NLRP3 Inflammasome Inhibitor OLT1177 Suppresses Onset of Inflammation in Mice with Dextran Sulfate Sodium-Induced Colitis.

BACKGROUND AND AIMS: NLRP3 inflammasomes have been reported to have a key role in the initiation and perpetuation of inflammatory bowel diseases (IBD). Here we investigated the effects of OLT1177, a selective inhibitor of NLRP3 inflammasomes, in mice with dextran sulfate sodium (DSS)-induced colitis. METHODS: C57BL/6J mice were given drinking water containing 3% DSS for 5 days. OLT1177 was administered for 5 days during the induction phase (simultaneously with DSS treatment) or the recovery phase (after the DSS treatment ended). The body weight and disease activity index were monitored daily. The mice were sacrificed 10 days after the start of the experiment, and the severity of inflammation in the colon was determined based on histological and biochemical analyses. RESULTS: Administration of OLT1177 during the induction phase effectively suppressed DSS colitis in terms of weight loss, disease activity index, histological score, and expression of inflammatory cytokines compared to the DSS group. In contrast, OLT1177 administration during the recovery phase did not significantly affect the colitis disease course or the results of histological analyses. CONCLUSIONS: OLT1177 was effective in preventing the onset of DSS colitis in mice. These results could guide the use of OLT1177 as a therapy for human IBD.

Docosahexaenoic Acid Promotes Axon Outgrowth by Translational Regulation of Tau and Collapsin Response Mediator Protein 2 Expression.

n-3 PUFAs are essential for neuronal development and brain function. However, the molecular mechanisms underlying their biological effects remain unclear. Here we examined the mechanistic action of docosahexaenoic acid (DHA), the most abundant n-3 polyunsaturated fatty acids in the brain. We found that DHA treatment of cortical neurons resulted in enhanced axon outgrowth that was due to increased axon elongation rates. DHA-mediated axon outgrowth was accompanied by the translational up-regulation of Tau and collapsin response mediator protein 2 (CRMP2), two important axon-related proteins, and the activation of Akt and p70 S6 kinase. Consistent with these findings, rapamycin, a potent inhibitor of mammalian target of rapamycin (mTOR), prevented DHA-mediated axon outgrowth and up-regulation of Tau and CRMP2. In addition, DHA-dependent activation of the Akt-mTOR-S6K pathway enhanced 5'-terminal oligopyrimidine tract-dependent translation of Tau and CRMP2. Therefore, our results revealed an important role for the Akt-mTOR-S6K pathway in DHA-mediated neuronal development.

Na+/H+ exchange regulatory factor 1 is required for ROMK1 K+ channel expression in the surface membrane of cultured M-1 cortical collecting duct cells.

The ROMK1 K+ channel, a member of the ROMK channel family, is the major candidate for the K+ secretion pathway in the renal cortical collecting duct (CCD). ROMK1 possesses a PDZ domain-binding motif at its C-terminus that is considered a modulator of ROMK1 expression via interaction with Na+/H+ exchange regulatory factor (NHERF) 1 and NHERF2 scaffold protein. Although NHERF1 is a potential binding partner of the ROMK1 K+ channel, the interaction between NHERF1 and K+ channel activity remains unclear. Therefore, in this study, we knocked down NHERF1 in cultured M-1 cells derived from mouse CCD and investigated the surface expression and K+ channel current in these cells after exogenous transfection with EGFP-ROMK1. NHERF1 knockdown resulted in reduced surface expression of ROMK1 as indicated by a cell biotinylation assay. Using the patch-clamp technique, we further found that the number of active channels per patched membrane and the Ba2+-sensitive whole-cell K+ current were decreased in the knockdown cells, suggesting that reduced K+ current was accompanied by decreased surface expression of ROMK1 in the NHERF1 knockdown cells. Our results provide evidence that NHERF1 mediates K+ current activity through acceleration of the surface expression of ROMK1 K+ channels in M-1 cells.

PSD-Zip70 Deficiency Causes Prefrontal Hypofunction Associated with Glutamatergic Synapse Maturation Defects by Dysregulation of Rap2 Activity.

