Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 35
Filtrar
1.
Int J Mol Sci ; 24(5)2023 Feb 28.
Artigo em Inglês | MEDLINE | ID: mdl-36902101

RESUMO

Grapes are widely cultivated around the world and their quality has distinct regional characteristics. In this study, the qualitative characteristics of the 'Cabernet Sauvignon' grape variety in seven regions, from half-véraison to maturity, were analyzed comprehensively at physiological and transcriptional levels. The results indicated that the quality traits of 'Cabernet Sauvignon' grapes in different regions were significantly different with obvious regionality. Total phenols, anthocyanins, and titratable acids were the main factors of the regionality of berry quality, which were very sensitive to changes in the environment. It should be noted that the changes in titrating acids and total anthocyanin of berries vary greatly from half-véraison to maturity between regions. Moreover, the transcriptional analysis showed that the co-expressed genes between regions characterized the core transcriptome of berry development, while the unique genes of each region reflected the regionality of berries. The differentially expressed genes (DEGs) between half-véraison and maturity can be used to demonstrate that the environment of the regions could promote or inhibit gene expression. The functional enrichment suggested that these DEGs help to understand the interpretation of the plasticity of the quality composition of grapes according to the environment. Taken together, the information generated by this study could contribute to the development of viticultural practices aimed at making better use of native varieties for the development of wines with regional characteristics.


Assuntos
Vitis , Vinho , Vitis/genética , Antocianinas/metabolismo , Transcriptoma , Frutas/metabolismo
2.
J Sci Food Agric ; 102(3): 1124-1136, 2022 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-34329497

RESUMO

BACKGROUND: Although the grape berries are deliberated as a non-climacteric fruit, ethylene seems to be involved in grape berry ripening. However, the precise role of ethylene in regulating the ripening of non-climacteric fruits is poorly understood. RESULTS: Exogenous ethephon (ETH) can stimulate the concentration of internal ethylene and accelerate the accumulation of anthocyanins in berries of 'Fujiminori', including malvidin-, delphinidin-, and petunidin-derivatives (3',4',5'-trihydroxylated anthocyanins) and cyanidin-derivatives (3',4'-dihydroxylated anthocyanins). The content of 3',4',5'-trihydroxylated anthocyanins was extremely higher than 3',4'-dihydroxylated anthocyanins, and ethylene did not affect the composition of anthocyanins in grape. Furthermore, we observed the expression of anthocyanin structural and regulatory genes as well as ethylene biosynthesis and response genes in response to ETH treatment. The anthocyanins accumulation is significantly associated with increased expression of anthocyanin structural (VvPAL, Vv4CH, VvCHS, VvCHI, VvF3H, and VvUFGT) and regulatory genes (VvMYBA1, VvMYBA2, and VvMYBA3), which persisted over the 12 days. In addition, exogenous ETH affected the endogenous ethylene biosynthesis (VvACO2 and VvACO4) and the downstream ethylene regulatory network (VvERS1, VvETR2, VvCTR1, and VvERF005). CONCLUSIONS: These findings bring new insights into the physiological and molecular function of ethylene during berry development and ripening in grapes. © 2021 Society of Chemical Industry.


Assuntos
Antocianinas/metabolismo , Etilenos/farmacologia , Frutas/crescimento & desenvolvimento , Reguladores de Crescimento de Plantas/farmacologia , Vitis/efeitos dos fármacos , Antocianinas/química , Frutas/química , Frutas/efeitos dos fármacos , Frutas/metabolismo , Vitis/química , Vitis/crescimento & desenvolvimento , Vitis/metabolismo
3.
Plant Biotechnol J ; 19(6): 1216-1239, 2021 06.
Artigo em Inglês | MEDLINE | ID: mdl-33440072

RESUMO

In grape, MYBA1 and MYBA2 at the colour locus are the major genetic determinants of grape skin colour, and the mutation of two functional genes (VvMYBA1 and VvMYBA2) from these loci leads to white skin colour. This study aimed to elucidate the regulation of grape berry coloration by isolating and characterizing VvMYBA2w and VvMYBA2r alleles. The overexpression of VvMYBA2r up-regulated the expression of anthocyanin biosynthetic genes and resulted in higher anthocyanin accumulation in transgenic tobacco than wild-type (WT) plants, especially in flowers. However, the ectopic expression of VvMYBA2w inactivated the expression of anthocyanin biosynthetic genes and could not cause obvious phenotypic modulation in transgenic tobacco. Unlike in VvMYBA2r, CA dinucleotide deletion shortened the C-terminal transactivation region and disrupted the transcriptional activation activity of VvMYBA2w. The results indicated that VvMYBA2r positively regulated anthocyanin biosynthesis by forming the VvMYBA2r-VvMYCA1-VvWDR1 complex, and VvWDR1 enhanced anthocyanin accumulation by interacting with the VvMYBA2r-VvMYCA1 complex; however, R44 L substitution abolished the interaction of VvMYBA2w with VvMYCA1. Meanwhile, both R44 L substitution and CA dinucleotide deletion seriously affected the efficacy of VvMYBA2w to regulate anthocyanin biosynthesis, and the two non-synonymous mutations were additive in their effects. Investigation of the colour density and MYB haplotypes of 213 grape germplasms revealed that dark-skinned varieties tended to contain HapC-N and HapE2, whereas red-skinned varieties contained high frequencies of HapB and HapC-Rs. Regarding ploidy, the higher the number of functional alleles present in a variety, the darker was the skin colour. In summary, this study provides insight into the roles of VvMYBA2r and VvMYBA2w alleles and lays the foundation for the molecular breeding of grape varieties with different skin colour.


