Water Extract of Portulaca Oleracea Inhibits PEDV Infection-Induced Pyrolysis by Caspase-1/GSDMD.

Porcine epidemic diarrhea virus (PEDV) belongs to the coronavirus family and the coronavirus genus, causing contact enteric infection in pigs. It is one of the most serious diseases that threatens the pig industry. However, there is currently no specific drug to prevent and treat the disease, indicating that we need to be vigilant about the spread of the disease and the development of anti-PEDV drugs. The dried aerial parts of the plant Portulaca oleracea in the family Portulacaceous, whose decoction can be used to treat acute enteritis, dysentery, diarrhea, and other diseases. This study explored the potential mechanism of water extract of Portulaca oleracea (WEPO) in PEDV-induced pyroptosis in Vero cells. PEDV decreased the viability of Vero cells in a dose- and time-dependent manner, causing cell damage, upregulating the level of intracellular Nlrp3, and inhibiting the level of Gasdermin D (GSDMD) and the activation of Caspase-1. WEPO can inhibit PEDV-induced pyroptosis, reduce the elevation of inflammatory factors caused by infection, and exhibit a dose-dependent effect. Knockdown of Caspase-1 and GSDMD separately can induce the production of the inflammatory factor IL-1ß to significantly decrease and increase, respectively. These results suggest that WEPO can inhibit cell pyroptosis caused by PEDV and that the Caspase-1 and GSDMD pathways play an important role in this process.

Antibiotic resistance and drug modification: Synthesis, characterization and bioactivity of newly modified potent pleuromutilin derivatives with a substituted piperazine moiety.

Antibiotic-resistant bacteria pose a major global public health concern, owing to the lack of effective antibacterial drugs. Consequently, the discovery and development of innovative antibacterial drug classes with unique mechanisms of action are urgently needed. In this study, we designed, synthesised, and tested a series of novel pleuromutilin derivatives with piperazine linker substituted by amino acids moieties to determine their antibacterial properties. Most synthesized compounds exhibited potent activities against Staphylococcus aureus (S. aureus), methicillin-resistant S. aureus (MRSA), and methicillin-resistant Staphylococcus epidermidis. Compound 6l, the most potent antibacterial agent created in this study, displayed a rapid bactericidal activity against MRSA, Klebsiella pneumoniae and S. aureus cfr N12. Moreover, pharmacokinetics study of compound 6l exhibited good PK performance with a low in vivo clearance (CL = 1965 mL/h/kg) and a suitable half-life (T1/2 = 11.614 ± 5.123 h). Molecular docking experiments revealed the binding model of compound 6l to the unmethylated A2503 of peptidyl transferase centre of 23S rRNA. Interaction pattern of 6l with cfr-mediated ribosomes revealed by molecular dynamics. Moreover in vivo mouse systemic infection experiments with compound 6l revealed its effectiveness against MRSA and S. aureus cfr N12 with the ED50 of 11.08 mg/kg and 14.63 mg/kg body weight, respectively.

Antiviral activity of portulaca oleracea L. extracts against porcine epidemic diarrhea virus by partial suppression on myd88/NF-κb activation in vitro.

Porcine epidemic diarrhea virus (PEDV), especially variants, causes a highly contagious enteric disease which could give rise to huge economic losses in the swine industry worldwide. Portulaca oleracea L. has been reported to regulate intestine disease and involved in viral infections. However, the underlying mechanisms of Portulaca oleracea L. extracts against PEDV have not been fully elucidated. In this study, the antiviral effects and potential mechanisms of Portulaca oleracea L. extracts against PEDV were investigated in vitro. We first examined the inhibitory effects of different Portulaca oleracea L. extracts on the PEDV(JX-16 strain) in vitro and found that the water extract of Portulaca oleracea L.(PO)could significantly inhibit PEDV replication by 92.73% on VH cells and 63.07% on Vero cells. Furthermore, time-course analysis showed PO inhibited PEDV replication during the adsorption period of infectious cycle. Western blot and indirect immunofluorescence assay indicated that PO down-regulated the S protein expression in a dose-dependent manner. In addition, our results demonstrated the ability of PO to inhibit PEDV replication in VH cells by down-regulating the cytokine levels (TNF-α,IL-22 and IFN-α) and inhibiting the NF-κB signaling pathway activated by PEDV. Thus, Portulaca oleracea L extracts have potential utility in the preventive and therapeutic strategies for PEDV infection.

