Characterization of a New, Country Bean (Lablab purpureus) Lineage of Bean Common Mosaic Necrosis Virus.

Country bean (Lablab purpureus, family Fabaceae) is grown in subsistence agriculture in Bangladesh as a multipurpose crop for food, animal feed, and green manure. This study was undertaken to investigate the genetic diversity of bean common mosaic necrosis virus (BCMNV, genus Potyvirus, family Potyviridae) in country beans. Leaf samples from country beans showing yellowing, vein banding, and mosaic symptoms were collected during field surveys between 2015 and 2019 cropping seasons from farmers' fields in different geographic regions. These samples were tested by serological and molecular diagnostic assays for the presence of BCMNV. Virus-positive samples were subjected to high-throughput Illumina sequencing to generate near-complete genomes of BCMNV isolates. In pairwise comparisons, the polyprotein sequences of BCMNV isolates from Bangladesh showed greater than 98% identities among themselves and shared less than 84% sequence identity at the nucleotide level with virus isolates reported from other countries. In the phylogenetic analysis, BCMNV isolates from Bangladeshi country beans formed a separate clade from virus isolates reported from common beans in other countries in the Americas, Africa, Europe, and from East Timor. Grow-out studies showed seed-to-seedling transmission of BCMNV, implying a possible seedborne nature of the virus in country beans.

First reports of Beet curly top virus, Citrus yellow vein-associated virus, and Hop latent viroid in industrial hemp (Cannabis sativa) in Washington State.

In 2021 and 2022, virus-like symptoms were observed in several cultivars of industrial hemp (Cannabis sativa) in two fields in central Washington, USA. Affected plants had a range of symptoms at different developmental stages, with young plants having severe stunting with shortened internodes and reduced flower mass. Young leaves of infected plants also showed light green to total yellowing, and twirling with twisting margins (Fig. S1). Infections of older plants caused less foliar symptoms that consisted of mosaic, mottling, and mild chlorosis on a few branches with tacoing of older leaves. To assess if symptomatic hemp plants were infected with Beet curly top virus (BCTV) as reported earlier (Giladi et al., 2020; Chiginsky et al., 2021), symptomatic leaves were collected from 38 plants, and the extracted total nucleic acids tested by PCR to amplify a 496-base pair (bp) fragment specific to BCTV coat protein (CP) using primers BCTV2-F 5'-GTGGATCAATTTCCAG-ACAATTATC-3' and BCTV2-R 5'-CCCATAAGAGCCATATCA-AACTTC-3' (Strausbaugh et al. 2008). BCTV was found in 37 of the 38 plants. To further assess the virome of symptomatic hemp plants, total RNA was extracted from symptomatic leaves of four plants using Spectrum total RNA isolation kits (Sigma-Aldrich, St. Louis, MO) and subjected to high-throughput sequencing on an Illumina Novaseq platform in paired-end mode (University of Utah, Salt Lake City, UT). The raw reads (33 to 40 million per sample) were trimmed based on quality and ambiguity and resulting paired-end reads of ≈142 bp length were assembled de novo into a pool of contigs (CLC Genomics Workbench 21, Qiagen Inc.). Virus sequences were identified through BLASTn analysis in GenBank (https://www.ncbi.nlm.nih.gov/blast). One contig of 2,929 nucleotides (nt) obtained from one sample (accession no. OQ068391) showed 99.3% identity with BCTV-Wor strain reported from sugar beet in Idaho (accession no. KX867055 Strausbaugh et al., 2017). Another contig of 1,715 nt from a second sample (accession no. OQ068392) shared 97.3% identity with BCTV-CO strain (accession no. KX867022). Two contig sequences of 2,876 nt (accession no. OQ068388) and 1,399 nt (accession no. OQ068389) obtained from the 3rd and 4th samples showed 97.2% and 98.3% identity, respectively, with Citrus yellow vein-associated virus (CYVaV, accession no. MT893740.1) reported in industrial hemp from Colorado (Chiginsky et al., 2021). Contigs of 256 nt sequence (accession no. OQ068390) obtained from the 3rd and 4th samples also showed 99-100% identity with Hop Latent viroid (HLVd) sequences in GenBank (accessions OK143457 and X07397). These results indicated single infections of BCTV strains and co-infection of CYVaV and HLVd in individual plants. To confirm theagents, symptomatic leaves were collected from 28 randomly selected hemp plants and tested by PCR/RT-PCR using primers specific to BCTV (Strausbaugh et al., 2008), CYVaV (Kwon et al., 2021) and HLVd (Matousek et al., 2001). Amplicons specific to BCTV (496 bp), CYVaV (658 bp) and HLVd (256 bp) were detected in 28, 25, and 2 samples, respectively. BCTV CP sequences obtained by Sanger sequencing from seven samples showed 100% sequence identity with BCTV-CO and BCTV-Wor strains in six and one samples, respectively. Similarly, sequences of CYVaV- and HLVd-specific amplicons showed 100% identity with corresponding sequences in GenBank. To the best of our knowledge, this is the first report of two strains of BCTV (BCTV-CO and BCTV-Wor), CYVaV, and HLVd infecting industrial hemp in Washington state.