Assuntos
Vitis , Alelos , Antocianinas , Embaralhamento de DNA , Frutas/genética , Frutas/metabolismo , Regulação da Expressão Gênica de Plantas/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Pigmentação da Pele , Vitis/genética , Vitis/metabolismo
4.
BMC Genomics ; 21(1): 444, 2020 Jun 29.
Artigo em Inglês | MEDLINE | ID: mdl-32600251

RESUMO

BACKGROUND: The class III peroxidases (PODs) are involved in a broad range of physiological activities, such as the formation of lignin, cell wall components, defense against pathogenicity or herbivore, and abiotic stress tolerance. The POD family members have been well-studied and characterized by bioinformatics analysis in several plant species, but no previous genome-wide analysis has been carried out of this gene family in grapevine to date. RESULTS: We comprehensively identified 47 PODs in the grapevine genome and are further classified into 7 subgroups based on their phylogenetic analysis. Results of motif composition and gene structure organization analysis revealed that PODs in the same subgroup shared similar conjunction while the protein sequences were highly conserved. Intriguingly, the integrated analysis of chromosomal mapping and gene collinearity analysis proposed that both dispersed and tandem duplication events contributed to the expansion of PODs in grapevine. Also, the gene duplication analysis suggested that most of the genes (20) were dispersed followed by (15) tandem, (9) segmental or whole-genome duplication, and (3) proximal, respectively. The evolutionary analysis of PODs, such as Ka/Ks ratio of the 15 duplicated gene pairs were less than 1.00, indicated that most of the gene pairs exhibiting purifying selection and 7 pairs underwent positive selection with value greater than 1.00. The Gene Ontology Enrichment (GO), Kyoto Encyclopedia of Genes Genomics (KEGG) analysis, and cis-elements prediction also revealed the positive functions of PODs in plant growth and developmental activities, and response to stress stimuli. Further, based on the publically available RNA-sequence data, the expression patterns of PODs in tissue-specific response during several developmental stages revealed diverged expression patterns. Subsequently, 30 genes were selected for RT-PCR validation in response to (NaCl, drought, and ABA), which showed their critical role in grapevine. CONCLUSIONS: In conclusion, we predict that these results will lead to novel insights regarding genetic improvement of grapevine.


Assuntos
Perfilação da Expressão Gênica/métodos , Peroxidases/genética , Vitis/crescimento & desenvolvimento , Sequenciamento Completo do Genoma/métodos , Mapeamento Cromossômico , Evolução Molecular , Duplicação Gênica , Regulação da Expressão Gênica no Desenvolvimento , Regulação da Expressão Gênica de Plantas , Família Multigênica , Proteínas de Plantas/genética , Análise de Sequência de RNA , Estresse Fisiológico , Vitis/genética
5.
BMC Plant Biol ; 20(1): 409, 2020 Sep 03.
Artigo em Inglês | MEDLINE | ID: mdl-32883203

RESUMO

BACKGROUND: Grapevine (Vitis vinifera L.), which has important nutritional values and health benefits, is one of the most economically important fruit crops cultivated worldwide. Several studies showed a large number of microRNAs (VvmiRNAs) involved in the modulation of grape growth and development, and many VvmiRNA families have multiple members. However, the way by which various members from the same miRNA family work is unclear, particularly in grapes. RESULTS: In this study, an important conserved VvmiR172 family (VvmiR172s) and their targets were set as a good example for elucidating the interaction degree, mechanism, and spatio-temporal traits of diverse members from the same miRNA family. miR-RACE and Stem-loop RT-PCR were used to identify the spatio-temporal expressions of various members of VvmiR172s; together with RLM-RACE, PPM-RACE, Western blot, transgenic technologies, their interaction degree, and regulation mechanism were further validated. The expression of VvmiR172c was significantly higher than that of VvmiR172a, b, and d and showed a positive correlation with the abundance of VvAP2 cleavage products. These findings indicated that VvmiR172c might be one of the main action factors of the VvmiR172 family in flower development. The ability of VvmiR172c to cleave target genes differed due to divergence in complementary degree with VvAP2 and expression levels of various members. In VvmiR172 transgenic lines, we observed that 35S::VvmiR172c resulted in the earliest and abundant flowering, indicating the strong function of VvmiR172c. In contrast, the non-significant phenotypic changes were detected in the VvAP2 transgenic lines. The qRT-PCR and Western bolt results demonstrated that VvmiR172c plays a major role in targeting VvAP2. CONCLUSIONS: VvmiR172 up-regulated the expression of NtFT and decreased the expression of NtFLC. The up/down regulation of VvmiR172c was the most pronounced. The functions of four VvmiR172 members in grape differed, and miR172c had the strongest regulation on AP2.