Ganoderic Acids Prevent Renal Ischemia Reperfusion Injury by Inhibiting Inflammation and Apoptosis.

Renal ischemia reperfusion injury (RIRI) is one of the main causes of acute kidney injury (AKI), which can lead to acute renal failure. The development of RIRI is so complicated that it involves many factors such as inflammatory response, oxidative stress and cell apoptosis. Ganoderic acids (GAs), as one of the main pharmacological components of Ganoderma lucidum, have been reported to possess anti-inflammatory, antioxidant, and other pharmacological effects. The study is aimed to investigate the protective effect of GAs on RIRI and explore related underlying mechanisms. The mechanisms involved were assessed by a mouse RIRI model and a hypoxia/reoxygenation model. Compared with sham-operated group, renal dysfunction and morphological damages were relieved markedly in GAs-pretreatment group. GAs pretreatment could reduce the production of pro-inflammatory factors such as IL-6, COX-2 and iNOS induced by RIRI through inhibiting TLR4/MyD88/NF-kB signaling pathway. Furthermore, GAs reduced cell apoptosis via the decrease of the ratios of cleaved caspase-8 and cleaved caspase-3. The experimental results suggest that GAs prevent RIRI by alleviating tissue inflammation and apoptosis and might be developed as a candidate drug for preventing RIRI-induced AKI.

Ganoderic acid A is the effective ingredient of Ganoderma triterpenes in retarding renal cyst development in polycystic kidney disease.

Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common life-threatening monogenetic diseases characterized by progressive enlargement of fluid-filled renal cysts. Our previous study has shown that Ganoderma triterpenes (GT) retards PKD renal cyst development. In the present study we identified the effective ingredient of GT in suppression of kidney cyst development. Using an in vitro MDCK cystogenesis model, we identified ganoderic acid A (GA-A) as the most promising candidate among the 12 ganoderic acid (GA) monomers. We further showed that GA-A (6.25-100 µM) significantly inhibited cyst growth in MDCK cyst model and embryonic kidney cyst model in vitro, and the inhibitory effect was reversible. In kidney-specific Pkd1 knockout (kPKD) mice displaying severe cystic kidney disease, administration of GA-A (50 mg· kg-1 ·d-1, sc) significantly attenuated renal cyst development. In both MDCK cells and kidney of kPKD mice, we revealed that GA-A dose-dependently downregulated the Ras/MAPK signaling pathway. The expression of proliferating cell nuclear antigen (PCNA) was also suppressed, suggesting a possible effect of GA-A on cell proliferation. These experimental data suggest that GA-A may be the main ingredient of GT as a potential therapeutic reagent for treating ADPKD.

Ganoderic acid hinders renal fibrosis via suppressing the TGF-ß/Smad and MAPK signaling pathways.

Renal fibrosis is considered as the pathway of almost all kinds of chronic kidney diseases (CKD) to the end stage of renal diseases (ESRD). Ganoderic acid (GA) is a group of lanostane triterpenes isolated from Ganoderma lucidum, which has shown a variety of pharmacological activities. In this study we investigated whether GA exerted antirenal fibrosis effect in a unilateral ureteral obstruction (UUO) mouse model. After UUO surgery, the mice were treated with GA (3.125, 12.5, and 50 mg· kg-1 ·d-1, ip) for 7 or 14 days. Then the mice were sacrificed for collecting blood and kidneys. We showed that GA treatment dose-dependently attenuated UUO-induced tubular injury and renal fibrosis; GA (50 mg· kg-1 ·d-1) significantly ameliorated renal disfunction during fibrosis progression. We further revealed that GA treatment inhibited the extracellular matrix (ECM) deposition in the kidney by suppressing the expression of fibronectin, mainly through hindering the over activation of TGF-ß/Smad signaling. On the other hand, GA treatment significantly decreased the expression of mesenchymal cell markers alpha-smooth muscle actin (α-SMA) and vimentin, and upregulated E-cadherin expression in the kidney, suggesting the suppression of tubular epithelial-mesenchymal transition (EMT) partially via inhibiting both TGF-ß/Smad and MAPK (ERK, JNK, p38) signaling pathways. The inhibitory effects of GA on TGF-ß/Smad and MAPK signaling pathways were confirmed in TGF-ß1-stimulated HK-2 cell model. GA-A, a GA monomer, was identified as a potent inhibitor on renal fibrosis in vitro. These data demonstrate that GA or GA-A might be developed as a potential therapeutic agent in the treatment of renal fibrosis.

