Genetic variability and evolutionary analyses of the coat protein gene of Tomato mosaic virus.

Tomato mosaic virus (ToMV), a member of the genus Tobamovirus, infects several ornamental and horticultural crops worldwide. In this study, the nucleotide sequences of the coat protein gene of worldwide ToMV isolates were analyzed to estimate the genetic structure and diversity of this virus and the involved evolutionary forces. The phylogenetic analysis showed three clades with high bootstrap support: Clade I contained three ToMV isolates from Brazil collected from pepper, Clade II comprised one Brazilian ToMV isolate from pepper, and Clade III was composed of ToMV isolates collected from different plant hosts (pepper, tomato, eggplant, lilac, camellia, dogwood, red spruce, etc.) and water (from melting ice, lakes and streams) from different countries: USA, Brazil, Korea, Germany, Spain, Denmark (Greenland), China, Taiwan, Malaysia, Iran, and Kazakhstan. With the exception of Brazil, nucleotide diversity within and between different geographic regions was very low, although statistical analyses suggested some gene flow between most of these regions. Our analyses also suggested a strong negative selection which could have contributed to the genetic stability of ToMV.

First Report of Pepper as a Natural Host for Pelargonium zonate spot virus in Spain.

Pelargonium zonate spot virus (PZSV) was first reported on Pelargonium zonale (L.) L'Hér. ex Aiton and later on tomato in Italy, Spain, France (1), and the United States (2). In Spain, PZSV was first detected in 1996 in tomato plants of cv. Royesta from greenhouses in Zaragoza Province (3) and subsequently in tomato in the Catalonia and Navarra areas. In April 2006, symptoms of PZSV were found at high incidence on tomato in a greenhouse in Huesca, Aragón (northeastern Spain). Randomly distributed pepper plants (Capsicum annuum L.) of cv. Estilo F1 growing in the same greenhouse showed severe foliar chlorotic ringspots and line patterns similar to those observed in tomato. Samples from symptomatic peppers and tomatoes and one asymptomatic weed of Rubia tinctorum L. tested positive by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies against PZSV (Agdia Inc., Elkhart, IN and DSMZ, Braunschweig, Germany) as did a Spanish PZSV isolate used as a positive control (3). Sap extracts from two tomatoes, three peppers, and the single R. tinctorum plant were mechanically inoculated to 22 indicator species, including pepper and tomato. On 17 of 22 species inoculated, sap from symptomatic tomatoes and peppers elicited local or systemic symptoms similar to those reported earlier for PZSV isolates (3). Systemic symptoms were mainly mosaic, chlorotic, and necrotic line patterns and ringspots on leaves of most indicator species, closely resembling those observed on the greenhouse pepper and tomato plants. Symptoms on inoculated tomatoes also included stem necrosis and death. Reactions of indicator species did not indicate the presence of any other pepper- or tomato-infecting viruses. Both field infected and mechanically inoculated plants of pepper cvs. Yolo Wonder and Doux des Landes were maintained in the greenhouse until the development of fruit symptoms. Only fruits of cv. Yolo Wonder showed dark green and slightly depressed circles on their surface. Local and systemic infection by PZSV was confirmed by DAS-ELISA in most inoculated plants. Total RNA from leaves of field or inoculated plants was used as template for amplification by reverse transcription (RT)-PCR with primers R3-F and R3-R that are specific for the PZSV 3a gene (2), and amplicons were sequenced directly. The sequences of 697 nt from pepper and tomato isolates from the same greenhouse were identical (GenBank Accession Nos. CQ178217 and CQ178216, respectively) and had 96.1% identity to nucleotides 384 to 1,080 in PZSV RNA-3 (NC_003651). Our results confirm the natural infection of pepper plants in Huesca by PZSV. To our knowledge, this is the first report of pepper as a natural host for PZSV, a significant finding considering the potential risks of PZSV dispersion whenever tomato and pepper coexist, particularly in greenhouses and nurseries. References: (1) M. Finetti-Sialer and D. Gallitelli. J. Gen. Virol. 84:3143, 2003. (2) H. Y. Liu and J. L. Sears. Plant Dis. 91:633, 2007. (3) M. Luis-Arteaga and M. A. Cambra. Plant Dis. 84:807, 2000.

Detection and identification of species of the genus Fabavirus by RT-PCR with a single pair of primers.

The genus Fabavirus includes three species: Broad bean wilt virus 1 (BBWV-1), BBWV-2 and Lamium mild mosaic virus (LMMV), but a new candidate species, Gentian mosaic virus (GeMV), has been proposed. Analysis of the complete nucleotide sequences of fabaviruses was used to design a pair of conserved primers for specific detection of members of this genus. These primers encompassed the 5'-terminal non-translatable region (NTR) , whose size for BBWV-1, BBWV-2 and GeMV was different. RT-PCR, with this pair of primers, is a rapid and sensitive procedure for diagnosis of fabavirus infections, that also allows identification of distinct species involved in single or mixed infections, based on the size of the amplification products. Moreover, it might allow future discovery of potential new species of this genus.

