First Report of Alternaria Leaf Spot Caused by Alternaria tenuissima on Blueberry (Vaccinium corymbosum) in Western Australia.

Blueberry (Vaccinium corymbosum) plants in a commercial plantation at Yanchep, Western Australia, in April and May 2013, showed a widespread leaf spotting condition. Leaf lesions were circular to irregular, light brown to gray, 1 to 5 mm in diameter, with distinct dark brownish red borders. A fungus was consistently recovered by plating surface-sterilized (1% NaOCl) sections of symptomatic leaf tissue onto water agar and sub-culturing onto potato dextrose agar (PDA). For conidial production, the fungus was grown on PDA under a 12-h/12-h dark/light photoperiod at 25°C. Fungal colonies had a dark olive color on both sides, with loose, cottony mycelium on the surface of cultures. Isolates showed morphological similarities to Alternaria tenuissima as described in other reports (1,3). Simple conidiophores ranged from 16.3 to 96.6 µm (mean 37.5 µm) and produced numerous conidia in long chains. Conidia ranged from 7.0 to 23.9 µm (mean 13.9 µm) in length and 3.9 to 7.5 µm (mean 5.7 µm) in width, contained two to five transverse septa, but only an occasional longitudinal septum was observed. Using a representative isolate, a PCR-based assay with the ITS1 and ITS4 primers was used to amplify from the 3' end of 16S rRNA, across ITS1, 5.8S rRNA, and ITS2 to the 5' end of the 26S rRNA (4). The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank (2). The sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank (Accession No. KC568287) for A. tenuissima. The relevant information for a representative isolate has been lodged in GenBank (KF408355). A conidial suspension of 2.5 × 105 conidia ml-1 from a single-spore culture was spot inoculated onto 20 leaves, ranging from recently emerged to oldest, of 6-month-old V. corymbosum Nellie Kelly plants maintained at 18/13°C 12-h/12-h day/night and >90% relative humidity for 72 h post inoculation. Symptoms were evident by 18 days post inoculation and by 24 days consisted of pale brown lesions that were mostly 2.1 to 2.5 µm in diameter and with distinct dark brownish red borders. A. tenuissima, showing morphological characteristics identical to those described above, was re-isolated from lesions to fulfill Koch's postulates. No lesions occurred on an equivalent number of leaves of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13639). A. tenuissima has been reported across Australia on a range of other hosts. However, on V. corymbosum, the pathogen has only previously been recorded in Tasmania (2009). It may also have been the cause of a leaf spotting condition on V. corymbosum recorded in Victoria (1976) and New South Wales (1984), but mistakenly listed with A. alternata as the cause. To the best of our knowledge, this is the first record of A. tenuissima on V. corymbosum in Western Australia. With 10 to 30% of leaves showing disease symptoms widely spread on many V. corymbosum plants in the commercial plantation, this pathogen could potentially adversely affect the future production of blueberries in Western Australia. References: (1) F. L. Caruso and R. C. Ramsdell, eds. Compendium of Blueberry and Cranberry Diseases. American Phytopathological Society, St. Paul, MN, 1995. (2) J. C. Kang et al. Mycol. Res. 106:1151, 2002. (3) E. G. Simmons. Mycotaxon 70:325, 1999. (4) T. J. White et al. Pages 315-322 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

First Report of Phoma glomerata Associated with the Ascochyta Blight Complex on Field Pea (Pisum sativum) in Australia.

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as "black spot disease" in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5'GTTTCCGTAGGTGAACCTGC 3') and AB28 (5'ATATGCTTAAGTTCAGCGGGT 3') were used to amplify extracted DNA from the 3' end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5' end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml-1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.

First Report of Powdery Mildew Caused by Erysiphe cruciferarum on Brassica campestris var. pekinensis, B. carinata, Eruca sativa, E. vesicaria in Australia and on B. rapa and B. oleracea var. capitata in Western Australia.