First report of Tobacco ringspot virus in highbush blueberry in Washington State.

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

First Report of grapevine red globe virus in grapevines in Washington State.

Grapevine red globe virus (GRGV; genus Maculavirus, family Tymoviridae) has been reported in grapevines (Vitis spp.) from Italy, Greece, France, China, Spain and Germany and in California, U.S.A. (Sabanadzovic et al. 2000; Cretazzo et al. 2017; Fan et al. 2016; Ruiz-Garcia et al., 2018). During surveys of grapevine nurseries, a total of 241 composite samples, each consisting of four petioles from mature leaves/vine from five asymptomatic grapevines, from 33 grapevine (Vitis vinifera) cultivars were collected. Total RNA isolated from these samples using Spectrum Total RNA isolation kit (Sigma-Aldrich, St. Louis, MO) was subjected to high-throughput sequencing (HTS) on an Illumina HiSeq2500 or Novaseq 6000 platforms in paired-end mode (Genomics Core Facility, Huntsman Cancer Institute, Utah University, Salt Lake City, UT). After trimming raw reads based on quality and ambiguity, the paired-end quality reads of approximately 120 (HiSeq) or 145 (Novaseq) base pair (bp) length were assembled de novo into a pool of contigs (CLC Genomics workbench 12). These contigs were subjected to BLASTn analysis against the nonredundant virus database from GenBank (http://www.ncbi.nlm.nih.gov/blast). A total of 49 contig sequences, ranging from 200 to 1645 bp in length with an average coverage ranging up to 418.7, aligning with GRGV genome were detected in cvs. Aglianico, Cabernet franc, Pinot gris and Riesling. BLASTn analysis of contigs greater than 500 bp length showed sequence identity between 88.5% and 95% with corresponding GRGV sequences reported from other countries. These results indicated the presence of genetically distinct isolates of GRGV. HTS data also revealed coinfection of GRGV in all samples with one or more of the following virus and/or viroids: grapevine rupestris stem pitting associated virus, grapevine rupestris vein feathering virus, hop stunt viroid or grapevine yellow speckle viroid-1. To further confirm infection by GRGV, total RNA was extracted from two asymptomatic Pinot gris vines previously tested positive in HTS using Spectrum Total RNA isolation kit and subjected to reverse transcription-PCR using primers specific to the replicase polyprotein gene of the virus (RG4847F: 5'-TGGTCTGTTGTTCGCATCTT-3' and RG6076R: 5' CGGAAGGGGAAGCATTGATCT-3', Cretazzo et al., 2017). Sequence analysis of the approximately1,250 bp amplicons (accession number MT749359) showed 91.2 % nt sequence identity with corresponding sequence of GRGV isolate from Brazil (KX828704.1). To our knowledge, this is the first report of GRGV in Washington State. Together with the report of the occurrence of GRGV in California (Sabanadzovic et al. 2000), these/span> results indicate wide geographical distribution of the virus. Although GRGV can cause asymptomatic infections in grapevines (Martelli et al. 2002), the economic importance of GRGV as single or coinfections with other viruses needs to be examined to assess the potential significance of the virus to grape production and grapevine certification programs.