A recombinant vaccine of Riemerella anatipestifer OmpA fused with duck IgY Fc and Schisandra chinensis polysaccharide adjuvant enhance protective immune response.

Riemerella anatipestifer (R. anatipestifer) causes septicemia and infectious serositis in domestic ducks, leading to high mortality and great economic losses worldwide. Vaccination is currently considered the best strategy to prevent R. anatipestifer infection in ducklings. In this study, we fused the duck IgY Fc gene to the outer membrane protein A (ompA) of R. anatipestifer. The eukaryotic expression plasmid carrying the fusion gene was transformed into Pichia pastoris (P. pastoris) to express the recombinant ompA and ompA-Fc proteins. Then, the effects of fused Fc on the vitality and antigen processing efficiency of duck peritoneal macrophages (PMø) were evaluated in vitro, whereas their immunogenicity was evaluated in vivo. Furthermore, Schisandra chinensis polysaccharide (SCP) was used to evaluate its immune-conditioning effects on the activation of PMø. SCP was also used as adjuvant to investigate immunomodulation on immunoresponses induced by the fused ompA-Fc in ducklings. The conventional Freund's incomplete adjuvant served as the control of SCP. Notably, ompA-Fc promoted phagocytosis of PMø and significantly increased serum antibody titers, CD4+ and CD8+ T-lymphocyte counts, lymphocyte transformation rate, and serum levels of IL-2 and IL-4. In addition, ducklings injected with the ompA-Fc vaccine exhibited considerably greater resistance to the R. anatipestifer challenge than those that received vaccines based on standalone ompA. Of note, SCP was demonstrated to boost the secretion of nitric oxide (NO), IL-1ß, IL-6, TNF-α, and IFN-ß by duck macrophages. In addition, the supplementation of SCP adjuvant to the ompA-Fc vaccines led to the further enhancement of immune response and vaccine protection. The dose of 200 µg/mL showed the most pronounced effects. This study provided valuable insights into protective strategies against R. anatipestifer infection.

Ganoderma Lucidum Polysaccharide Peptide Alleviates Hepatoteatosis via Modulating Bile Acid Metabolism Dependent on FXR-SHP/FGF.

BACKGROUND/AIMS: Non-alcoholic fatty liver disease (NAFLD) encompasses a series of pathologic changes ranging from steatosis to steatohepatitis, which may progress to cirrhosis and hepatocellular carcinoma. The purpose of this study was to determine whether ganoderma lucidum polysaccharide peptide (GLPP) has therapeutic effect on NAFLD. METHODS: Ob/ ob mouse model and ApoC3 transgenic mouse model were used for exploring the effect of GLPP on NAFLD. Key metabolic pathways and enzymes were identified by metabolomics combining with KEGG and PIUmet analyses and key enzymes were detected by Western blot. Hepatosteatosis models of HepG2 cells and primary hepatocytes were used to further confirm the therapeutic effect of GLPP on NAFLD. RESULTS: GLPP administrated for a month alleviated hepatosteatosis, dyslipidemia, liver dysfunction and liver insulin resistance. Pathways of glycerophospholipid metabolism, fatty acid metabolism and primary bile acid biosynthesis were involved in the therapeutic effect of GLPP on NAFLD. Detection of key enzymes revealed that GLPP reversed low expression of CYP7A1, CYP8B1, FXR, SHP and high expression of FGFR4 in ob/ob mice and ApoC3 mice. Besides, GLPP inhibited fatty acid synthesis by reducing the expression of SREBP1c, FAS and ACC via a FXR-SHP dependent mechanism. Additionally, GLPP reduced the accumulation of lipid droplets and the content of TG in HepG2 cells and primary hepatocytes induced by oleic acid and palmitic acid. CONCLUSION: GLPP significantly improves NAFLD via regulating bile acid synthesis dependent on FXR-SHP/FGF pathway, which finally inhibits fatty acid synthesis, indicating that GLPP might be developed as a therapeutic drug for NAFLD.