Inspection of field plantings of diverse cruciferous species, mainly oilseed varieties sown for agronomic assessment at Crawley, (31.99°S, 115.82°E), Western Australia, in September 2012, indicated the occurrence of extensive leaf and stem colonization by powdery mildew at the late flowering stage, with whitish patches 3 to 4 cm in length on stems of Brassica campestris var. pekinensis, B. carinata, B. oleracea var. capitata, B. rapa, Eruca sativa, and E. vesicaria. These patches coalesced to form a dense, white, powdery layer. Infected leaves showed signs of early senescence. Pathogenicity was demonstrated from transferring field inoculum from the most susceptible variety by pressing diseased leaves onto leaves of the six potted plant species, and incubating plants in a moist chamber for 48 hours post-inoculation (hpi) in an air-conditioned glasshouse approximating 25°C. Signs of powdery mildew were evident by 7 days post-inoculation (dpi), and well developed symptoms by 10 dpi and as observed in the field. Uninoculated control plants did not develop powdery mildew. On all inoculated species, abundant conidia typical of those produced by Erysiphe cruciferarum were observed, matching the descriptions of conidia given by Purnell and Sivanesan (3), with cylindrical conidia typically borne singly or in short chains. Mycelia were amphigenous, in patches, often spreading to become effused. Conidiophores were 3 to 4 cells, unbranched, and foot cells cylindrical. Across all host species, conidia were mostly produced singly with overall mean measured lengths 19.7 to 35.4 µm (mean 26.9 µm), and measured widths 7.1 to 12.9 µm (mean 9.7 µm), from measurements taken on 200 conidia for each of the six different species. Spore sizes measured approximated those found for E. cruciferarum by Kaur et al. (1) on B. juncea in Western Australia (viz. 21.2 to 35.4 × 8.8 to 15.9 µm), but were smaller than those reported by Purnell and Sivanesan (3) (viz. 30 to 40 × 12 to 16 µm) or by Koike and Saenz (1) (viz. 35 to 50 × 12 to 21 µm). We confirmed a length-to-width ratio >2 (mean range 2.7 to 2.8 across all six species) as found by both Purnell and Sivanesan (3) and Koike and Saenz (2). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene was carried out with universal primers ITS1 and ITS4 and PCR products from E. cruciferarum from B. oleracea var. capitata and B. rapa sequenced. BLAST analyses to compare sequences with those in GenBank showed a >99% nucleotide identity for E. cruciferarum. In Western Australia, E. cruciferarum has been recorded on B. napus var. napobrassica since 1971 (4), B. napus since 1986 (4), and on B. juncea since 2008 (1). In other regions of Australia, E. cruciferarum has been recorded on B. campestris, B. oleracea var. capitata, B. oleracea var. acephala, B. napus, B. napus var. naprobrassica, and B. rapa var. rapa. To the best of our knowledge, this is the first record of E. cruciferarum on B. campestris var. pekinensis, B. carinata, E. sativa, and E. vesicaria in Australia and on B. rapa and B. oleracea var. capitata in Western Australia. Powdery mildew epidemics on other brassicas in Western Australia are generally sporadic and it remains to be seen what the impact of this disease will be on these new host species. References: (1) P. Kaur et al. Plant Dis. 92:650, 2008. (2) S. T. Koike and G. S. Saenz. Plant Dis. 81:1093, 1997. (3) T. J. Purnell and A. Sivanesan. No. 251 in IMI Descriptions of Fungi and Bacteria, 1970. (4) R. G. Shivas. J. Royal Soc. West. Aust. 72:1, 1989.

First Report of Rice Blast (Magnaporthe oryzae) on Rice (Oryza sativa) in Western Australia.