First report of grapevine rupestris vein feathering virus in grapevines from Washington State.

Since the first report of grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) in a Greek grapevine causing chlorotic discoloration of leaf veins (El Beaino et al., 2001), GRVFV was reported in some European countries, and in Australia, China, Korea, New Zealand, Uruguay, and Canada (Blouin et al., 2017; Cho et al., 2018; Reynard et al., 2017). In the USA, the virus was reported only from California in vines showing Syrah decline symptoms (Al Rwahnih et al., 2009). During virus surveys conducted between 2015 and 2019, 424 samples (petioles from individual or composite of five vines, with 4 petioles/vine) with and without discernible symptoms were collected randomly from 39 Vitis vinifera cultivars in vineyards and nurseries in eastern Washington State. Total RNA was isolated from these samples separately using SpectrumTM Plant Total RNA Kit (Sigma-Aldrich) and subjected individually to Illumina RNAseq (Huntsman Cancer Institute, Salt Lake City, UT). An average of ~28 million 120-base pair (bp) paired-end reads using HiSeq2500 platform and an average of ~18 million 145-bp paired-end reads using Novaseq 6000 platform were obtained per sample. The contigs from de novo assembly of quality-filtered reads from each sample (CLC Genomics workbench 12) were subjected to BLASTn analysis against the virus database from GenBank. In addition to grapevine viruses and viroids previously reported in Washington State, GRVFV-specific sequences were obtained in samples from 11 of the 39 cultivars; namely, Muscat Ottonel, Pinot gris and Sangiovese from vineyards and Aglianico, Bonarda, Cabernet Sauvignon, Chardonnay, Garnacha Tinta, Riesling, Tempranillo and Valdiguie from nurseries. BLASTn analysis of the 73 GRVFV-specific contigs, ranging in size between 500 nt and 6474 nt, showed sequence identity between 79.4% and 95.5% with GRVFV sequences deposited in GenBank. The data also revealed that GRVFV was always present as coinfection with one or more viruses and viroids (grapevine leafroll-associated virus 3, grapevine red blotch virus, grapevine virus A and B, grapevine rupestris stem pitting-associated virus, hop stunt viroid and grapevine yellow speckle viroid 1) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5'- TACAAGGTGAATTGCTCCACAC -3') and SaR-1027 (5'-TCATTGGCGATGCGTTCG-3') to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT782070) showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084811.1) to 90.9% (738 bp out of 813 bp) with an isolate from New Zealand (MF000326.1). Additional studies are in progress to examine the etiology, genetic diversity and impact of GRVFV in Washington vineyards.

Intra-species recombination among strains of the ampelovirus Grapevine leafroll-associated virus 4.