Assuntos
Flores/crescimento & desenvolvimento , Regulação da Expressão Gênica de Plantas , MicroRNAs/genética , RNA de Plantas/genética , Vitis/genética , Flores/genética , MicroRNAs/metabolismo , RNA de Plantas/metabolismo , Vitis/crescimento & desenvolvimento , Vitis/metabolismo
6.
BMC Plant Biol ; 20(1): 72, 2020 Feb 13.
Artigo em Inglês | MEDLINE | ID: mdl-32054455

RESUMO

BACKGROUND: The B-BOX (BBX) proteins are the class of zinc-finger transcription factors and can regulate plant growth, development, and endure stress response. In plants, the BBX gene family has been identified in Arabidopsis, rice, and tomato. However, no systematic analysis of BBX genes has been undertaken in grapevine. RESULTS: In this study, 24 grapevine BBX (VvBBX) genes were identified by comprehensive bioinformatics analysis. Subsequently, the chromosomal localizations, gene structure, conserved domains, phylogenetic relationship, gene duplication, and cis-acting elements were analyzed. Phylogenetic analysis divided VvBBX genes into five subgroups. Numerous cis-acting elements related to plant development, hormone and/or stress responses were identified in the promoter of the VvBBX genes. The tissue-specific expressional dynamics of VvBBX genes demonstrated that VvBBXs might play important role in plant growth and development. The transcript analysis from transcriptome data and qRT-PCR inferred that 11 VvBBX genes were down-regulated in different fruit developmental stages, while three VvBBX genes were up-regulated. It is also speculated that VvBBX genes might be involved in multiple hormone signaling (ABA, ethylene, GA3, and CPPU) as transcriptional regulators to modulate berry development and ripening. VvBBX22 seems to be responsive to multiple hormone signaling, including ABA, ethylene GA3, and CPPU. Some VvBBX genes were strongly induced by Cu, salt, waterlogging, and drought stress treatment. Furthermore, the expression of VvBBX22 proposed its involvement in multiple functions, including leaf senescence, abiotic stress responses, fruit development, and hormone response. CONCLUSIONS: Our results will provide the reference for functional studies of BBX gene family, and highlight its functions in grapevine berry development and ripening. The results will help us to better understand the complexity of the BBX gene family in abiotic stress tolerance and provide valuable information for future functional characterization of specific genes in grapevine.


Assuntos
Frutas/genética , Regulação da Expressão Gênica de Plantas , Genoma de Planta , Proteínas de Plantas/genética , Fatores de Transcrição/genética , Vitis/genética , Frutas/crescimento & desenvolvimento , Família Multigênica , Proteínas de Plantas/metabolismo , Fatores de Transcrição/metabolismo , Vitis/crescimento & desenvolvimento
7.
BMC Genomics ; 20(1): 786, 2019 Oct 29.
Artigo em Inglês | MEDLINE | ID: mdl-31664916

RESUMO

BACKGROUND: The plant-specific TCP transcription factors play different functions in multiple processes of plant growth and development. TCP family genes have been identified in several plant species, but no comprehensive analysis of the TCP family in grapevine has been undertaken to date, especially their roles in fruit development. RESULTS: A total of 18 non-redundant grapevine TCP (VvTCP) genes distributing on 11 chromosomes were identified. Phylogenetic and structural analysis showed that VvTCP genes were divided into two main classes - class I and class II. The Class II genes were further classified into two subclasses, the CIN subclass and the CYC/TB1 subclass. Segmental duplication was a predominant duplication event which caused the expansion of VvTCP genes. The cis-acting elements analysis and tissue-specific expression patterns of VvTCP genes demonstrated that these VvTCP genes might play important roles in plant growth and development. Expression patterns of VvTCP genes during fruit development and ripening were analyzed by RNA-Seq and qRT-PCR. Among them, 11 VvTCP genes were down-regulated during different fruit developmental stages, while only one VvTCP genes were up-regulated, suggesting that most VvTCP genes were probably related to early development in grapevine fruit. Futhermore, the expression of most VvTCP genes can be inhibited by drought and waterlogging stresses. CONCLUSIONS: Our study establishes the first genome-wide analysis of the grapevine TCP gene family and provides valuable information for understanding the classification and functions of the TCP genes in grapevine.