Commercial rice crops (Oryza sativa L.) have been recently reintroduced to the Ord River Irrigation Area in northern Western Australia. In early August 2011, unusual leaf spot symptoms were observed by a local rice grower on rice cultivar Quest. A leaf spot symptom initially appeared as grey-green and/or water soaked with a darker green border and then expanded rapidly to several centimeters in length and became light tan in color with a distinct necrotic border. Isolations from typical leaf lesions were made onto water agar, subcultured onto potato dextrose agar, and maintained at 20°C. A representative culture was lodged in the Western Australian Culture Collection Herbarium, Department of Agriculture and Food Western Australia (WAC 13466) and as a herbarium specimen in the Plant Pathology Herbarium, Plant Biosecurity Science (BRIP 54721). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 (4). The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Magnaporthe oryzae B.C. Couch, the causal agent of rice blast, the most important fungal disease of rice worldwide (1). Additional sequencing with the primers Bt1a/Bt1b for the ß-tubulin gene, primers ACT-512F/ACT-783R for the actin gene, and primers CAL-228F/CAL-737R for the calmodulin gene showed 100% identity in each case with M. oryzae sequences in GenBank, confirming molecular similarity with other reports, e.g., (1). The relevant sequence information for a representative isolate has been lodged in GenBank (GenBank Accession Nos. JQ911754 for (ITS) 1 and 2; JX014265 for ß-tubulin; JX035809 for actin; and JX035808 for calmodulin). Isolates also showed morphological similarity with M. oryzae as described in other reports, e.g., (3). Spores of M. oryzae were produced on rice agar under "black light" at 21°C for 4 weeks. Under 30/28°C (day/night), 14/12 h (light/dark), rice cv. Quest was grown for 7 weeks, and inoculated by spraying a suspension 5 × 105 spores/ml onto foliage until runoff occurred. Inoculated plants were placed under a dark plastic covering for 72 h to maximize humidity levels around leaves, and subsequently maintained under >90% RH conditions. Typical symptoms of rice blast appeared within 14 days of inoculation and were as described above. Infection studies were successfully repeated and M. oryzae was readily reisolated from leaf lesions. No disease symptoms were observed nor was M. oryzae isolated from water-inoculated control rice plants. There have been previous records of rice blast in the Northern Territory (2) and Queensland, Australia (Australian Plant Pest Database), but this is the first report of M. oryzae in Western Australia, where it could potentially be destructive if conditions prove conducive. References: (1) B. C. Couch and L. M. Kohn. Mycologia 94:683, 2002; (2) J. B. Heaton. The Aust. J. Sci. 27:81, 1964; (3) C. V. Subramanian. IMI Descriptions of Fungi and Bacteria No 169, Pyricularia oryzae, 1968; (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, New York, 1990.

First Report of Sarocladium oryzae Causing Sheath Rot on Rice (Oryza sativa) in Western Australia.

Rice (Oryza sativa L.) has been grown in the Ord River Irrigation Area (ORIA) in northern Western Australia since 1960. In 2011, a sheath rot of rice was observed in the ORIA. Symptoms were variable, appearing as either (i) oblong pale to dark brown lesions up to 3 cm length, (ii) lesions with pale grey/brown centers and with dark brown margins, or (iii) diffuse dark or reddish brown streaks along the sheath. Lesions enlarged and coalesced, often covering the majority of the leaf sheath, disrupting panicle emergence. Isolations from small pieces of infested tissues from plants showing sheath rot symptoms were made onto water agar, subcultured onto potato dextrose agar, cultures maintained at 20°C, and a representative culture lodged both in the Western Australian Culture Collection maintained at the Department of Agriculture and Food Western Australia (as WAC 13481) and in the culture collection located at the DAFF Plant Pathology Herbarium (as BRIP 54763). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 according to the published protocol (4). The DNA PCR products from a single isolate were sequenced and BLAST analyses used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Sarocladium oryzae (Sawada) W. Gams & D. Hawksworth. Isolates showed morphological (e.g., conidiophore and conidia characteristics) (2) and molecular (1) similarities with S. oryzae as described in other reports. The relevant sequence information for a representative isolate was lodged in GenBank (GenBank Accession No. JQ965668). Spores of S. oryzae were produced on rice agar under "black light" at 22°C to induce sporulation over 4 weeks. Under conditions of 30/28°C (day/night), 14/12 h (light/dark), rice cv. Quest, grown for 11 weeks until plants reached the tillering stage, was inoculated by spraying a suspension 5 × 107 spores/ml of the same single isolate onto foliage until runoff occurred. Inoculated plants were placed under a dark plastic cover for 72 h to maximize humidity levels around leaves and subsequently maintained under >90% relative humidity conditions. Symptoms of sheath rot as described in (i) and (ii) above appeared by 14 days after inoculation, with lesions up to 23 cm long by 15 days post-inoculation. Severe disease prevented young panicles from emerging. Infection studies were successfully repeated and S. oryzae was reisolated from leaf lesions 1 week after lesion appearance. No disease was observed on water-inoculated control rice plants. There have been records of S. oryzae on rice in New South Wales in the early 1980s (3) and in 2006 to 2007 (Australian Plant Pest Database), but to our knowledge, this is the first report of this pathogen in Western Australia. References: (1) N. Ayyadurai et al. Cur. Microbiol. Mycologia 50:319, 2005. (2) B. L. K. Brady. No. 673 in: IMI Descriptions of Fungi and Bacteria, 1980. (3) D. Phillips et al. FAO Plant Prot. Bull. 40:4, 1992. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