Dysregulation of synapse formation and plasticity is closely related to the pathophysiology of psychiatric and neurodevelopmental disorders. The prefrontal cortex (PFC) is particularly important for executive functions such as working memory, cognition, and emotional control, which are impaired in the disorders. PSD-Zip70 (Lzts1/FEZ1) is a postsynaptic density (PSD) protein predominantly expressed in the frontal cortex, olfactory bulb, striatum, and hippocampus. Here we found that PSD-Zip70 knock-out (PSD-Zip70KO) mice exhibit working memory and cognitive defects, and enhanced anxiety-like behaviors. These abnormal behaviors are caused by impaired glutamatergic synapse transmission accompanied by tiny-headed immature dendritic spines in the PFC, due to aberrant Rap2 activation, which has roles in synapse formation and plasticity. PSD-Zip70 modulates the Rap2 activity by interacting with SPAR (spine-associated RapGAP) and PDZ-GEF1 (RapGEF) in the postsynapse. Furthermore, suppression of the aberrant Rap2 activation in the PFC rescued the behavioral defects in PSD-Zip70KO mice. Our data demonstrate a critical role for PSD-Zip70 in Rap2-dependent spine synapse development in the PFC and underscore the importance of this regulation in PFC-dependent behaviors. SIGNIFICANCE STATEMENT: PSD-Zip70 deficiency causes behavioral defects in working memory and cognition, and enhanced anxiety due to prefrontal hypofunction. This study revealed that PSD-Zip70 plays essential roles in glutamatergic synapse maturation via modulation of the Rap2 activity in the PFC. PSD-Zip70 interacts with both SPAR (spine-associated RapGAP) and PDZ-GEF1 (RapGEF) and modulates the Rap2 activity in postsynaptic sites. Our results provide a novel Rap2-specific regulatory mechanism in synaptic maturation involving PSD-Zip70.

Glucocorticoid suppresses dendritic spine development mediated by down-regulation of caldesmon expression.

Glucocorticoids (GCs) mediate the effects of stress to cause structural plasticity in brain regions such as the hippocampus, including simplification of dendrites and shrinkage of dendritic spines. However, the molecular mechanics linking stress and GCs to these effects remain largely unclear. Here, we demonstrated that corticosterone (CORT) reduces the expression levels of caldesmon (CaD), causing dendritic spines to become vulnerable. CaD regulates cell motility by modulating the actin-myosin system and actin filament stability. In cultured rat hippocampal neurons, CaD localized to dendritic spines by binding to filamentous actin (F-actin), and CaD expression levels increased during spine development. CaD stabilized the F-actin dynamics in spines, thereby enlarging the spine heads, whereas CaD knockdown decreased the spine-head size via destabilization of the F-actin dynamics. CaD was also required for chemical LTP-induced actin stabilization. The CaD expression levels were markedly decreased by exposure to CORT mediated by suppression of serum response factor-dependent transcription. High CORT levels reduced both the spine-head size and F-actin stability similarly to CaD knockdown, and overexpressing CaD abolished the detrimental effect of CORT on dendritic spine development. These results indicate that CaD enlarges the spine-head size by stabilizing F-actin dynamics, and that CaD is a critical target in the GC-induced detrimental effects on dendritic spine development.

Caldesmon regulates axon extension through interaction with myosin II.

To begin the process of forming neural circuits, new neurons first establish their polarity and extend their axon. Axon extension is guided and regulated by highly coordinated cytoskeletal dynamics. Here we demonstrate that in hippocampal neurons, the actin-binding protein caldesmon accumulates in distal axons, and its N-terminal interaction with myosin II enhances axon extension. In cortical neural progenitor cells, caldesmon knockdown suppresses axon extension and neuronal polarity. These results indicate that caldesmon is an important regulator of axon development.

Folic acid is a potent chemoattractant of free-living amoebae in a new and amazing species of protist, Vahlkampfia sp.

Folic acid (folate; vitamin Bc) is well recognized as essential for the proper metabolism of the essential amino acid methionine as well as for the synthesis of adenine and thymine. A folate deficiency has been Implicated in a wide variety of disorders from Alzheimer's disease to depression and neural tube defects. In the cellular slime molds, including Dictyostelium, vegetative growth-phase cells are known to chemotactically move toward folate that is secreted by bacterial food sources such as Escherichia coli. Intracellular folate signal transductlon, including G proteins, Ca(2+)channels, and the PIP3 pathway, has been reported in D. discoideum. To our surprise, the genuine chemoattractant(s) of free-living protozoan amoebae have remained to be determined, possibly because of lack of a pertinent method for assaying chemotaxis. We recently isolated a primitive free-living amoeba from the soil of Costa Rica and identified it as a new species of the genus Vahlkampfia belonging to Subclass Gymnamoebia, which includes Entamoeba and Acanthamoeba. The amoebae can grow and multiply quite rapidly, engulfing nearby bacteria such as E. coli. Importantly, we have demonstrated here using a quite simple but finely designed chemotaxis assay that the Vahlkampfia amoebae exhibit chemotaxis toward higher folate concentrations. Riboflavin and cyanocobalamin were also found to serve as positive chemoattractants. Among these chemoattractants, folate is of particular importance because its function seems to be evolutionarily conserved as a potent chemoattractant of amoeboid cells in a wide range of organisms as well as in the Protista and cellular slime molds.

Social Stress-Induced Postsynaptic Hyporesponsiveness in Glutamatergic Synapses Is Mediated by PSD-Zip70-Rap2 Pathway and Relates to Anxiety-Like Behaviors.