Assuntos
Proteínas de Plantas/genética , Fatores de Transcrição/genética , Vitis/genética , Motivos de Aminoácidos , Frutas/genética , Frutas/crescimento & desenvolvimento , Frutas/metabolismo , Genoma de Planta , Família Multigênica , Filogenia , Proteínas de Plantas/química , Proteínas de Plantas/classificação , Proteínas de Plantas/metabolismo , Regiões Promotoras Genéticas , Estresse Fisiológico/genética , Sintenia , Fatores de Transcrição/química , Fatores de Transcrição/classificação , Fatores de Transcrição/metabolismo , Transcriptoma , Vitis/crescimento & desenvolvimento , Vitis/metabolismo
8.
Funct Integr Genomics ; 19(6): 933-952, 2019 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-31172301

RESUMO

miRNA156 family members (miR156s) participate in regulating the transition of plant vegetative and reproductive growth, flower development, and formation of berry skin color by negatively modulating their target gene SPLs. However, the evolution and functional diversification of miR156s in plants remain elusive. Phylogenetic analysis on 310 miR156s from 51 plant species on miRBase 21.0 showed that only miR156a could be conserved in the 51 plant species, but their sequences exhibited variation; another set of miR156s, such as miR156m/n/o/p/q/r/s/t/u/v/w/x/y/z, was identified only in certain special plant species (Glycine max and Malus); also, all base variations in the sequences of 310 miR156s occurred within one miR156 seed sequence, "TGACAGAAGAGAGTGAGCAC," and the changed base sites were mainly located at the 11th and 14th bases from the 5' end of the miR156 seed sequence, in which some base variations of miR156s resulted in a difference in miR156 targeting modes; by contrast, miR156 precursor sequences are highly divergent across diverse species. Similarly, cis-regulatory motifs on the promoter sequence of MIR156s in various plants also exhibited significant discrepancy. The intragenic MIR156 genes overlapped their target SBP genes, thereby suggesting that some microRNAs (miRNAs) originate from duplication of target genes. These traits might be the reasons of the conservation and diversification of miR156 gene family. This study identified the conserved seed sequence "TGACAGAAGAGAGTGAGCAC," and the sequence variation characterization, of miR156 family evolution, also investigated the varied traits of their promoters, precursors, and mature sequences in sequence evolutions and found some miRNAs might originate from duplication of target genes. Our findings will contribute to our understanding of the functional diversification of miRNAs and the interactions of miRNA/target pairs based on the evolutionary history of miRNA genes.


Assuntos
Sequência Conservada , MicroRNAs/genética , Filogenia , Plantas/genética , Evolução Molecular , Plantas/classificação , Polimorfismo Genético
9.
Funct Integr Genomics ; 17(6): 697-710, 2017 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-28674744

RESUMO

MicroRNAs (miRNAs) are endogenous small RNAs of -21 nucleotides that play an important role in diverse plant physiological processes at the post-transcriptional level by directing mRNA cleavage or translational inhibition. Previous studies have indicated that down-regulation of miR398 in response to oxidative stress allows up-regulation of the two target genes, cytosolic CSD1 and chloroplastic CSD2 (copper/zinc superoxide dismutase), resulting in protecting the plants to tolerate oxidative stress. In this study, we provide evidence that grapevine miR398 (Vv-miR398), by regulating the expression of its target genes, VvCSD1 and VvCSD2, mediates responses of grapevine to copper (Cu) stress which have been magnified due to increase in Cu-containing pesticide application. The expression of Vv-miR398 was inhibited by different concentrations of Cu stress; on the other hand, there was a steady increase in the activity of VvCSD1 and VvCSD2 genes. The function of VvCSD1 and VvCSD2 under Cu stress was thoroughly examined by overexpressing the use of the VvCSD1 and VvCSD2 in transgenic tobacco (Nicotiana tabacum). We found that both the overexpressed transgenic lines had lower Cu sensitivity and higher Cu tolerance compared with the wild type. In addition, lower levels of ROS and higher levels of SOD activities were accumulated in the transgenic lines in comparison with the wild type under the higher Cu conditions. Furthermore, these transgenic tobacco lines also recorded a higher UV and salt tolerance than the WT plants. These results suggested that overexpressing the VvCSDs will enhance the ROS-scavenging systems and protect the plant against more oxidative damage. Also, more investigations in this line are needed that would provide significant improvements in our understanding the resistance of fruit crops to environmental stress.