First Report of Phoma herbarum on Tedera (Bituminaria bituminosa var. albomarginata) in Australia.

Tedera (Bituminaria bituminosa (L.) C.H. Stirton var. albomarginata) has been successfully established across the mixed-farming (wheat-sheep) region of Western Australia because this species has remarkable drought tolerance and can survive the dry-summer period with strong retention of green leaf. A leaf spot symptom involving pale brown lesions with distinct dark brown margins had been observed in genetic evaluation plots of tedera at Medina and Mount Barker, Western Australia, and a Phoma sp. was isolated. Single-spore isolations of a typical Phoma sp. isolate were made onto potato dextrose agar and maintained at 20°C, and a representative culture has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13435). Amplification of the internal transcribed spacer (ITS) 1 and ITS2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 according to published protocol (3). The DNA PCR products were sequenced and BLAST analyses was used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Phoma herbarum. Isolates also showed morphological (e.g., 1) and molecular (e.g., 2) similarities with P. herbarum as described in other reports. The relevant sequence information for a representative isolate has been lodged in GenBank (Accession No. JQ282910). A conidial suspension of 107 conidia ml-1 from a single-spore culture was spray inoculated onto foliage of 6-week-old tedera plants maintained under >90% relative humidity conditions for 72-h postinoculation. Symptoms evident by 10 days postinoculation consisted of pale brown lesions, mostly 1.5 to 4 mm in diameter, which developed a distinct, dark brown margin. Occasional lesions also showed a distinct chlorotic halo extending 1 to 1.5 mm outside the boundary of the lesion. Infection studies were successfully repeated twice and P. herbarum was readily reisolated from infected foliage. No disease was observed on and no P. herbarum were isolated from water-inoculated control plants. Except for a recent published report of P. herbarum on field pea (Pisum sativum L.) (2), this pathogen has only been noted in the Australian Plant Pest Database as occurring on lucerne (Medicago sativa L.) and soybean (Glycine max (L.) Merr.) in Western Australia in 1985 and on a Protea sp. in 1991. To our knowledge, this is the first published report of P. herbarum as a pathogen on tedera in Australia or elsewhere. That P. herbarum occurs on other hosts in Australia and has a wide host range elsewhere together suggest its potential to be a pathogen on a wider range of host genera and species. References: (1) G. L. Kinsey. No. 1501 in: IMI Descriptions of Fungi and Bacteria. 2002. (2) Y. P. Li et al. Plant Dis. 95:1590, 2011. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

First Report of Black Spot Caused by Boeremia exigua var. exigua on Field Pea in Australia.