Development of RAPD and SCAR markers linked to the Pvr4 locus for resistance to PVY in pepper ( Capsicum annuum L.).

Potato Virus Y (PVY) is the only potyvirus infecting pepper ( Capsicum annuum L.) in Europe. Currently, the development of pepper varieties resistant to PVY seems to be the most-efficient method to control PVY damage. Among the sources of resistance, a monogenic dominant gene Pvr4 confers resistance against all known PVY pathotypes. In this work, bulked segregant analysis (BSA) was used to search for randomly amplified polymorphic DNA (RAPD) markers linked to the Pvr4 gene, using segregating progenies obtained by crossing a homozygous resistant ('Serrano Criollo de Morelos-334') with a homozygous susceptible ('Yolo Wonder') cultivar. Eight hundred decamer primers were screened to identify one RAPD marker (UBC19(1432)) linked in repulsion phase to Pvr4. This marker was converted into a dominant sequence characterised amplified region (SCAR) marker (SCUBC19(1423)). This marker was mapped into a dense Capsicum genetic map in a region where several genes for resistance to different diseases are located. This marker can be useful to identify PVY-resistant genotypes in segregating progenies of pepper in marker-assisted selection (MAS) breeding programs.

First Report of Natural Infection of Greenhouse-Grown Tomato and Weed Species by Pelargonium zonate spot virus in Spain.

Tomato (Lycopersicon esculentum Mill.) plants showing severe chlorotic and necrotic ringspots, line patterns on leaves, and concentric chlorotic ringspots on stems and fruits were observed in plastic greenhouse-grown tomato crops cv. Royesta during the spring of 1996 in Zaragoza province, Northeast Spain. Symptoms were similar to those associated with Pelargonium zonate spot virus (PZSV) infection on tomato in Italy (1,2). The causal agent was mechanically transmitted from leaf, fruit, and stem samples to several indicator species. The following host reactions were recorded: chlorotic local lesions on Chenopodium amaranticolor, C. quinoa, Cucumis sativus, and Cucurbita pepo, and systemic reactions, sometimes associated with localized reactions, on Capsicum annuum 'Doux des Landes' and 'Yolo Wonder', Datura stramonium, Gomphrena globosa, Nicotiana clevelandii, N. glutinosa, N. megalosiphon, N. rustica, N. sylvestris, N. tabacum 'Paraguay', 'Samsun', and 'Xanthi nc', Ocimum basilicum, Petunia hybrida, Physalis floridana, Solanum melongena, and Vigna unguiculata. Symptoms obtained in indicator species were erratic. During the spring of 1999, naturally occurring symptoms appeared again on tomato plants, cultivars Royesta and Bond, growing in greenhouses in the same area. Positive serological reactions with the enzyme-linked immunosorbent assay (ELISA) using a commercial PZSV antiserum (Agdia Inc.), developed against an Italian isolate of PZSV, were obtained with extracts from leaves, stems, and fruits of tomato plants naturally infected (1999) and from systemically infected indicator species mechanically inoculated with sap from tomato samples (1996 and 1999). Serological results were confirmed by molecular hybridization analysis using a PZSV-specific riboprobe (D. Gallitelli, personal communication). Some of the weeds growing around the greenhouses (Capsella bursa-pastoris, Diplotaxis erucoides, Picris echioides, and Sonchus oleraceus) also tested positive for PZSV (A405nm values greater than three times that of healthy plants). However, other weed species such as Anacyclus tomentosus, Beta maritima, Cardaria draba, Malva sylvestris, Medicago sp., Polygonum aviculare, Rumex sp., and Sisymbrium irio tested negative, while results from tests on Borago officinalis, Bromus rigidus, and Convolvulus arvensis were inconclusive. Symptoms like those of naturally infected tomato plants were reproduced by mechanically inoculating tomato seedlings with sap from PZSV-infected tobacco (Nicotiana glutinosa and N. tabacum 'Paraguay') or from Physalis floridana plants. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) C. Vovlas et al. Inform. Fitopatol. 2:39, 1986.

Natural Infection of Field-Grown Borage (Borago officinalis) by Alfalfa mosaic virus in Spain.