Assuntos
MicroRNAs/genética , Estresse Oxidativo , Proteínas de Plantas/genética , Superóxido Dismutase/genética , Vitis/genética , Adaptação Fisiológica , Cobre/toxicidade , Regulação da Expressão Gênica de Plantas , MicroRNAs/metabolismo , Praguicidas/toxicidade , Proteínas de Plantas/metabolismo , Superóxido Dismutase/metabolismo , Nicotiana/genética , Transgenes , Vitis/efeitos dos fármacos , Vitis/metabolismo
10.
Funct Integr Genomics ; 16(6): 595-617, 2016 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-27562678

RESUMO

A 2000-bp 5'-flanking region of VvPAL-like was isolated from 'Summer Black' grapevine by PCR amplification, named pVvPAL-like. To gain a better understanding of the expression and regulatory mechanism of VvPAL-like, a chimeric expression unit consisting of the ß-glucuronidase (GUS) reporter gene under the control of a 2000-bp fragment of the VvPAL-like promoter was transformed into tobacco via Agrobacterium tumefaciens. Histochemical staining showed that the full-length promoter directs efficient expression of the reporter gene in cotyledons and hypocotyls, stigma, style, anthers, pollen, ovary, trichomes, and vascular bundles of transgenic plants. A series of 5' progressive deletions of the promoter revealed the presence of a negative regulatory region (-424 to -292) in the VvPAL-like promoter. Exposure of the transgenic tobacco plants to various abiotic stresses demonstrated that the full-length construct could be induced by light, copper (Cu), abscisic acid (ABA), indole-3-acetic (IAA), methyl jasmonate (MeJA) (N-1-naphthylphthalamic acid), ethylene, and drought. Furthermore, the ethylene-responsive region was found to be located in the -1461/-930 fragment, while the element(s) for the MeJA-responsive expression may be present in the -424/-292 region in the VvPAL-like promoter. These findings will help us to better understand the molecular mechanisms by which VvPAL-like participates in biosynthesis of flavonoids and stress responses.


Assuntos
Nicotiana/genética , Plantas Geneticamente Modificadas/genética , Regiões Promotoras Genéticas/efeitos dos fármacos , Transcriptoma/genética , Vitis/genética , Ácido Abscísico/farmacologia , Acetatos/farmacologia , Agrobacterium tumefaciens/genética , Cobre/farmacologia , Ciclopentanos/farmacologia , Secas , Etilenos/farmacologia , Regulação da Expressão Gênica de Plantas/efeitos dos fármacos , Regulação da Expressão Gênica de Plantas/efeitos da radiação , Genes Reporter , Glucuronidase/genética , Luz , Oxilipinas/farmacologia , Ftalimidas/farmacologia
11.
Funct Integr Genomics ; 15(6): 673-84, 2015 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-26054906

RESUMO

With more copper and copper-containing compounds used as bactericides and fungicides in viticulture, copper homeostasis in grapevine (Vitis) has become one of the serious environmental crises with great risk. To better understand the regulation of Cu homeostasis in grapevine, grapevine seedlings cultured in vitro with different levels of Cu were utilized to investigate the tolerance mechanisms of grapevine responding to copper availability at physiological and molecular levels. The results indicated that Cu contents in roots and leaves arose with increasing levels of Cu application. With copper concentration increasing, malondialdehyde (MDA) content increased in roots and leaves and the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) increased to protect the plant itself from damage. The expression patterns of 19 genes, encoding transporters, chaperones, and P-type ATPases involved in copper homeostasis in root and leaf of grapevine seedling under various levels of Cu(2+) were further analyzed. The expression patterns indicated that CTr1, CTr2, and CTr8 transporters were significantly upregulated in response both to Cu excess and deficiency. ZIP2 was downregulated in response to Cu excess and upregulated under Cu-deficient conditions, while ZIP4 had an opposite expression pattern under similar conditions. The expression of chaperones and P-type ATPases in response to Cu availability in grapevine were also briefly studied.


Assuntos
Proteínas de Transporte de Cátions/metabolismo , Cobre/metabolismo , Homeostase , Chaperonas Moleculares/metabolismo , Proteínas de Plantas/metabolismo , Vitis/genética , Sequência de Aminoácidos , Catalase/metabolismo , Proteínas de Transporte de Cátions/química , Proteínas de Transporte de Cátions/genética , Chaperonas Moleculares/química , Chaperonas Moleculares/genética , Dados de Sequência Molecular , Peroxidase/metabolismo , Folhas de Planta/metabolismo , Proteínas de Plantas/química , Proteínas de Plantas/genética , Raízes de Plantas/metabolismo , Superóxido Dismutase/metabolismo , Vitis/metabolismo
12.
BMC Genomics ; 15: 111, 2014 Feb 08.
Artigo em Inglês | MEDLINE | ID: mdl-24507455