Taishan Pinus massoniana Pollen Polysaccharides Enhance Immune Responses in Chickens Infected by Avian Leukosis Virus Subgroup B.

Immunosuppressive virus, which can cause suppressed immunity and vaccination failure, frequently occurs in chicken flocks and seriously destroys the poultry industry. Our previous studies have reported that Taishan Pinus massoniana pollen polysaccharide (TPPPS) possess immunomodulatory effects and improve the immune effects of vaccines. In this study, avian leukosis virus subgroup B (ALV-B) was chosen as immunosuppressive virus to artificially establish immunosuppressive models in chickens, and the immune modulatory ability of TPPPS on the immune response of chickens was evaluated. Four randomly assigned groups (Group I-IV) of these immunosuppressed chickens were administered with TPPPS at doses of 0, 100, 200, and 400 mg/kg (every kilogram chick), respectively. Group V was administered with saline as control. At seven day old, 10 chickens randomly selected from Group I-V were inoculated with the attenuated Newcastle disease (ND) vaccine. The results showed that during the monitoring period, TPPPS significantly enhanced weight of immune organs, peripheral lymphocyte proliferation, the percentage of CD4+ and the ratio of CD4+/CD8+, IL-2 and IFN-γ production, and ALV-B antibody positive rate of chickens in a dose-dependent manner, with 400 mg/kg TPPPS being the most effective. In addition, the antibody titer against Newcastle disease virus (NDV) in Group IV with 400 mg/kg was significantly higher than those in other groups. We observed the stronger immunity in the TPPPS group, which indicates that TPPPS could be used as an immunoenhancer to relieve immunosuppression caused by ALV-B in the poultry industry.

Pharmacokinetics and tissue distribution of pefloxacin mesylate in chickens.

A specific, sensitive and stable high-performance liquid chromatography (HPLC)-based analytical method was established to determine the level of pefloxacin mesylate (PM) in the plasma and various tissues of chickens. Chickens were randomly assigned to 12 equal experiment groups, including 11 treatment groups and one control group. The chickens in the treatment groups received oral administration of PM and were sacrificed at different pre-determined time points, with their blood and various organs harvested, extracted and analyzed by HPLC to quantify the level of the residual antibiotic. Method validation studies indicated that the HPLC measurement showed excellent precision, reproducibility, stability and robustness. The obtained pharmacokinetic parameters suggested that PM reached peak levels in various tissues within 1-2 h after its oral administration, and was mainly concentrated in liver and kidney. The antibiotic was also found to be cleared from chicken crureus, brain, testes, ovaries and pancreas at higher rates compared with other organs. Overall, the rapid accumulation of PM could at least be partially attributed to its relatively slow organ clearance. These results could serve as a useful guidance for the rational use of PM and other quinolone-derived antimicrobials in the treatment of infectious diseases in chickens and other animals.

The Taishan Robinia pseudoacacia polysaccharides enhance immune effects of rabbit haemorrhagic disease virus inactivated vaccines.

Robinia pseudoacacia flower, a common component in traditional Chinese medicine, has long been well-known for its high pharmaceutical value. This study aimed to assess the immunopotentiating effects of Taishan Robinia Pseudoacacia polysaccharides (TRPPS) in rabbits inoculated with a rabbit haemorrhagic disease virus (RHDV) inactivated vaccine. The rabbits were administered with the RHDV vaccine in conjunction with varying concentrations of TRPPS, and their blood samples were collected at different time points to analyze the ratio and number of blood lymphocytes. In addition, sera were prepared and analyzed to determine the overall antibody titer and the level of IL-2, a cytokine commonly used as an indicator of immune activity. The various TRPPS-supplemented vaccines were shown to be more effective in enhancing the immune functions of the inoculated rabbits compared to their polysaccharide-free counterpart, with 200 mg/mL of TRPPS exhibiting the most pronounced benefits that were comparable to those of propolis. In addition, the TRPPS-supplemented RHDV inactivated vaccines could significantly improve the survival rates of the immunized rabbits against RHDV infection. Our studies offered convincing experimental evidence for the development of TRPPS as a new type of plant-derived immunopotentiator.