PSD-Zip70 is a postsynaptic protein that regulates glutamatergic synapse formation and maturation by modulation of Rap2 activity. PSD-Zip70 knockout (PSD-Zip70KO) mice exhibit defective glutamatergic synaptic transmission in the prefrontal cortex (PFC) with aberrant Rap2 activation. As prefrontal dysfunction is implicated in the pathophysiology of stress-induced psychiatric diseases, we examined PSD-Zip70KO mice in a social defeat (SD) stress-induced mouse model of depression to investigate stress-induced alterations in synaptic function. Compared with wild-type (WT) mice, PSD-Zip70KO mice exhibited almost normal responses to SD stress in depression-related behaviors such as social activity, anhedonia, and depressive behavior. However, PSD-Zip70KO mice showed enhanced anxiety-like behavior irrespective of stress conditions. The density and size of dendritic spines of pyramidal neurons were reduced in the medial PFC (mPFC) in mice exposed to SD stress. Phosphorylation levels of the AMPA-type glutamate receptor (AMPA-R) GluA2 subunit at Ser880 were prominently elevated in mice exposed to SD stress, indicating internalization of surface-expressed AMPA-Rs and decreased postsynaptic responsiveness. Structural and functional impairments in postsynaptic responsiveness were associated with Rap2 GTPase activation in response to SD stress. Social stress-induced Rap2 activation was regulated by a PSD-Zip70-dependent pathway via interaction with SPAR/PDZ-GEF1. Notably, features such as Rap2 activation, dendritic spine shrinkage, and increased GluA2 phosphorylation were observed in the mPFC of PSD-Zip70KO mice even without SD stress. Together with our previous results, the present findings suggest that SD stress-induced postsynaptic hyporesponsiveness in glutamatergic synapses is mediated by PSD-Zip70-Rap2 signaling pathway and closely relates to anxiety-like behaviors.

Myocardin-related transcription factor A (MRTF-A) activity-dependent cell adhesion is correlated to focal adhesion kinase (FAK) activity.

The regulation of cell-substrate adhesion is tightly linked to the malignant phenotype of tumor cells and plays a role in their migration, invasion, and metastasis. Focal adhesions (FAs) are dynamic adhesion structures that anchor the cell to the extracellular matrix. Myocardin-related transcription factors (MRTFs), co-regulators of the serum response factor (SRF), regulate expression of a set of genes encoding actin cytoskeletal/FA-related proteins. Here we demonstrated that the forced expression of a constitutively active MRTF-A (CA-MRTF-A) in B16F10 melanoma cells induced the up-regulation of actin cytoskeletal and FA proteins, resulting in FA reorganization and the suppression of cell migration. Expression of CA-MRTF-A markedly increased phosphorylation of focal adhesion kinase (FAK) and paxillin, which are important components for FA dynamics. Notably, FAK activation was triggered by the clustering of up-regulated integrins. Our results revealed that the MRTF-SRF-dependent regulation of cell migration requires both the up-regulation of actin cytoskeletal/FA proteins and the integrin-mediated regulation of FA components via the FAK/Src pathway. We also demonstrated that activation of the MRTF-dependent transcription correlates FAK activation in various tumor cells. The elucidation of the correlation between MRTF and FAK activities would be an effective therapeutic target in focus of tumor cell migration.

Diversification of caldesmon-linked actin cytoskeleton in cell motility.

The actin cytoskeleton plays a key role in regulating cell motility. Caldesmon (CaD) is an actin-linked regulatory protein found in smooth muscle and non-muscle cells that is conserved among a variety of vertebrates. It binds and stabilizes actin filaments, as well as regulating actin-myosin interaction in a calcium (Ca2+)/calmodulin (CaM)- and/or phosphorylation-dependent manner. CaD function is regulated qualitatively by Ca2+/CaM and by its phosphorylation state and quantitatively at the mRNA level, by three different transcriptional regulation of the CALD1 gene. CaD has numerous functions in cell motility, such as migration, invasion, and proliferation, exerted via the reorganization of the actin cytoskeleton. Here we will outline recent findings regarding CaD's structural features and functions.

Glucocorticoid receptor-mediated expression of caldesmon regulates cell migration via the reorganization of the actin cytoskeleton.

