Bioproduction of prostaglandins in a transgenic liverwort, Marchantia polymorpha.

Prostaglandins are biologically active substances used in a wide range of medical treatments. Prostaglandins have been supplied mainly by chemical synthesis; nevertheless, the high cost of prostaglandin production remains a factor. To lower the cost of prostaglandin production, we attempted to produce prostaglandins using a liverwort, Marchantia polymorpha L., which accumulates arachidonic acid, which is known as a substrate of prostaglandins. Here we report the first bioproduction of prostaglandins in plant species by introducing a cyclooxygenase gene from a red alga, Gracilaria vermiculophylla into the liverwort. The transgenic liverworts accumulated prostaglandin F2α, prostaglandin E2 and prostaglandin D2 which were not detected in the wild-type liverwort. Moreover, we succeeded in drastically increasing the bioproduction of prostaglandins using an in vitro reaction system with the extracts of transgenic liverworts.

ANGUSTIFOLIA, a plant homolog of CtBP/BARS, functions outside the nucleus.

CtBP/BARS is a unique protein family in having quite diversified cellular functions, intercellular localizations, and developmental roles. ANGUSTIFOLIA (AN) is the sole homolog of CtBP/BARS from Arabidopsis thaliana, although it has plant AN-specific motifs and a long C-terminus. Previous studies suggested that AN would function in the nucleus as a transcriptional co-repressor, as CtBPs function in animals; however, precise verification has been lacking. In this paper, we isolated a homologous gene (MAN) of AN from liverwort, Marchantia polymorpha. Transformation of the Arabidopsis an-1 mutant with 35S-driven MAN completely complemented the an-1 phenotype, although it lacks the putative nuclear localization signal (NLS) that exists in AN proteins isolated from other plant species. We constructed several plasmids for expressing modified ANs with amino acid substitutions in known motifs. The results clearly indicated that modified AN with mutations in the putative NLS-like domain could complement the an-1 phenotype. Therefore, we re-examined localization of AN using several techniques. Our results demonstrated that AN localizes on punctuate structures around the Golgi, partially overlapping with a trans-Golgi network resident, which highlighted an unexpected link between leaf development and membrane trafficking. We should reconsider the roles and evolutionary traits of AN based on these findings.

Cold-induced accumulation of ω-3 polyunsaturated fatty acid in a liverwort, Marchantia polymorpha L.

The liverwort Marchantia polymorpha L. synthesizes various long-chain polyunsaturated fatty acids including arachidonic acid and eicosapentaenoic acid, neither of which is produced by higher plants. Here we report the effects of temperature on long-chain polyunsaturated fatty acid accumulation in the liverwort. The accumulation of ω-3 polyunsaturated fatty acids increased significantly as the growth temperature decreased. Specifically, the relative content of eicosapentaenoic acid to total fatty acids at 5 °C was approximately 3-fold higher than at 25 °C. On the other hand, the accumulation of ω-6 polyunsaturated fatty acids decreased at low temperatures. An analysis of gene expression indicated that the mRNA of the MpFAD3 gene for ER ω-3 desaturase increased significantly at 5 °C. These results indicate that in the liverwort the n-3 pathway was enhanced at low temperature, mainly via expression of the cold-induced ω-3 desaturase gene, leading to increased accumulation of eicosapentaenoic acid.

Identification of a cyclooxygenase gene from the red alga Gracilaria vermiculophylla and bioconversion of arachidonic acid to PGF(2α) in engineered Escherichia coli.

Prostaglandins (PGs) are important local messenger molecules in many tissues and organs of animals including human. For applications in medicine and animal care, PGs are mostly purified from animal tissues or chemically synthesized. To generate a clean, reliable, and inexpensive source for PGs, we have now engineered expression of a suitable cyclooxygenase gene in Escherichia coli and achieved production levels of up to 2.7 mg l(-1) PGF(2α). The cyclooxygenase gene cloned from the red alga Gracilaria vermiculophylla appears to be fully functional without any eukaryotic modifications in E. coli. A crude extract of the recombinant E. coli cells is able to convert in vitro the substrate arachidonic acid (AA) to PGF(2α). Furthermore, these E. coli cells produced PGF(2α) in a medium supplemented with AA and secreted the PGF(2α) product. To our knowledge, this is the first report of the functional expression of a cyclooxygenase gene and concomitant production of PGF(2α) in E. coli. The successful microbial synthesis of PGs with reliable yields promises a novel pharmaceutical tool to produce PGF(2α) at significantly reduced prices and greater purity.