Mechanisms of Stem Cells and Their Secreted Exosomes in the Treatment of Autoimmune Diseases.

Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases mainly relies on their immune regulation ability, regulating the number and function of auxiliary cells, anti-inflammatory factors and proinflammatory factors in patients to reduce inflammation. On the other hand, the stem cell- derived secretory body has weak immunogenicity and low molecular weight, can target the site of injury, and can extend the length of its active time in the patient after combining it with the composite material. Therefore, the role of secretory bodies in the stem cell treatment of autoimmune diseases is increasingly important.

Cellular and molecular mechanisms of highly active mesenchymal stem cells in the treatment of senescence of rhesus monkey ovary.

BACKGROUND: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics single-nucleus transcriptome sequencing experiment on the ovaries of macaque monkeys after HA-MSC treatment. METHODS: The results of cell subgroup classification were visualized by 10X Genomics single nuclear transcriptome sequencing. The aging model of hGCs was established, and the migration ability of the cells was determined after coculture of HA-MSCs and aging hGCs. The genes screened by single nuclear transcriptional sequencing were verified in vitro by qPCR. RESULTS: Compared with the aging model group, the number of cell receptor pairs in each subgroup of the HA-MSC-treated group increased overall. Treatment with 200 µmol/L H2O2 for 48 h was used as the optimum condition for the induction of hGC senescence. After coculture of noncontact HA-MSCs with senescent hGCs, it was found that HA-MSCs can reverse the cell structure, proliferation ability, senescence condition, expression level of senescence-related genes, and expression level of key genes regulating the senescence pathway in normal hGCs. CONCLUSIONS: HA-MSC therapy can improve the tissue structure and secretion function of the ovary through multiple cellular and molecular mechanisms to resist ovarian aging. In vitro validation experiments further supported the results of single-cell sequencing, which provides evidence supporting a new option for stem cell treatment of ovarian senescence.

Structural characterization and anti-oxidative activity for a glycopeptide from Ganoderma lucidum fruiting body.

A water-soluble glycopeptide (named GL-PWQ3) with a molecular weight (Mw) of 2.40 × 104 g/mol was isolated from Ganoderma lucidum fruiting body by hot water extraction, membrane ultrafiltration, and gel column chromatography, which mainly consisted of glucose and galactose. Based on the methylation, FT-IR, 1D, and 2D NMR analysis, the polysaccharide portion of GL-PWQ3 was identified as a glucogalactan, which was comprised of unsubstituted (1,6-α-Galp, 1,6-ß-Glcp, 1,4-ß-Glcp) and monosubstituted (1,2,6-α-Galp and 1,3,6-ß-Glcp) in the backbone and possible branches that at the O-3 position of 1,3-Glcp and T-Glcp, and the O-2 position of T-Fucp, T-Manp or T-Glcp. The chain conformational study by SEC-MALLS-RI and AFM revealed that GL-PWQ3 was identified as a highly branched polysaccharide with a polydispersity index of 1.25, and might have compact sphere structures caused by stacked multiple chains. Moreover, the GL-PWQ3 shows strong anti-oxidative activity in NRK-52E cells. This study provides a theoretical basis for further elucidating the structure-functionality relationships of GL-PWQ3 and its potential application as a natural antioxidant in pharmacotherapy as well as functional food additives.

Safety and efficacy evaluation of halicin as an effective drug for inhibiting intestinal infections.