BACKGROUND: Grapevine leafroll disease is one of the most economically important viral diseases affecting grape production worldwide. Grapevine leafroll-associated virus 4 (GLRaV-4, genus Ampelovirus, family Closteroviridae) is one of the six GLRaV species documented in grapevines (Vitis spp.). GLRaV-4 is made up of several distinct strains that were previously considered as putative species. Currently known strains of GLRaV-4 stand apart from other GLRaV species in lacking the minor coat protein. METHODS: In this study, the complete genome sequence of three strains of GLRaV-4 from Washington State vineyards was determined using a combination of high-throughput sequencing, Sanger sequencing and RACE. The genome sequence of these three strains was compared with corresponding sequences of GLRaV-4 strains reported from other grapevine-growing regions. Phylogenetic analysis and SimPlot and Recombination Detection Program (RDP) were used to identify putative recombination events among GLRaV-4 strains. RESULTS: The genome size of GLRaV-4 strain 4 (isolate WAMR-4), strain 5 (isolate WASB-5) and strain 9 (isolate WALA-9) from Washington State vineyards was determined to be 13,824 nucleotides (nt), 13,820 nt, and 13,850 nt, respectively. Multiple sequence alignments showed that a 11-nt sequence (5'-GTAATCTTTTG-3') towards 5' terminus of the 5' non-translated region (NTR) and a 10-nt sequence (5'-ATCCAGGACC-3') towards 3' end of the 3' NTR are conserved among the currently known GLRaV-4 strains. LR-106 isolate of strain 4 and Estellat isolate of strain 6 were identified as recombinants due to putative recombination events involving divergent sequences in the ORF1a from strain 5 and strain Pr. CONCLUSION: Genome-wide analyses showed for the first time that recombinantion can occur between distinct strains of GLRaV-4 resulting in the emergence of genetically stable and biologically successful chimeric viruses. Although the origin of recombinant strains of GLRaV-4 remains elusive, intra-species recombination could be playing an important role in shaping genetic diversity and evolution of the virus and modulating the biology and epidemiology of GLRaV-4 strains.

Barley stripe mosaic virus (BSMV) as a virus-induced gene silencing vector in maize seedlings.

Barley stripe mosaic virus (BSMV) was the first reported and still widely used virus-induced gene silencing (VIGS) vector for monocotyledons including wheat and barley. Despite BSMV's reported infectivity on maize (Zea mays), the use of the virus as a vector in maize has not been optimized. Here, we assayed infectivity of BSMV in different maize cultivars by vascular puncture inoculation. Through knockdown of the endogenous host phytoene desaturase gene, we demonstrate for the first time that BSMV can be used as a VIGS vector in maize. This adds BSMV to the repertoire of tools available for functional studies in maize.

An Analysis of the Complete Genome Sequence and Subgenomic RNAs Reveals Unique Features of the Ampelovirus, Grapevine leafroll-associated virus 1.

Despite being the first closterovirus documented in grapevines (Vitis sp.), the molecular biology of Grapevine leafroll-associated virus 1 (GLRaV-1, genus Ampelovirus, family Closteroviridae) is still in its infancy. In this study, the complete genome sequence of two GLRaV-1 isolates was determined to be 18,731 (isolate WA-CH) and 18,946 (isolate WA-PN) nucleotides (nt). The genome of WA-CH and WA-PN isolates encodes nine putative open reading frames (ORFs) and the arrangement of these ORFs in both isolates was similar to that of Australian and Canadian isolates. In addition to two divergent copies of the coat protein (CP), the genome of GLRaV-1 isolates contain CP-homologous domain in four genes, making the virus unique among Closteroviridae members. The 5' and 3' nontranslated regions (NTRs) of WA-CH and WA-PN isolates showed differences in size and sequence composition, with 5' NTR having variable number of ∼65-nt-long repeats. Using the 5' NTR sequences, a reverse transcription-polymerase chain reaction and restriction fragment length polymorphism method was developed to distinguish GLRaV-1 variants in vineyards. Northern analysis of total RNA from GLRaV-1-infected grapevine samples revealed three subgenomic RNAs (sgRNAs), corresponding tentatively to CP, p21, and p24 ORFs, present at higher levels, with p24 sgRNA observed at relatively higher abundance than the other two sgRNAs. The 5' terminus of sgRNAs corresponding to CP, CPd1, CPd2, p21, and p24 were mapped to the virus genome and the leader sequence for these five sgRNAs determined to be 68, 27, 15, 49, and 18 nt, respectively. Taken together, this study provided a foundation for further elucidation of the comparative molecular biology of closteroviruses infecting grapevines.

