RESUMO
Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.
RESUMO
Thrips tabaci Lindeman (Thysanoptera: Thripidae) adult and larval settling and oviposition on onion (Allium cepa L.) foliage were investigated in relation to leaf position and leaf length at prebulb plant growth stages under controlled conditions. In the laboratory, four and six adult females of T. tabaci were released on onion plants at three-leaf stage and six- to eight-leaf stage, respectively, and thrips egg, nymph, and adult count data were collected on each of the three inner most leaves at every 2-cm leaf segment. Thrips settling and oviposition parameters were quantified during the light period on the above ground portion of onion plants from the distal end of the bulb or leaf sheath "neck" through the tips of the foliage. Results from studies confirmed that distribution of thrips adults, nymphs, and eggs were skewed toward the base of the plant. The settling distributions of thrips adults and nymphs differed slightly from the egg distribution in that oviposition occurred all the way to the tip of the leaf while adults and nymphs were typically not observed near the tip. In a field study, the foliage was divided into three equal partitions, i.e., top, middle, basal thirds, and thrips adults by species, primarily Frankliniella fusca (Hinds) and T. tabaci, were collected from each partition to determine if there was a similar bias of all adult thrips toward the base of the plant. The results suggested that adults of different species appear to segregate along leaf length. Finally, thrips oviposition on 2-cm segments and Iris yellow spot virus positive leaf segments were quantified in the field, irrespective of thrips species. Both variables demonstrated a very similar pattern of bias toward the base of the plant and were significantly correlated.
Assuntos
Distribuição Animal , Cebolas/virologia , Oviposição , Doenças das Plantas/virologia , Tisanópteros/fisiologia , Tospovirus/fisiologia , Animais , Cadeia Alimentar , Georgia , Ninfa/crescimento & desenvolvimento , Ninfa/fisiologia , Cebolas/fisiologia , Óvulo/crescimento & desenvolvimento , Óvulo/fisiologia , Folhas de Planta/fisiologia , Tisanópteros/crescimento & desenvolvimentoRESUMO
Several species of root-knot nematodes (Meloidogyne spp.) are known to have significant presence on turfgrass in golf course greens, particularly in the western United States. Nematodes isolated from a golf course in King County, WA were identified as Meloidogyne minor based on analysis of the large ribosomal subunit (LSU 28S D2-D3 expansion segment), the internal transcribed spacers 1 and 2 (ITS rDNA), the intergenic spacer region 2 (IGS2), and the nuclear protein-coding gene Hsp90. Sequence-characterized amplified region (SCAR) primers that were originally designed to be specific for M. fallax were found to cross-react with M. minor. A population from California was determined to be M. fallax based on juvenile tail morphology and analysis of the ribosomal markers and Hsp90, comprising the first report of this species in North America. Using trees based on Hsp90 genomic alignments, the phylogenetic relationships of these populations and known root-knot nematode species were congruent with previous trees based on ribosomal genes. Resolution of M. fallax and M. chitwoodi using Hsp90 was equivalent to species separation obtained with 28S or 18S rDNA alignments. The strengths and weaknesses of ribosomal and Hsp90 markers, and the use of SCAR polymerase chain reaction as diagnostic tools are discussed.
RESUMO
Based on a new record of the rare species Robustodorus megadorus from Utah, the generic diagnosis was amended to include the following characters: a labial disc surrounded by six pore-like sensilla; the absence of a cephalic disc; a lobed cephalic region devoid of annulation; a hexagonal inner cuticular structure of the pouch surrounding the stylet cone; large stylet knobs, rounded in outline and somewhat flattened on their lateral margins; a large spermatheca with an occluded lumen and lacking sperm; the excretory pore located between the median bulb and nerve ring. The stylet orifice consists of an open, ventral, elongate slit or groove. These characters distinguish the genus from the closely related genus Aphelenchoides. A lectotype and paralectotypes were designated. Results of phylogenetic analyses of the 18S and D2-D3 of 28S rRNA gene sequences revealed that R. megadorus occupies a basal position within one of the two main clades of the subfamily Aphelenchoidinae and shares close relationships with a species group of the genus Aphelenchoides that includes A. blastophthorus, A. fragariae, A. saprophilus, A. xylocopae, and A. subtenuis. Several specimens in our collection of R. megadorus were infected with Pasteuria sp. as were some of the paralectotypes.