Halicin, the first antibacterial agent discovered by artificial intelligence, exerts broad-spectrum antibacterial effects and has a unique structure. Our study found that halicin had a good inhibitory effect on clinical isolates of drug-resistant strains and Clostridium perfringens (C. perfringens). The safety of halicin was evaluated by acute oral toxicity, genotoxicity and subchronic toxicity studies. The results of acute toxicity test indicated that halicin, as a low-toxicity compound, had an LD50 of 2018.3 mg/kg. The results of sperm malformation, bone marrow chromosome aberration and cell micronucleus tests showed that halicin had no obvious genotoxicity. However, the results of the 90-day subchronic toxicity test indicated that the test rats exhibited weight loss and slight renal inflammation at a high dose of 201.8 mg/kg. Teratogenicity of zebrafish embryos showed that halicin had no significant teratogenicity. Analysis of intestinal microbiota showed that halicin had a significant effect on the intestinal microbial composition, but caused a faster recovery. Furthermore, drug metabolism experiments showed that halicin was poorly absorbed and quickly eliminated in vivo. Our study found that halicin had a good therapeutic effect on intestinal infection model of C. perfringens. These results show the feasibility of developing oral halicin as a clinical candidate drug for treating intestinal infections.

Comparison of gut microbiota immunity and pathology in specific-pathogen-free chickens with glandular and muscular gastritis using different methods.

The objective of this study is to review different methods to screen for the optimal model for preventing and treating chicken glandular and muscular gastritis syndrome. Twenty-four 40-day-old specific pathogen-free (SPF) chickens were randomly allocated into four groups (N = 6): polyethylene glycol + ammonium chloride group (M1 group), acetic acid + rhubarb group (M2 group), polyethylene glycol + rhubarb group (M3 group), and control group. The control group had free access to water, while the remaining groups received different doses of molding reagents added to their drinking water. The animal models were assessed based on clinical manifestations, histopathology findings, serological analysis, and composition of intestinal microbiota to establish an optimal approach for constructing an avian model of glandular and muscular gastritis. The SPF chickens in each model group exhibited typical symptoms of glandular and muscular gastritis, poor spirit, yellow loose stools with undigested feed, and enlargement and ulceration of the glandular and muscular stomach. Among these groups, the M3 group had the highest incidence rate of 100%. Compared to the control group, the body weight and body temperature of the chicken in the three model groups were reduced, and the glandular and muscular stomachs and duodenum showed different degrees of bleeding, mucosal abscission, and other pathological injuries. Additionally, the levels of serum IL-2 and α-amylase activity decreased while the content of IL-4 increased. After conducting 16s rDNA sequencing, it was observed that the abundance of Bacteroides, Faecalibacterium, and Ruminococcaceae UCG-014 was significantly increased in the model group compared to the control group. Conversely, there was a notable decrease in the levels of Megamonas and Lactobacillus, which are speculated to be associated with arachidonic acid metabolism, the NF-κB signaling pathway, and TNF signaling pathways. The combination of polyethylene glycol and rhubarb emerged as the most effective method for establishing the glandular and muscular gastritis model in SPF chickens. This constructed chicken model displayed distinct signs of damage to the glandular and muscular stomach, inflammatory response, and disturbance in the intestinal flora, thereby providing a foundation for future research on the prevention and treatment of this syndrome.

Ganoderma lucidum Polysaccharide Peptide Alleviates Cyclophosphamide-Induced Male Reproductive Injury by Reducing Oxidative Stress and Apoptosis.

Chemotherapy is an important factor leading to male infertility. It is crucial to discover safe and effective treatments to prevent male reproductive injury caused by chemotherapy. The Ganoderma lucidum polysaccharide peptide (GLPP) has multiple pharmacological activities. The purpose of this study was to determine whether GLPP could protect the male sperm production from chemotherapeutic injury using a mouse model, with testicular damage induced by cyclophosphamide (CP). CP (50 mg/kg/day) was injected intraperitoneally into male ICR mice gavaged with different doses of GLPP at certain spermatogenic stages. The experimental results showed that GLPP alleviated the CP-induced reduction in reproductive organ coefficients and sperm parameters and reduced the morphological damage of testicular tissues in a dose-dependent manner. GLPP significantly improved the reproductive index, sperm-related parameters, sex hormone levels, and histological testis architecture at different spermatogenic stages. Furthermore, GLPP significantly increased superoxide dismutase (SOD), glutathione (GSH), catalase (CAT), Nrf2, and HO-1, and decreased malondialdehyde (MDA) and Keap-1 in the testicular tissue, indicating reduced oxidative stress. In addition, GLPP limited CP-induced apoptosis via a reduction in Bax expression and increase in Bcl-2 expression. This study suggests that GLPP plays a protective role in spermatogenesis by reducing chemotherapeutic injury and might be developed into drug for male patients receiving chemotherapy.