Black spot is a major disease of field pea (Pisum sativum L.) production across southern Australia. Known causal agents in Australia include one or more of Mycosphaerella pinodes (Berk. & Bloxam) Vestergr., Phoma medicaginis var. pinodella (L.K. Jones), Ascochyta pisi Lib., or P. koolunga (Davidson, Hartley, Priest, Krysinska-Kaczmarek, Herdina, McKay & Scott) (2), but other pathogens may also be associated with black spot symptoms. Black spot generally occurs on most plants and in most pea fields in Western Australia (W.A.), and during earlier winter/spring surveys of blackspot pathogens, some isolates were tentatively allocated to P. medicaginis var. pinodella despite different cultural characteristics on potato dextrose agar (PDA). Recently, single-spore isolations of a single culture each from an infested pea crop at Medina, Moora, and Mt. Barker in W.A. were made onto PDA. A PCR-based assay with TW81 and AB28 primers was used to amplify from the ITS-5.8S rDNA region. Purified DNA products were sequenced for the three isolates and then BLASTn was used to compare sequences with those in GenBank. Our sequences (GenBank Accession Nos. JN37743, JN377439, and JN377438) had 100% nucleotide identity with P. exigua Desm. var. exigua accessions (GI13385450, GI169894028, and GI189163921), an earlier synonym of what is now known as Boeremia exigua var. exigua ([Desm.] Aveskamp, Gruyter & Verkley) (1). Davidson et al. (2) used the same primers to identify P. koolunga, but none of our isolates were P. koolunga. A suspension of 107 conidia ml-1 of each representative isolate was inoculated onto foliage of 15-day-old field pea cv. Dundale plants and maintained at >90% relative humidity for 72 h postinoculation. Control plants inoculated with just water remained symptomless. Brown lesions were evident by 8 to 10 days postinoculation and mostly 1 to 3 mm in diameter. B. exigua var. exigua was readily reisolated from infected leaves. Isolates have been lodged in the W.A. Culture Collection Herbarium maintained at the Department of Agriculture and Food W.A. (Accession Nos. WAC13500, WAC13502, and WAC13501 from Medina, Moora, and Mt. Barker, respectively). Outside Australia, its synonym P. exigua var. exigua is a known pathogen of field pea (4), other legumes including common bean (Phaseolus vulgaris L.) (4) and soybean (Glycine max [L.] Merr.) (3), and is known to produce phytotoxic cytochalasins. In eastern Australia, P. exigua var. exigua has been reported on common bean (1930s and 1950s), phasey bean (Macroptilium lathyroides [L.] Urb.) and siratro (M. atropurpureum (DC.) Urb.) (1950s and 1960s), mung bean (Vigna radiata [L.] Wilczek.) (1960s), ramie (Boehmeria nivea [L.] Gaudich.) (1939), potato (Solanum tuberosum L.) (1980s), and pyrethrum (Tanacetum cinerariifolium [Trevir.] Schultz Bip.) (2004 and 2007) (Australian Plant Pest Database). To our knowledge, this the first report of B. exigua var. exigua on field pea in Australia, and because of its potential to be a significant pathogen on field pea, warrants further evaluation. References: (1) M. M. Aveskamp et al. Stud. Mycol. 65:1, 2010. (2) J. A. Davidson et al. Mycologia 101:120, 2009. (3) L. Irinyi et al. Mycol. Res. 113:249, 2009. (4) J. Marcinkowska. Biul. Inst. Hod. Aklim. Rosl. 190:169, 1994.

Comparison of two total cellular fatty acid analysis protocols to differentiate Rhizoctonia oryzae and R. oryzae-sativae.

Two fatty acid analysis protocols (the MIDI and a modified MIDI method) were investigated for their utility to characterize and differentiate Rhizoctonia oryzae and R. oryzae-sativae isolates from four countries. Only the modified MIDI method permitted a clear differentiation between the two species, regardless of the isolates' country of origin. The modified MIDI method gave the most consistent and reproducible fatty acid results. The failure of the MIDI method to differentiate between R. oryzae and R. oryzae-sativae isolates suggests that the 30 minutes saponification step is insufficient to completely break the cell wall of these two species. This study demonstrated that fatty acid profiles, obtained by the modified MIDI protocol, have the potential as a diagnostic tool for both R. oryzae and R. oryzae-sativae.