RESUMO

BACKGROUND: MicroRNAs (miRNAs), involving in various biological and metabolic processes, have been discovered and analyzed in quite a number of plants species, such as Arabidopsis, rice and other plants. However, there have been few reports about grapevine miRNAs in response to gibberelline (GA3). RESULTS: Solexa technology was used to sequence small RNA libraries constructed from grapevine berries treated with GA3 and the control. A total of 122 known and 90 novel grapevine miRNAs (Vvi-miRNAs) were identified. Totally, 137 ones were found to be clearly responsive to GA3, among which 58 were down-regulated, 51 were up-regulated, 21 could only be detected in the control, and seven were only detected in the treatment. Subsequently, we found that 28 of them were differentially regulated by GA3, with 12 conserved and 16 novel Vvi-miRNAs, based on the analysis of qRT-PCR essays. There existed some consistency in expression levels of GA3-responsive Vvi-miRNAs between high throughput sequencing and qRT-PCR essays. In addition, 117 target genes for 29 novel miRNAs were predicted. CONCLUSIONS: Deep sequencing of short RNAs from grapevine berries treated with GA3 and the control identified 137 GA3-responsive miRNAs, among which 28 exhibited different expression profiles of response to GA3 in the diverse developmental stages of grapevine berries. These identified Vvi-miRNAs might be involved in the grapevine berry development and response to environmental stresses.


Assuntos
MicroRNAs/metabolismo , Vitis/genética , Sequência de Bases , Sequência Conservada , Regulação da Expressão Gênica de Plantas/efeitos dos fármacos , Biblioteca Gênica , Giberelinas/farmacologia , Sequenciamento de Nucleotídeos em Larga Escala , MicroRNAs/química , RNA de Plantas/química , RNA de Plantas/metabolismo , Análise de Sequência de RNA , Vitis/crescimento & desenvolvimento
13.
Plant Mol Biol ; 84(3): 269-85, 2014 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-24081692

RESUMO

MicroRNAs (miRNAs) play critical regulatory roles mainly through cleaving their target mRNAs or repressing gene translation during plant development. Grapevines are among the most economically important fruit crops with available whole genome sequences. Studies on grapevine miRNAs (Vv-miRNAs) are also widely available. However, studies on the regulation mode of Vv-miRNAs on their target mRNAs during grapevine development have not been studied well, especially at the transcriptome-wide level. Here, six small RNA and mRNA libraries from various grapevine tissues were constructed for Illumina and Degradome sequencing. Subsequently, we systematically analyzed the spatiotemporal variations in the regulation of the target genes of regulation of Vv-miRNAs. In total, 242 known and 132 novel Vv-miRNAs and 193 target mRNAs were identified, including 103 target mRNAs for known and 90 target mRNAs for novel miRNAs, were validated in one or more of the tissues examined. More than 50 % of novel miRNAs were expressed exclusively in the flowers and berries, where they cleaved their target genes in a tissue-specific manner, especially, the breadth of their cleavage sites in flower tissues. Moreover, six novel miRNAs in berries responded to exogenous gibberellin and/or ethylene under a quantitative real time RT-PCR analysis, which confirmed their regulatory functions during berry development. Up to 93.6 % of the known miRNAs were highly conserved in various tissues, where their expression levels exhibited dynamic variations during grapevine development. Significantly, some Vv-miRNA families had one key member that acted as the main regulator of their target genes during grapevine development.


Assuntos
Regulação da Expressão Gênica de Plantas , Genes de Plantas , Transcriptoma , Vitis/genética , MicroRNAs/genética , Reação em Cadeia da Polimerase em Tempo Real , Vitis/crescimento & desenvolvimento
14.
Mol Biol Rep ; 41(5): 2937-49, 2014 May.
Artigo em Inglês | MEDLINE | ID: mdl-24458826

RESUMO

In this study, 10 grapevine (Vitis vinifera) SR/CAMTA (Signal Responsive/Calmodulin-binding Transcription Activators) gene models were identified from three grapevine genome protein datasets. They belong to four gene groups: VvCAMTA1, VvCAMTA3, VvCAMTA4 and VvCAMTA5, which were located on chromosome 5, 7_random, 1 and 5, respectively. Alternative splicing could explain the multiple gene models in one gene group. Subcellular localization using the WoLF tool showed that most of the VvCAMTAs were located in the nucleus, except for VvCAMTA3.1, VvCAMTA3.2 and VvCAMTA5.2, which were located in the chloroplast, chloroplast and cytosol, respectively. Subcellular localization using TargetP showed that most of the VvCAMTAs were not located in the chloroplast, mitochondrion and secretory pathway in cells. VvCAMTA1.1 and VvCAMTA1.2 were located in the mitochondria. The digital gene expression profile showed that VvCAMTAs play important roles in Ca2+ signal transduction. The gene expression patterns of VvCAMTAs were different; for example, VvCAMTA1 was expressed mainly in the bud, while VvCAMTA3 was expressed mainly in fruit and inflorescence, with low expression in the bud. The results of this study make a substantial contribution to our knowledge concerning genes, genome annotation, and cell signal transduction in grapevine.