RESUMO
A survey of 238 golf courses in 10 states of the western United States found root-knot nematodes (Meloidogyne spp.) in 60% of the putting greens sampled. Sequence and phylogenetic analyses of 18S rRNA, D2-D3 of 28S rRNA, internal transcribed spacer-rRNA, and mitochondrial DNA gene sequences were used to identify specimens from 110 golf courses. The most common species, Meloidogyne naasi, was found in 58 golf courses distributed from Southern California to Washington in the coastal or cooler areas of those states. In the warmer regions of the Southwest, M. marylandi was recovered from 38 golf courses and M. graminis from 11 golf courses. This constitutes the first report of M. marylandi in Arizona, California, Hawaii, Nevada, and Utah, and the first report of M. graminis in Arizona, Hawaii, and Nevada. Two golf courses in Washington were infested with M. minor, the first record of this nematode in the Western Hemisphere. Columbia root-knot nematode, M. chitwoodi, was found in a single golf course in California. Polymerase chain reaction restriction fragment length polymorphism of the intergenic region between the cytochrome oxidase and 16S rRNA genes in the mitochondrial genome with restriction enzyme SspI was able to distinguish populations of M. graminis from M. marylandi, providing a fast and inexpensive method for future diagnosis of these nematodes from turf.
RESUMO
A little known, unculturable ascomycete, referred to as Phyllachora ambrosiae, can destroy the inflorescences of Ambrosia artemisiifolia, an invasive agricultural weed and producer of highly allergenic pollen. The fungus often remains undetectable in ragweed populations. This work was conducted to understand its origin and pathogenesis, a prerequisite to consider its potential as a biocontrol agent. The methods used included light and transmission electron microscopy, nrDNA sequencing, phylogenetic analyses, artificial inoculations, and the examination of old herbarium and recent field specimens from Hungary, Korea, Ukraine and USA. The Eurasian and the North American specimens of this fungus were to represent two distinct, although closely related lineages that were only distantly related to other lineages within the Ascomycota. Consequently, we describe a new genus that includes Cryptophyllachora eurasiatica gen. et sp. nov. and C. ambrosiae comb. nov., respectively. The pathogenesis of C. eurasiatica was shown in A. artemisiifolia. No evidence was found for either seed-borne transmission or systemic infection. Two hypotheses were developed to explain the interaction between C. eurasiatica and A. artemisiifolia: (i) as yet undetected seed-borne transmissions and latent, systemic infections; or (ii) alternative hosts.
Assuntos
Ambrosia/microbiologia , Fungos/patogenicidade , Agricultura , DNA Fúngico/química , DNA Fúngico/isolamento & purificação , DNA Fúngico/metabolismo , Fungos/classificação , Fungos/genética , Microscopia Eletrônica de Transmissão , Filogenia , Análise de Sequência de DNARESUMO
Eudarluca caricis is assumed to be a nonspecific mycoparasite of rust fungi. The evidence for its mycoparasitism has rested on constant association with uredinia. In this study, stable isotopes provided additional evidence of mycoparasitism, as E. caricis was enriched with 15N relative to its associated rust fungus, as were parasites and mycoparasites generally with respect to their hosts. Host specificity was directly tested in inoculations in the greenhouse. Isolates of E. caricis from Puccinia on two Eurasian grasses (i.e. Holcus lanatus and Phalaris arundinacaea) did not infect Melampsora on Populus that, in contrast, was successfully infected by a poplar isolate of E. caricis. An isolate from M. medusae on P. deltoides infected a significantly greater percentage of uredinia of M. medusae on P. deltoides than uredinia of M. occidentalis on P. trichocarpa. The host specificity of the three isolates was reflected in their divergence in a phylogenetic analysis based on ITS sequences. Interestingly, the analysis revealed that mycoparasites of rust and powdery mildew fungi have evolved from a common ancestor.