaling molecules in distinct brain areas and (v) cognitive behavior is systematically investigated. Of the antibiotics used (ampicillin, bacitracin, meropenem, neomycin, vancomycin), ampicillin had some oral bioavailability but did not enter the brain. 16S rDNA sequencing confirmed antibiotic-induced microbial community disruption, and metabolomics revealed that gut dysbiosis was associated with depletion of bacteria-derived metabolites in the colon and alterations of lipid species and converted microbe-derived molecules in the plasma. Importantly, novel object recognition, but not spatial, memory was impaired in antibiotic-treated mice. This cognitive deficit was associated with brain region-specific changes in the expression of cognition-relevant signaling molecules, notably brain-derived neurotrophic factor, N-methyl-d-aspartate receptor subunit 2B, serotonin transporter and neuropeptide Y system. We conclude that circulating metabolites and the cerebral neuropeptide Y system play an important role in the cognitive impairment and dysregulation of cerebral signaling molecules due to antibiotic-induced gut dysbiosis.

Synergistic effects of NOD1 or NOD2 and TLR4 activation on mouse sickness behavior in relation to immune and brain activity markers.

Toll-like receptors (TLRs) and nuclear-binding domain (NOD)-like receptors (NLRs) are sensors of bacterial cell wall components to trigger an immune response. The TLR4 agonist lipopolysaccharide (LPS) is a strong immune activator leading to sickness and depressed mood. NOD agonists are less active but can prime immune cells to augment LPS-induced cytokine production. Since the impact of NOD and TLR co-activation in vivo has been little studied, the effects of the NOD1 agonist FK565 and the NOD2 agonist muramyl dipeptide (MDP), alone and in combination with LPS, on immune activation, brain function and sickness behavior were investigated in male C57BL/6N mice. Intraperitoneal injection of FK565 (0.001 or 0.003mg/kg) or MDP (1 or 3mg/kg) 4h before LPS (0.1 or 0.83mg/kg) significantly aggravated and prolonged the LPS-evoked sickness behavior as deduced from a decrease in locomotion, exploration, food intake and temperature. When given alone, FK565 and MDP had only minor effects. The exacerbation of sickness behavior induced by FK565 or MDP in combination with LPS was paralleled by enhanced plasma protein and cerebral mRNA levels of proinflammatory cytokines (IFN-γ, IL-1ß, IL-6, TNF-α) as well as enhanced plasma levels of kynurenine. Immunohistochemical visualization of c-Fos in the brain revealed that NOD2 synergism with TLR4 resulted in increased activation of cerebral nuclei relevant to sickness. These data show that NOD1 or NOD2 synergizes with TLR4 in exacerbating the immune, sickness and brain responses to peripheral immune stimulation. Our findings demonstrate that the known interactions of NLRs and TLRs at the immune cell level extend to interactions affecting brain function and behavior.

Neuropeptides and the microbiota-gut-brain axis.

Neuropeptides are important mediators both within the nervous system and between neurons and other cell types. Neuropeptides such as substance P, calcitonin gene-related peptide and neuropeptide Y (NPY), vasoactive intestinal polypeptide, somatostatin and corticotropin-releasing factor are also likely to play a role in the bidirectional gut-brain communication. In this capacity they may influence the activity of the gastrointestinal microbiota and its interaction with the gut-brain axis. Current efforts in elucidating the implication of neuropeptides in the microbiota-gut-brain axis address four information carriers from the gut to the brain (vagal and spinal afferent neurons; immune mediators such as cytokines; gut hormones; gut microbiota-derived signalling molecules) and four information carriers from the central nervous system to the gut (sympathetic efferent neurons; parasympathetic efferent neurons; neuroendocrine factors involving the adrenal medulla; neuroendocrine factors involving the adrenal cortex). Apart from operating as neurotransmitters, many biologically active peptides also function as gut hormones. Given that neuropeptides and gut hormones target the same cell membrane receptors (typically G protein-coupled receptors), the two messenger roles often converge in the same or similar biological implications. This is exemplified by NPY and peptide YY (PYY), two members of the PP-fold peptide family. While PYY is almost exclusively expressed by enteroendocrine cells, NPY is found at all levels of the gut-brain and brain-gut axis. The function of PYY-releasing enteroendocrine cells is directly influenced by short chain fatty acids generated by the intestinal microbiota from indigestible fibre, while NPY may control the impact of the gut microbiota on inflammatory processes, pain, brain function and behaviour. Although the impact of neuropeptides on the interaction between the gut microbiota and brain awaits to be analysed, biologically active peptides are likely to emerge as neural and endocrine messengers in orchestrating the microbiota-gut-brain axis in health and disease.

Development of a Polyethylene Glycol/Polymethyl Methacrylate-Based Binder System for a Borosilicate Glass Filler Suitable for Injection Molding.

Powder injection molding is an established, cost effective and often near-net-shape mass production process for metal or ceramic parts with complex geometries. This paper deals with the extension of the powder injection molding process chain towards the usage of a commercially available borosilicate glass and the realization of glass compounds with huge densities. The whole process chain consists of the individual steps of compounding, molding, debinding, and sintering. The first part, namely, the search for a suitable feedstock composition with a very high solid load and reliable molding properties, is mandatory for the successful manufacture of a dense glass part. The most prominent feature is the binder composition and the related comprehensive rheological characterization. In this work, a binder system consisting of polyethylene glycol and polymethylmethacrylate with stearic acid as a surfactant was selected and its suitability for glass injection molding was evaluated. The influence of all feedstock components on processing and of the process steps on the final sintered part was investigated for sintered glass parts with densities around 99% of the theoretical value.

Correction: Fibromyalgia-associated hyperalgesia is related to psychopathological alterations but not to gut microbiome changes.

[This corrects the article DOI: 10.1371/journal.pone.0274026.].

Typical and extreme weather datasets for studying the resilience of buildings to climate change and heatwaves.

We present unprecedented datasets of current and future projected weather files for building simulations in 15 major cities distributed across 10 climate zones worldwide. The datasets include ambient air temperature, relative humidity, atmospheric pressure, direct and diffuse solar irradiance, and wind speed at hourly resolution, which are essential climate elements needed to undertake building simulations. The datasets contain typical and extreme weather years in the EnergyPlus weather file (EPW) format and multiyear projections in comma-separated value (CSV) format for three periods: historical (2001-2020), future mid-term (2041-2060), and future long-term (2081-2100). The datasets were generated from projections of one regional climate model, which were bias-corrected using multiyear observational data for each city. The methodology used makes the datasets among the first to incorporate complex changes in the future climate for the frequency, duration, and magnitude of extreme temperatures. These datasets, created within the IEA EBC Annex 80 "Resilient Cooling for Buildings", are ready to be used for different types of building adaptation and resilience studies to climate change and heatwaves.