Agrobacterium-mediated transformation of Euphorbia tirucalli callus.

In order to establish a basis for transformation technology in the petroleum plant Euphorbia tirucalli, the callus of the plant was infected with Agrobacterium, washed with distilled water, sterilized with distilled water containing 100 mg/l of carbenicillin, selected on solidified B5 medium containing 13 mg/l of G418 and 100 mg/l of carbenicillin, and then on solidified B5 medium containing 25 mg/l of G418 and 100 mg/l of carbenicillin for the transgenic calli, and then the callus lines were subcultured successively on solidified B5 medium containing 50 mg/l of G418. We performed PCR analysis of sterilized G418-resistant callus line DNA and concluded that the gene introduced was integrated into the callus genome.

Cloning and characterization of a squalene synthase gene from a petroleum plant, Euphorbia tirucalli L.

Euphorbia tirucalli L., which is also known as a petroleum plant, produces a large amount of phytosterols and triterpenes. During their biosynthesis, squalene synthase converts two molecules of the hydrophilic substrate farnesyl diphosphate into a hydrophobic product, squalene. An E. tirucalli cDNA clone of a putative squalene synthase gene (EtSS) was isolated by RT-PCR followed by 5'- and 3'-RACE. The restriction fragment polymorphisms revealed by Southern blot analysis suggest that EtSS is a single copy gene. The glycine at the 287th residue from the N-terminal end of domain C has replaced alanine, which is conserved among all the other SS sequences deposited in the Genbank database. The N-terminal 380 residues of the hydrophilic sequence was expressed as a peptide-tagged protein in E. coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. GC-MS analysis showed that squalene was detected in the in vitro reaction mixture. E. tirucalli transgenic callus lines, in which EtSS was overexpressed, accumulated increased amounts of phytosterols as compared with that of wild type callus. RT-PCR analysis of wild type E. tirucalli plants revealed that the EtSS transcript accumulated in almost equal amounts in the stems and the leaves with a stalk, while a lower amount was detected in the roots. In situ hybridization analysis revealed that prominent antisense-probe signal was detected in the cambia within bundle sheathes. These results indicate that EtSS functions prominently in cambia, which are located adjacent to conductive tubes, and that this gene plays important roles in phytosterol accumulation in petroleum plants.

Pathway engineering of Brassica napus seeds using multiple key enzyme genes involved in ketocarotenoid formation.

Brassica napus (canola) plants were genetically manipulated to increase the amount and composition of carotenoids in seeds by using seven key enzyme genes involved in ketocarotenoid formation, which originated from a soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3), and marine bacteria Brevundimonas sp. strain SD212 and Paracoccus sp. strain N81106 (formerly called Agrobacterium aurantiacum). The seven key gene cassettes, in which each gene was surrounded by an appropriate promoter and terminator, were connected in a tandem manner, and the resulting constructs (17 kb) were inserted into a binary vector and used for transformation of B. napus. Surprisingly, 73-85% of the regenerated plants retained all seven genes, and formed orange- or pinkish orange-coloured seeds (embryos), while untransformed controls had light yellow-coloured seeds with predominant accumulation of lutein. Three of the transgenic lines were analysed further. The total amount of carotenoids in these seeds was 412-657 microg g(-1) fresh weight, which was a 19- to 30-fold increase compared with that of untransformed controls. The total amount of ketocarotenoids was 60-190 microg g(-1) fresh weight. beta-Carotene was the predominant carotenoid, with significant amounts of alpha-carotene, echinenone, phytoene, lutein, and canthaxanthin also detected in the transgenic seeds. The ratio of hydroxylated carotenoids to overall carotenoids was quite small relative to the ratio of ketocarotenoids to overall carotenoids. Interestingly, expression of many endogenous carotenogenic genes was also altered in the transgenic seeds, suggesting that their expression was affected by an increase in carotenoid biosynthesis.

Detection of 5-lipoxygenase activity in the liverwort Marchantia polymorpha L.