Alfalfa mosaic virus (AMV) has a wide host range and is distributed throughout the world. It causes disease in several vegetable crops, including bean, celery, lettuce, pea, pepper, and tomato (1). In Spain, it has been found naturally infecting alfalfa, pepper, and tomato. During the autumn of 1999, in the area of Zaragoza (northeastern Spain), several plants expressing foliar yellow mosaic symptoms were observed in borage grown for human consumption in open field plots. The commercial value of the symptomatic plants was greatly reduced. The symptoms were similar to those previously obtained in greenhouse-grown borage plants mechanically inoculated with three tomato isolates of AMV (2). The following indicator species, including virus-free borage plants, were mechanically inoculated with sap from leaves of symptomatic borage plants, and reactions were recorded: chlorotic and necrotic local lesions on Tetragonia expansa and Vigna unguiculata; chlorotic local lesions and systemic mosaic on Chenopodium quinoa, C. amaranticolor, Cucumis sativus 'Marketmore', Gomphrena globosa, and Nicotiana glutinosa; systemic mosaic, sometimes associated with localized reactions, on Ocimum basilicum, Capsicum annuum 'Doux des Landes' and 'Yolo Wonder', N. benthamiana, N. clevelandii, N. rustica, N. sylvestris, N. tabacum 'Paraguay' and 'Xanthi nc', Petunia hybrida, Physalis floridana, and Solanum melongena 'Cerna krazavitska'. The reactions are in agreement with the indicator host reactions described for AMV (1). Symptoms on virus-free borage plants mechanically inoculated with sap from symptomatic borage and from inoculated C. amaranticolor and O. basilicum experimental hosts were similar to those observed in naturally infected borage. Positive serological reactions (A405 values more than three times greater than those of the negative controls) in double-antibody sandwich enzyme-linked immunosorbent assay using commercially prepared antiserum against AMV (Agdia, Inc., Elkhart, IN) were obtained with extracts of naturally infected borage leaves and with systemically infected indicator species. Alfalfa plots located in the vicinity of the symptomatic borage plants could be the source of virus for borage infections. To our knowledge, this is the first report of natural AMV infection in Borago spp. References: (1) E. M. J. Jaspars and L. Bos. CMI/AAB. No. 229, 1980. (2) M. Luis-Arteaga and J. M. Alvarez. Inf. Téc. Econ. Agr. 92:70, 1996.

First Report of Broad bean wilt virus 1 in Spain.

In late summer 2001, field-grown pepper (Capsicum annuum) plants showing chlorotic blotching in leaves and fruits were observed in Benicarló, Castellón, Spain. Enzyme-linked immunosorbent assays of extracts of these plants with a collection of plant virus antisera showed a positive reaction only with Broad bean wilt virus serotype 1 (BBWV-1) antiserum. To confirm BBWV-1 infection, primers B1 (GCTCTTCCCCATATAACTTTC) and B2 (GTCTCTATCTTCTCTTCTTCC) were designed based on the nucleotide sequence of BBWV-1 isolate PV132 (GenBank Accession No. AB018702), and were used for reverse-transcription polymerase chain reaction analysis. RNAs extracted from symptomatic plants yielded a cDNA product of ~500 bp that was not obtained using RNA extracts from healthy plants. The sequence of this cDNA fragment was determined, and it showed ~80% nucleotide identity with a BBWV-1 genomic region, encompassing part of the two coat proteins genes. Amino acid identities were ~94% with BBWV-1 isolates and ~60% with BBWV-2 isolates. BBWV-1 and BBWV-2 are considered different species of the genus Fabavirus. BBWV-1 and BBWV-2 are distributed worldwide and infect a wide range of plants. In the Mediterranean Basin, BBWV-1 has been serologically identified in Jordan, Lebanon, Syria, Egypt, Tunisia, Morocco (2), and Italy (1), but no nucleotide sequence data is available. To our knowledge, this is the first report of BBWV-1 in Spain. References: (1) M. G. Bellardi et al. Plant Dis. 81:959, 1997. (2) K. M. Makkouk et al. Neth. J. Plant Pathol. 96:291, 1990.

New molecular methods for identification of broad bean wilt virus 1.

Broad bean wilt virus 1 (BBWV-1) causes damages in economically important plant crops such as pepper, bean, spinach, etc. Fast, cheap and reliable diagnostic tools are crucial to limit or control the disease. In this work, tissue blot immunoassay (TBIA), dot-blot (DB) and tissue-print (TP)-hybridization were developed for BBWV-1 diagnosis and evaluated for sensitivity, specificity and reliability in plants of several host species grown in the greenhouse or in the field, in comparison with ELISA and RT-PCR. RT-PCR followed by DB-hybridization provided the most sensitive and efficient diagnostic, but the virus was also detected in most samples by ELISA. Detection by TBIA or by TP-hybridization avoided sample processing, but they were less consistent and greatly depended on host species and tissue. DB-hybridization with probes corresponding to different genomic regions allowed universal detection of BBWV-1 and discrimination between genetically distant isolates.

The complete sequence of a Spanish isolate of Broad bean wilt virus 1 (BBWV-1) reveals a high variability and conserved motifs in the genus Fabavirus.

The genome of a Spanish isolate of Broad bean wilt virus-1 (BBWV-1) was completely sequenced and compared with available sequences of other isolates of the genus Fabavirus (BBWV-1 and BBWV-2). This consisted of two RNAs of 5814 and 3431 nucleotides, respectively, and their organization was similar to that of other members of the family Comoviridae. Its mean nucleotide identity with a BBWV-1 American isolate was 81.5%, and between 59.8 and 63.5% with seven BBWV-2 isolates. Our analysis showed sequence stretches in the 5' non-coding regions which are conserved in both genomic RNAs and in BBWV-1 and BBWV-2 isolates.