Ganoderic acids alleviate atherosclerosis by inhibiting macrophage M1 polarization via TLR4/MyD88/NF-κB signaling pathway.

BACKGROUND AND AIMS: Atherosclerosis (AS) is a chronic inflammatory disease characterized by lipid infiltration and plaque formation in blood vessel walls. Ganoderic acids (GA), a class of major bioactive compounds isolated from the Chinese traditional medicine Ganoderma lucidum, have multiple pharmacological activities. This study aimed to determine the anti-atherosclerotic effect of GA and reveal the pharmacological mechanism. METHODS: ApoE-/- mice were fed a high-cholesterol diet and treated with GA for 16 weeks to induce AS and identify the effect of GA. Network pharmacological analysis was performed to predict the anti-atherosclerotic mechanisms. An invitro cell model was used to explore the effect of GA on macrophage polarization and the possible mechanism involved in bone marrow dereived macrophages (BMDMs) and RAW264.7 cells stimulated with lipopolysaccharide or oxidized low-density lipoprotein. RESULTS: It was found that GA at 5 and 25 mg/kg/d significantly inhibited the development of AS and increased plaque stability, as evidenced by decreased plaque in the aorta, reduced necrotic core size and increased collagen/lipid ratio in lesions. GA reduced the proportion of M1 macrophages in plaques, but had no effect on M2 macrophages. In vitro experiments showed that GA (1, 5, 25 µg/mL) significantly decreased the proportion of CD86+ macrophages and the mRNA levels of IL-6, IL-1ß, and MCP-1 in macrophages. Experimental results showed that GA inhibited M1 macrophage polarization by regulating TLR4/MyD88/NF-κB signaling pathway. CONCLUSIONS: This study demonstrated that GA play an important role in plaque stability and macrophage polarization. GA exert the anti-atherosclerotic effect partly by regulating TLR4/MyD88/NF-κB signaling pathways to inhibit M1 polarization of macrophages. Our study provides theoretical basis and experimental data for the pharmacological activity and mechanisms of GA against AS.

Effects of Ganoderma lucidum polysaccharide peptide ameliorating cyclophosphamide-induced immune dysfunctions based on metabolomics analysis.

Ganoderma lucidum polysaccharide peptide (GLPP) is one of the most abundant constituents of Ganoderma lucidum (G. lucidum), with a wide range of functional activities. The present study investigated the immunomodulatory effects of GLPP in cyclophosphamide (CTX)-induced immunosuppressive mice. The results showed that 100 mg/kg/day of GLPP administration significantly alleviated CTX-induced immune damage by improving immune organ indexes, earlap swelling rate, the index of carbon phagocytosis and clearance value, secretion of cytokines (TNF-α, IFN-γ, and IL-2), and immunoglobulin A(IgA) in the mice. Furthermore, ultra-performance liquid chromatography with mass/mass spectrometry (UPLC-MS/MS) was conducted to identify the metabolites, followed by biomarker and pathway analysis. The results showed that GLPP treatment alleviated CTX-induced alterations in the fecal metabolome profile, including arachidonic acid (AA), leukotriene D4 (LTD4), indole-3-ethanol, and formyltetrahydrofolate (CF), by reversing citric acid, malic acid, cortisol, and oleic acid. These results support the concept that GLPP exhibits immunomodulatory activity via the folate cycle, methionine cycle, TCA cycle, fatty acid biosynthesis and metabolism, glycerophospholipid metabolism, AA metabolism, and cAMP pathways. In conclusion, the results could be helpful to understand the use of GLPP to clarify the immunomodulatory mechanism and be used as immunostimulants to prevent CTX-induced side effects in the immune system.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.