We detected 5-LOX (arachidonate 5-lipoxygenase) in the homogenate of Marchantia polymorpha by spectrophotometry and mass spectrometry. LC/MS/MS analysis indicated that the liverwort 5-LOX produced 5-hydroperoxy-6,8,11,14-eicosatetraenoic acid (5-HPETE) with arachidonic acid as a substrate. The 5-LOX activity showed a Ca(2+) response, as demonstrated for human 5-LOX. These findings suggest that the liverwort utilizes an arachidonate cascade in a defense signal response.

Gene content, organization and molecular evolution of plant organellar genomes and sex chromosomes: insights from the case of the liverwort Marchantia polymorpha.

The complete nucleotide sequence of chloroplast DNA (121,025 base pairs, bp) from a liverwort, Marchantia polymorpha, has made clear the entire gene organization of the chloroplast genome. Quite a few genes encoding components of photosynthesis and protein synthesis machinery have been identified by comparative computer analysis. We also determined the complete nucleotide sequence of the liverwort mitochondrial DNA and deduced 96 possible genes in the sequence of 186,608 bp. The complete chloroplast genome encodes twenty introns (19 group II and 1 group I) in 18 different genes. One of the chloroplast group II introns separates a ribosomal protein gene in a trans-position. The mitochondrial genome contains thirty-two introns (25 group II and 7 group I) in the coding regions of 17 genes. From the evolutionary point of view, we describe the origin of organellar introns and give evidence for vertical and horizontal intron transfers and their intragenomic propagation. Furthermore, we describe the gene organization of the Y chromosome in the dioecious liverwort M. polymorpha, the first detailed view of a Y chromosome in a haploid organism. On the 10 megabase (Mb) Y chromosome, 64 genes are identified, 14 of which are detected only in the male genome. These 14 genes are expressed in reproductive organs but not in vegetative thalli, suggesting their participation in male reproductive functions. These findings indicate that the Y and X chromosomes share the same ancestral autosome and support the prediction that in a haploid organism essential genes on sex chromosomes are more likely to persist than in a diploid organism.

Production of arachidonic and eicosapentaenoic acids in plants using bryophyte fatty acid Delta6-desaturase, Delta6-elongase, and Delta5-desaturase genes.

The liverwort Marchantia polymorpha L. synthesizes arachidonic (ARA) and eicosapentaenoic acids (EPA) from linoleic and alpha-linolenic acids respectively by a series of reactions catalyzed by Delta6-desaturase, Delta6-elongase, and Delta5-desaturase. Overexpression of the M. polymorpha genes encoding these enzymes in transgenic M. polymorpha plants resulted in 3- and 2-fold accumulation of ARA and EPA respectively, as compared to those in the wild type. When these three genes were introduced and co-expressed in tobacco plants, in which long-chain polyunsaturated fatty acids (LCPUFAs) are not native cellular components, ARA and EPA represented up to 15.5% and 4.9% respectively of the total fatty acid in the leaves. Similarly in soybean, C20-LCPUFAs represented up to 19.5% of the total fatty acids in the seeds. These results suggest that M. polymorpha can provide genes crucial to the production of C20-LCPUFAs in transgenic plants.

Molecular evolution of mitochondrial introns in the liverwort Marchantia polymorpha.

We here describe in detail the characterization and molecular evolution of group II introns in the mitochondrial genome of the liverwort Marchantia polymorpha. We find that 18 introns of the 25 group II introns can be assigned by their similarities to six clusters, indicating an intra-genomic propagation of one ancestral intron each into the respective clusters in the liverwort mitochondrial genome. Interestingly, the intra-genomic propagation of some of these introns occurred only after the evolutionary separation of the bryophytes from the other clades of plants. Finally we report that the maturase-like sequences in the liverwort group II introns have further evolved by horizontal and independent transposition and substitution by analogous sequences from other fungal introns.

Isolation and functional characterization of fatty acid delta5-elongase gene from the liverwort Marchantia polymorpha L.