Soil-borne wheat mosaic virus infectious clone and manipulation for gene-carrying capacity.

A full-length infectious cDNA clone of soil-borne wheat mosaic virus (SBWMV; genus Furovirus; family Virgaviridae) was developed for agrobacterium delivery. The cloned virus can be agroinfiltrated to Nicotiana benthamiana for subsequent infection of wheat (Triticum aestivum, L.). The utility of the virus as a vector for gene silencing and expression was assessed through sequence insertions in multiple sites of RNA2. Virus-induced photobleaching was observed in N. benthamiana but not in wheat, despite the stability of the inserts. The SBWMV infectious clone can be used for further studies to investigate the biology of SBWMV through mutagenesis.

3'-coterminal subgenomic RNAs and putative cis-acting elements of Grapevine leafroll-associated virus 3 reveals 'unique' features of gene expression strategy in the genus Ampelovirus.

BACKGROUND: The family Closteroviridae comprises genera with monopartite genomes, Closterovirus and Ampelovirus, and with bipartite and tripartite genomes, Crinivirus. By contrast to closteroviruses in the genera Closterovirus and Crinivirus, much less is known about the molecular biology of viruses in the genus Ampelovirus, although they cause serious diseases in agriculturally important perennial crops like grapevines, pineapple, cherries and plums. RESULTS: The gene expression and cis-acting elements of Grapevine leafroll-associated virus 3 (GLRaV-3; genus Ampelovirus) was examined and compared to that of other members of the family Closteroviridae. Six putative 3'-coterminal subgenomic (sg) RNAs were abundantly present in grapevine (Vitis vinifera) infected with GLRaV-3. The sgRNAs for coat protein (CP), p21, p20A and p20B were confirmed using gene-specific riboprobes in Northern blot analysis. The 5'-termini of sgRNAs specific to CP, p21, p20A and p20B were mapped in the 18,498 nucleotide (nt) virus genome and their leader sequences determined to be 48, 23, 95 and 125 nt, respectively. No conserved motifs were found around the transcription start site or in the leader sequence of these sgRNAs. The predicted secondary structure analysis of sequences around the start site failed to reveal any conserved motifs among the four sgRNAs. The GLRaV-3 isolate from Washington had a 737 nt long 5' nontranslated region (NTR) with a tandem repeat of 65 nt sequence and differed in sequence and predicted secondary structure with a South Africa isolate. Comparison of the dissimilar sequences of the 5'NTRs did not reveal any common predicted structures. The 3'NTR was shorter and more conserved. The lack of similarity among the cis-acting elements of the diverse viruses in the family Closteroviridae is another measure of the complexity of their evolution. CONCLUSIONS: The results indicate that transcription regulation of GLRaV-3 sgRNAs appears to be different from members of the genus Closterovirus. An analysis of the genome sequence confirmed that GLRaV-3 has an unusually long 5'NTR of 737 nt compared to other monopartite members of the family Closteroviridae, with distinct differences in the sequence and predicted secondary structure when compared to the corresponding region of the GLRaV-3 isolate from South Africa.

Genetic variability of natural populations of Grapevine leafroll-associated virus 2 in Pacific Northwest vineyards.