Glucocorticoids (GCs) play important roles in numerous cellular processes, including growth, development, homeostasis, inhibition of inflammation, and immunosuppression. Here we found that GC-treated human lung carcinoma A549 cells exhibited the enhanced formation of the thick stress fibers and focal adhesions, resulting in suppression of cell migration. In a screen for GC-responsive genes encoding actin-interacting proteins, we identified caldesmon (CaD), which is specifically up-regulated in response to GCs. CaD is a regulatory protein involved in actomyosin-based contraction and the stability of actin filaments. We further demonstrated that the up-regulation of CaD expression was controlled by glucocorticoid receptor (GR). An activated form of GR directly bound to the two glucocorticoid-response element-like sequences in the human CALD1 promoter and transactivated the CALD1 gene, thereby up-regulating the CaD protein. Forced expression of CaD, without GC treatment, also enhanced the formation of thick stress fibers and focal adhesions and suppressed cell migration. Conversely, depletion of CaD abrogated the GC-induced phenotypes. The results of this study suggest that the GR-dependent up-regulation of CaD plays a pivotal role in regulating cell migration via the reorganization of the actin cytoskeleton.

Reorganization of the actin cytoskeleton via transcriptional regulation of cytoskeletal/focal adhesion genes by myocardin-related transcription factors (MRTFs/MAL/MKLs).

RhoA is a crucial regulator of stress fiber and focal adhesion formation through the activation of actin nucleation and polymerization. It also regulates the nuclear translocation of myocardin-related transcription factor-A and -B (MRTF-A/B, MAL or MKL 1/2), which are co-activators of serum response factor (SRF). In dominant-negative MRTF-A (DN-MRTF-A)-expressing NIH 3T3 cell lines, the expressions of several cytoskeletal/focal adhesion genes were down-regulated, and the formation of stress fiber and focal adhesion was severely diminished. MRTF-A/B-knockdown cells also exhibited such cytoskeletal defects. In reporter assays, both RhoA and MRTF-A enhanced promoter activities of these genes in a CArG-box-dependent manner, and DN-MRTF-A inhibited the RhoA-mediated activation of these promoters. In dominant-negative RhoA (RhoA-N19)-expressing NIH 3T3 cell lines, the nuclear translocation of MRTF-A/B was predominantly prevented, resulting in the reduced expression of cytoskeletal/focal adhesion proteins. Further, constitutive-active MRTF-A/B increased the expression of endogenous cytoskeletal/focal adhesion proteins, and thereby rescued the defective phenotype of stress fibers and focal adhesions in RhoA-N19 expressing cells. These results indicate that MRTF-A/B act as pivotal mediators of stress fiber and focal adhesion formation via the transcriptional regulation of a subset of cytoskeletal/focal adhesion genes.

Dual roles of myocardin-related transcription factors in epithelial mesenchymal transition via slug induction and actin remodeling.

Epithelial-mesenchymal transition (EMT) is a critical process occurring during embryonic development and in fibrosis and tumor progression. Dissociation of cell-cell contacts and remodeling of the actin cytoskeleton are major events of the EMT. Here, we show that myocardin-related transcription factors (MRTFs; also known as MAL and MKL) are critical mediators of transforming growth factor beta (TGF-beta) 1-induced EMT. In all epithelial cell lines examined here, TGF-beta1 triggers the nuclear translocation of MRTFs. Ectopic expression of constitutive-active MRTF-A induces EMT, whereas dominant-negative MRTF-A or knockdown of MRTF-A and -B prevents the TGF-beta1-induced EMT. MRTFs form complexes with Smad3. Via Smad3, the MRTF-Smad3 complexes bind to a newly identified cis-element GCCG-like motif in the promoter region of Canis familiaris and the human slug gene, which activates slug transcription and thereby dissociation of cell-cell contacts. MRTFs also increase the expression levels of actin cytoskeletal proteins via serum response factor, thereby triggering reorganization of the actin cytoskeleton. Thus, MRTFs are important mediators of TGF-beta1-induced EMT.

Changes in the balance between caldesmon regulated by p21-activated kinases and the Arp2/3 complex govern podosome formation.

Podosomes are dynamic cell adhesion structures that degrade the extracellular matrix, permitting extracellular matrix remodeling. Accumulating evidence suggests that actin and its associated proteins play a crucial role in podosome dynamics. Caldesmon is localized to the podosomes, and its expression is down-regulated in transformed and cancer cells. Here we studied the regulatory mode of caldesmon in podosome formation in Rous sarcoma virus-transformed fibroblasts. Exogenous expression analyses revealed that caldesmon represses podosome formation triggered by the N-WASP-Arp2/3 pathway. Conversely, depletion of caldesmon by RNA interference induces numerous small-sized podosomes with high dynamics. Caldesmon competes with the Arp2/3 complex for actin binding and thereby inhibits podosome formation. p21-activated kinases (PAK)1 and 2 are also repressors of podosome formation via phosphorylation of caldesmon. Consequently, phosphorylation of caldesmon by PAK1/2 enhances this regulatory mode of caldesmon. Taken together, we conclude that in Rous sarcoma virus-transformed cells, changes in the balance between PAK1/2-regulated caldesmon and the Arp2/3 complex govern the formation of podosomes.

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.