Bryophyte Marchantia polymorpha L. produces C22 very-long-chain polyunsaturated fatty acid (VLCPUFA). Thus far, no enzyme that mediates elongation of C20 VLCPUFAs has been identified in land plants. Here, we report the isolation and characterization of the gene MpELO2, which encodes an ELO-like fatty acid elongase in M. polymorpha. Heterologous expression in yeast demonstrated that MpELO2 encodes delta5-elongase, which mediates elongation of arachidonic (20:4) and eicosapentaenoic acids (20:5). Phylogenetic and gene structural analysis indicated that the MpELO2 gene is closely related to bryophyte Delta6-elongase genes for C18 fatty acid elongation and diverged from them by local gene duplication.

Multicopy genes uniquely amplified in the Y chromosome-specific repeats of the liverwort Marchantia polymorpha.

Sex of the liverwort Marchantia polymorpha is determined by the sex chromosomes Y and X, in male and female plant, respectively. Approximately half of the Y chromosome is made up of unique repeat sequences. Here, we report that part of the Y chromosome, represented by a 90-kb insert of a genomic clone pMM2D3, contains five putative genes in addition to the ORF162 gene, which is present also within the Y chromosome-specific repeat region. One of the five putative genes shows similarity to a male gamete-specific protein of lily and is expressed predominantly in male sex organs, suggesting that this gene has a male reproductive function. Furthermore, Southern blot analysis revealed that these five putative genes are amplified on the Y chromosome, but they also probably have homologs on the X chromosome and/or autosomes. These observations suggest that the Y chromosome evolved by co-amplifying protein-coding genes with unique repeat sequences.

Cloning and characterization of a cDNA encoding beta-amyrin synthase from petroleum plant Euphorbia tirucalli L.

Euphorbia tirucalli L., known as the petroleum plant, produces a large amount of triterpenes, such as beta-amyrin. Degenerate RT-PCR based on the sequences conserved among known beta-amyrin synthases led to cloning of a putative triterpene synthase cDNA, EtAS, from leaves of E. tirucalli. The deduced amino acid sequence of the EtAS cDNA showed the highest identity of 82% to the Panax ginseng beta-amyrin synthase. Heterologous expression of the EtAS ORF in the methylotrophic yeast, Pichia pastoris, resulted in production of beta-amyrin, revealing that the EtAS cDNA codes for a beta-amyrin synthase. This is the first report of a gene involved in the triterpene synthetic pathway from Euphorbiaceae plants.

Cloning and expression of three lipoxygenase genes from liverwort, Marchantia polymorpha L., in Escherichia coli.

Three genes homologous to plant lipoxygenase genes were identified from the EST libraries of Marchantia polymorpha, in order to clarify the function of LOXs in bryophytes. Full-length genes were isolated using 5'- and 3'-RACE methods and named MpLOX1, MpLOX2, and MpLOX3, respectively. To investigate the enzymatic activities of liverwort LOXs, recombinant MpLOX1, MpLOX2, and MpLOX3 proteins were prepared from Escherichia coli cells expressing the corresponding gene. LC-MS/MS analyses and chiral column chromatography of their reaction products showed that MpLOX1 codes for 11S/15S-lipoxygenase against eicosapentaenoic acid and for 15S-lipoxygenase against arachidonic acid, and that MpLOX2 and MpLOX3 code for 15S-lipoxygenase against eicosapentaenoic and arachidonic acids. Phylogenetic analysis showed that the liverwort lipoxygenase genes separated from the ancestor of higher plants in the early stages of plant evolution. Quantification analyses suggested that arachidonic acid and eicosapentaenoic acid were preferred substrates. Furthermore, each liverwort lipoxygenase exhibited highest activity at pH 7.0 and dependency on Ca(2+) ion in the oxygenation reaction.

Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering with introduction of bacterial phytoene synthase gene crtB.