Genetic variability of field populations of Grapevine leafroll-associated virus 2 (GLRaV-2) in Pacific Northwest (PNW) vineyards was characterized by sequencing the entire coat protein (CP) and a portion of the heat-shock protein-70 homolog (HSP70h) genes. Phylogenetic analysis of CP and HSP70h nucleotide sequences obtained in this study and corresponding sequences from GenBank revealed segregation of GLRaV-2 isolates into six lineages with virus isolates from PNW distributed in 'PN', 'H4', and 'RG' lineages. An estimation of the ratio of nonsynonymous substitutions per nonsynonymous site to synonymous substitutions per synonymous site indicated that different selection pressures may be acting on the two genomic regions encoding proteins with distinct functions. Multiple alignments of CP amino acid sequences showed lineage-specific differences. Enzyme-linked immunosorbent assay results indicated that GLRaV-2-specific antibodies from a commercial source are unable to reliably detect GLRaV-2 isolates in the RG lineage, thereby limiting antibody-based diagnosis of all GLRaV-2 isolates currently found in PNW vineyards. A protocol based on reverse-transcription polymerase chain reaction and restriction fragment length polymorphism analysis was developed for differentiating GLRaV-2 isolates belonging to the three lineages present in the region. The taxonomic status of GLRaV-2 is discussed in light of the current knowledge of global genetic diversity of the virus.

Development of infectious cDNA clones of Grapevine leafroll-associated virus 3 and analyses of the 5' non-translated region for replication and virion formation.

Infectious cDNA clones were developed for Grapevine leafroll-associated virus 3 (GLRaV-3, genus Ampelovirus, family Closteroviridae). In vitro RNA transcripts generated from cDNA clones showed replication via the production of 3'-coterminal subgenomic (sg) mRNAs in Nicotiana benthamiana protoplasts. The detection of sgRNAs and the recovery of progeny recombinant virions from N. benthamiana leaves agroinfiltrated with full-length cDNA clones confirmed RNA replication and virion formation. The 5' non-translated region (5' NTR) of GLRaV-3 was exchangeable between genetic variants and complement the corresponding cognate RNA functions in trans. Mutational analysis of the 5' NTR in minireplicon cDNA clones showed that the conserved 40 nucleotides at the 5'-terminus were indispensable for replication, compared to downstream variable portion of the 5' NTR. Some of the functional mutations in the 5' NTR were tolerated in full-length cDNA clones and produced sgRNAs and virions in N. benthamiana leaves, whereas other mutations affected replication and virion formation.

Identification of a maize chlorotic dwarf virus silencing suppressor protein.

Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389kDa proteolytically processed polyprotein. We show that the N-terminal 78kDa polyprotein (R78) of MCDV acts as a suppressor of RNA silencing in a well-established assay system. We further demonstrate that R78 is cleaved by the viral 3C-like protease into 51 and 27kDa proteins (p51 and p27), and that p51 is responsible for silencing suppressor activity. Silencing suppressor activity of R78 is conserved in three divergent MCDV strains (MCDV-Severe, MCDV-M1, and MCDV-Tennessee), as well as the waikavirus Bellflower vein chlorosis virus, but was not detected for orthologous protein of Rice tungro spherical virus (RTSV-A) or the similarly-positioned protein from the sequivirus Parsnip yellow fleck virus (PYFV). This is the first identification of a virus suppressor of RNA silencing encoded by a waikavirus.

Transformation of an edible crop with the pagA gene of Bacillus anthracis.

Vaccination against anthrax is the most important strategy to combat the disease. This study describes a generation of edible transgenic crop expressing, functional protective antigen (PA). In vitro studies showed that the plant-expressed antigen is qualitatively similar to recombinant PA. Immunization studies in mouse animal models indicated the generation of PA-specific neutralizing antibodies and stressed the need for improving expression levels to generate higher antibody titers. Genetic engineering of a plant organelle offers immense scope for increasing levels of antigen expression. An AT-rich PA gene (pagA) coding for the 83-kDa PA molecule was thus cloned and expressed in tobacco chloroplasts. Biolistics was used for the transformation of a chloroplast genome under a set of optimized conditions. The expression of the pagA gene with 69% AT content was highly favored by an AT-rich chloroplast genome. A multifold expression level of functional PA was obtained as compared with the nuclear transgenic tobacco plants. This report describes for the first time a comprehensive study on generating transgenic plants expressing PA, which may serve as a source of an edible vaccine against anthrax. Two important achievements of expressing PA in an edible crop and use of chloroplast technology to enhance the expression levels are discussed here.