Assuntos
Biologia Computacional , Proteínas de Plantas/genética , Fatores de Transcrição/genética , Vitis/genética , Mapeamento Cromossômico , Biologia Computacional/métodos , Bases de Dados de Ácidos Nucleicos , Perfilação da Expressão Gênica , Espaço Intracelular/metabolismo , Modelos Moleculares , Família Multigênica , Especificidade de Órgãos/genética , Filogenia , Proteínas de Plantas/química , Proteínas de Plantas/metabolismo , Conformação Proteica , Transporte Proteico , Fatores de Transcrição/química , Fatores de Transcrição/metabolismo , Vitis/classificação , Vitis/metabolismo
15.
Mol Biol Rep ; 40(6): 4015-31, 2013 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-23269629

RESUMO

In plant and animal species FK506-binding protein (FKBP) family genes are important conserved genes and it is defined as the receptors of FK506 and rapamycin, where they work as PPIase and protein folding chaperones. FKBP have been isolated from Arabidopsis thaliana, Oryza sativa, and Zea mays. In grape, twenty-three genes containing the FK506-binding domain (FKBP_C) were first time identified by HMMER and blast research, they were classified into three groups and 17 out of the 23 genes were located on 11 chromosomes (Chr1, 3, 5, 7, 8, 14, 15, 16, 17, 18, and 19). The predicted gene expression pattern and semi-quantitative RT-PCR results revealed that five VvFKBPs were expressed in all tissues, while seven VvFKBPs were expressed only in some of the tissues, and the remaining VvFKBPs were not expressed in leaf, stem, inflorescences, flowers, and a mixture of fruit tissues (small, medium and big-sized fruits). Most of the VvFKBPs in grapevine 'Summer Black' were similar to those predicted one in 'Pinot Noir' except for VvFKBP16-4 and VvFKBPa. VvFKBP12, FaFKBP12 and PpFKBP12 were cloned from 'Summer Black', 'Sweet Charlie' and 'Xiahui 6'. Protein structure analysis confirmed that homologous genes have some differences during the process of protein structure construction. In this study, we characterized and verified 23 FKBP family genes in grapevine (Vitis vinifera L.) as well as their sub-cellular and chromosome location. The successful cloning of CDS regions and protein structural analysis of VvFKBP12, FaFKBP12, and PpFKBP12 can provide useful information for further study.


Assuntos
Genes de Plantas/genética , Família Multigênica , Proteínas de Plantas/genética , Proteínas de Ligação a Tacrolimo/genética , Proteínas de Ligação a Tacrolimo/metabolismo , Vitis/genética , Sequência de Aminoácidos , Cromossomos de Plantas/genética , Sequência Conservada/genética , Etiquetas de Sequências Expressas , Fragaria/genética , Perfilação da Expressão Gênica , Regulação da Expressão Gênica de Plantas , Dados de Sequência Molecular , Filogenia , Proteínas de Plantas/química , Estrutura Terciária de Proteína , Prunus/genética , Reprodutibilidade dos Testes , Alinhamento de Sequência , Frações Subcelulares/metabolismo , Proteínas de Ligação a Tacrolimo/química
16.
Antioxidants (Basel) ; 12(2)2023 Feb 06.
Artigo em Inglês | MEDLINE | ID: mdl-36829953

RESUMO

Here, the polysaccharides from grape pomace, a by-product in the wine industry, were characterized and evaluated in vitro and in vivo. The polysaccharides were extracted and studied using spectroscopic and chemical methods. The results revealed that GPPs are rich in arabinose, galactose and glucuronic acid and are heteropolysaccharides without protein and nucleic acid, containing α-glycoside bonds with irregular clusters on the surface. In vitro antioxidant activity assays indicated that GPPs have concentration-dependent antioxidant activity. In vivo, GPPs markedly decreased the levels of TNF-a, IL-6, ALT, AST and MDA in serum and liver tissues and restored the levels of SOD, CAT and GSH. Additionally, further histopathological examination confirmed that GPPs could mitigate the injury of liver induced by CCl4. Our results demonstrate that GPPs had antioxidant and hepatoprotective effects, and they are expected to be a potential ingredient for functional foods or hepatoprotective drugs.

17.
Food Res Int ; 163: 112161, 2023 01.
Artigo em Inglês | MEDLINE | ID: mdl-36596110

RESUMO

In this study, four wine grape polysaccharides were extracted and optimized by using an efficient ultrasound-assisted extraction. A three-level, three-factor Box Behnken Design (BBD) combining with response surface methodology (RSM) was employed to optimize the extraction conditions including ultrasonic power, ultrasonic time and liquid-to-solid ratio. Furthermore, their physicochemical structures, antioxidant and liver protective activity were investigated and compared. Results revealed that the functional groups and monosaccharide compositions of these grape polysaccharides collected from different varieties were similar. Nevertheless, their molecular weights, molar ratios of monosaccharide compositions and surface morphological features were different. And the antioxidant activities of these polysaccharides were screened by free radical scavenging test. 'Beichun' (BC) and 'Benni fuji' (BF) polysaccharides possessed better antioxidant function. Further, the in vivo evaluation indicated that the polysaccharides of BC and BF have a protective effect against myocardial I/R injury in mice by inhibiting myocardial necroptosis mediated by mitochondrial ROS generation. Therefore, BC and BF grapes have potential applications in the medical and food industries.