Linseed flax (Linum usitatissimum L.) is an industrially important oil crop, which includes large amounts of alpha-linolenic acid (18:3) and lignan in its seed oil. We report here the metabolic engineering of flax plants to increase carotenoid amount in seeds. Agrobacterium-mediated transformation of flax was performed to express the phytoene synthase gene (crtB) derived from the soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3) under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter or the Arabidopsis thaliana fatty acid elongase 1 gene (FAE1) seed-specific promoter. As a result, eight transgenic flax plants were generated. They formed orange seeds (embryos), in which phytoene, alpha-carotene, and beta-carotene were newly accumulated in addition to increased amounts of lutein, while untransformed flax plants formed light-yellow seeds, in which only lutein was detected. Interestingly, despite the control of the CaMV 35S promoter, the expression of crtB was not observed in the leaves but in the seeds in the transgenic flax plants. Total carotenoid amounts in these seeds were 65.4-156.3 microg/g fresh weight, which corresponded to 7.8- to 18.6-fold increase, compared with those of untransformed controls. These results suggest that the flux of phytoene synthesis from geranylgeranyl diphosphate was first promoted by the expressed crtB gene product (CrtB), and then phytoene was consecutively decomposed to the downstream metabolites alpha-carotene, beta-carotene, and lutein, as catalyzed by endogenous carotenoid biosynthetic enzymes in seeds. The transgenic flaxseeds enriched with the carotenoids could be valuable as nutritional sources for human health.

Expression of the gene for sterol-biosynthesis enzyme squalene epoxidase in parenchyma cells of the oil plant, Euphorbia tirucalli.

In plants, phytosterols and triterpenes are major secondary metabolites. In an attempt to reveal the mechanism for synthesis and storage of these compounds, we isolated and characterized cDNA clones for squalene epoxidase (SE), from a succulent shrub, Euphorbia tirucalli. Southern-blot analysis of total DNA using cDNA fragment as a probe showed that the E. tirucalli squalene epoxidase gene (EtSE) is single-copy type in terms of restriction fragment length polymorphism (RFLP). Deduced amino-acid sequence of the cDNA showed 83 and 75% identity to those of rice and ginseng, respectively, in an area excluding a less homologous putative transmembrane region in the N-terminal end. Functional characterization with heterologous expression using an erg1-disrupted yeast mutant KLN1 indicated that the EtSE recovered ergosterol auxotrophy of the mutant, and gave rise to an ergosterol accumulation in the EtSE transformant. RT-PCR analysis showed the EtSE transcripts in leaves and stem internodes accumulated in almost equal amounts, which were more abundant than those in roots. In situ hybridization using EtSE antisense probe revealed prominent EtSE expression on a parenchyma cell adjacent to primary laticifers that were located in a rosary orientation in the inner region of cortex. This is the first report of expression of a gene for a rate-limiting enzyme in mevalonate pathway in organs and tissues of a plant.

Gene organization of the liverwort Y chromosome reveals distinct sex chromosome evolution in a haploid system.

Y chromosomes are different from other chromosomes because of a lack of recombination. Until now, complete sequence information of Y chromosomes has been available only for some primates, although considerable information is available for other organisms, e.g., several species of Drosophila. Here, we report the gene organization of the Y chromosome in the dioecious liverwort Marchantia polymorpha and provide a detailed view of a Y chromosome in a haploid organism. On the 10-Mb Y chromosome, 64 genes are identified, 14 of which are detected only in the male genome and are expressed in reproductive organs but not in vegetative thalli, suggesting their participation in male reproductive functions. Another 40 genes on the Y chromosome are expressed in thalli and male sexual organs. At least six of these genes have diverged X-linked counterparts that are in turn expressed in thalli and sexual organs in female plants, suggesting that these X- and Y-linked genes have essential cellular functions. These findings indicate that the Y and X chromosomes share the same ancestral autosome and support the prediction that in a haploid organism essential genes on sex chromosomes are more likely to persist than in a diploid organism.

Regulation of a carbon concentrating mechanism through CCM1 in Chlamydomonas reinhardtii.

Aquatic photosynthetic organisms, including the green alga, Chlamydomonas reinhardtii, induce a set of genes for a carbon concentrating mechanism (CCM) through the CO2-signalling system, to acclimate to CO2-limiting stress conditions. We have described a regulatory gene, Ccm1, which was shown to regulate CCM induction in C. reinhardtii. In this review, we summarize the current understanding of the regulatory process, which controls the expression of genes for the CCM. In particular, CCM1-regulated genes and possible functions of Ccm1 in the CO2-signalling pathway are discussed, in relation to findings in other green algae and cyanobacteria.

Cis-acting elements and DNA-binding proteins involved in CO2-responsive transcriptional activation of Cah1 encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii.

Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between -293 and -231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5'-upstream region from -651 to -231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5'-upstream region of Cah1 is discussed.