Assuntos
Antioxidantes , Vitis , Animais , Camundongos , Antioxidantes/farmacologia , Antioxidantes/química , Polissacarídeos/farmacologia , Polissacarídeos/química , Peso Molecular , Monossacarídeos/química
18.
Int J Biol Macromol ; 239: 124164, 2023 Jun 01.
Artigo em Inglês | MEDLINE | ID: mdl-37011744

RESUMO

In this study, an efficient ultrasonic-assisted extraction method was used for the extraction and optimization of four wine grape polysaccharides. A three-level, three-factor Box Behnken Design combined with the response surface approach was used to optimize the extraction conditions. Their physicochemical properties, molecular structure, antioxidant activity, immunomodulatory activity and hepatoprotective effects were examined and compared. These findings suggest that the four wine grape polysaccharides share similar basic structural features and monosaccharide composition. Furthermore, four wine grape polysaccharides exhibited antioxidant and immunomodulatory activities in a concentration-dependent manner. Moldova (MD) polysaccharide displayed better antioxidant activity and immunomodulatory ability. Furthermore, MD polysaccharide has a significant therapeutic effect on CCl4-induced rat liver injury by improving the antioxidant defense system and inhibiting oxidative stress, indicating that MD has a hepatoprotective effect. Taken together, the MD wine grape polysaccharide may have potential applications in prevention of liver disease in the functional food and pharmaceutical industries.


Assuntos
Vitis , Vinho , Ratos , Animais , Antioxidantes/farmacologia , Antioxidantes/química , Estresse Oxidativo , Polissacarídeos/farmacologia , Polissacarídeos/química
19.
Hortic Res ; 10(5): uhad061, 2023 May.
Artigo em Inglês | MEDLINE | ID: mdl-37213686

RESUMO

Grapevine is one of the most economically important crops worldwide. However, the previous versions of the grapevine reference genome tipically consist of thousands of fragments with missing centromeres and telomeres, limiting the accessibility of the repetitive sequences, the centromeric and telomeric regions, and the study of inheritance of important agronomic traits in these regions. Here, we assembled a telomere-to-telomere (T2T) gap-free reference genome for the cultivar PN40024 using PacBio HiFi long reads. The T2T reference genome (PN_T2T) is 69 Mb longer with 9018 more genes identified than the 12X.v0 version. We annotated 67% repetitive sequences, 19 centromeres and 36 telomeres, and incorporated gene annotations of previous versions into the PN_T2T assembly. We detected a total of 377 gene clusters, which showed associations with complex traits, such as aroma and disease resistance. Even though PN40024 derives from nine generations of selfing, we still found nine genomic hotspots of heterozygous sites associated with biological processes, such as the oxidation-reduction process and protein phosphorylation. The fully annotated complete reference genome therefore constitutes an important resource for grapevine genetic studies and breeding programs.

20.
Mol Biol Rep ; 39(10): 9463-72, 2012 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-22733489

RESUMO

MicroRNAs (miRNAs) are an extensive class of newly identified small RNAs that regulate gene expression at post-transcription level by mRNA cleavage or translation. In our study, we used qRT-PCR and found that Vv-miR164 is expression in grapevine leaves, stems, tendrils, inflorescences, flowers and fruits. In addition, two potential target genes for Vv-miR164 were also found and verified by PPM-RACE and RLM-RACE. The results not only maps the cleavage site of the target mRNA but allowed for detection the expression pattern of cleaved fragments that can indicate the regulatory function of this miRNA on its target genes. These target genes were explored by qRT-PCR where some exhibited different expression patterns from their corresponding miRNA, indicating the cleavage mode of the miRNA on its target genes. The efficient and powerful approach used in this study can help in further understanding of how miRNAs cleaved their target mRNAs. Results from this study prove the importance of Vv-miR164 in regulating development and growth of grapes, and adds to the existing knowledge of small RNA-mediated regulation in grapes.


Assuntos
Genes de Plantas , MicroRNAs/metabolismo , Componentes Aéreos da Planta/genética , RNA de Plantas/metabolismo , Vitis/genética , Sequência de Aminoácidos , Sequência de Bases , Mapeamento Cromossômico , Clonagem Molecular , Expressão Gênica , Regulação da Expressão Gênica no Desenvolvimento , Regulação da Expressão Gênica de Plantas , MicroRNAs/genética , Dados de Sequência Molecular , Componentes Aéreos da Planta/metabolismo , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Interferência de RNA , RNA de Plantas/genética , Vitis/metabolismo
SELEÇÃO DE REFERÊNCIAS
Detalhe da pesquisa