Retrospective analysis of the clinical manifestations and survival of Korean patients with mucopolysaccharidosis type II: emphasis on the cardiovascular complication and mortality cases.

Hunter syndrome (mucopolysaccharidosis II, MPS II) is a rare, X-linked disorder of glycosaminoglycan (GAG) catabolism caused by a deficiency in the activity of the lysosomal enzyme, iduronate-2-sulfatase (I2S). In this study, the medical records of 75 Korean patients with Hunter syndrome (74 males, 1 female) were retrospectively reviewed to investigate the frequency of organ involvement and survival at a single center. The three most common symptoms of organ involvement were hepatosplenomegaly (99%), facial dysmorphism (97%), and frequent otitis media (91%). Cardiovascular involvement was also common including valvular abnormalities (89%), left ventricular hypertrophy (68%), and hypertension (30%). The 19 patients who died had a median age of 16.8 years at the time of death. Four of them died within 1 year of the start of enzyme replacement therapy; autopsy showed myocardial infarction with severe coronary artery disease in one patient. Two other patients died due to pneumonia and sleep apnea. In one case, the cause of death was not investigated. The high incidence of hypertension, and the presence of valvular heart disease indicates that close cardiac monitoring is mandatory in all patients with Hunter syndrome, especially relatively older patients even if they are being treated with enzyme replacement therapy.

Enzyme replacement therapy improves joint motion and outcome of the 12-min walk test in a mucopolysaccharidosis type VI patient previously treated with bone marrow transplantation.

Mucopolysaccharidosis type VI (MPS VI; Maroteaux-Lamy syndrome, OMIM #253200) is a rare disorder involving multiple organs and manifested particularly by severe skeletal abnormalities. Bone marrow transplantation (BMT) improves cardiopulmonary function and facial features, but has limited success in ameliorating skeletal abnormalities and short stature. Here, we report the outcome of enzyme replacement therapy (ERT) with recombinant human arylsulfatase-B (ASB, Naglazyme, BioMarin, Novato, CA) in an MPS VI patient who received BMT 10 years prior to ERT induction. Administration of weekly Naglazyme for 18 months was effective in improving range of motion in several joints [shoulders (improvement of flexion (Right/Left): 40°/55°; improvement of extension 30°/40°; improvement of abduction 10°/10°), elbows (improvement of flexion 25°/25°; improvement of extension 10°/15°), hips (improvement of flexion 25°/10°), and knees (improvement of flexion 45°/40°; improvement of extension 50°/60°)]. Improvement in the outcome of the 12-min walk test (70% increase) and 3-min stair-climbing test (29% increase) was also noted after ERT. Because ERT improved clinical features in an MPS VI patient who had undergone prior BMT, the role of ERT post successful BMT in MPS VI needs further investigation.

A polymorphism in the growth hormone receptor is associated with height in children with Prader-Willi syndrome.

The exon-3 deletion polymorphism (d3, Database of Genomic Variants ID: Variation_64191) in the growth hormone receptor (GHR) gene is associated with increased growth response to growth hormone (GH) therapy in GH-deficient patients. However, an association of the GHR genotype with height has not yet been reported in Prader-Willi syndrome (PWS). The aim of this study was to assess the association of GHR alleles with height before starting GH therapy in patients with PWS. Seventy-four patients with PWS were genotyped and their medical records were retrospectively reviewed (45 males and 29 females, median age 8.7 years). One hundred normal controls, with known final height, were also genotyped. The GH-exon 3 locus was genotyped using a PCR multiplex assay. The distribution of alleles in the patients with PWS was not different from controls [(fl/fl n = 53 (72%), fl/d3 n = 21 (28%)) in PWS vs. (fl/fl n = 72(72%), fl/d3 n = 26(26%), and d3/d3 n = 2(2%)]. However, patients with PWS carrying a d3 allele had significantly greater height standard deviation scores (SDS) (P = 0.025) and higher insulin-like growth factor I (IGF-I) level (P = 0.041), although the age at the start of GH therapy, weight, BMI, and body fat were not different. The d3 allele was associated with height and IGF-I levels before GH therapy and suggests that even before GH therapy, d3 allele may influence height through GH secretion.

Renal function after tandem high-dose chemotherapy and autologous stem cell transplantation in children with Wilms tumor.

Despite increasing evidence that tandem HDCT and autoSCT might improve the survival of patients with high-risk solid tumors, patients with Wilms tumor may be at high risk of acute and chronic renal impairment during and after tandem HDCT/autoSCT because they usually have a single kidney. We investigated the feasibility of tandem HDCT/autoSCT in patients with Wilms tumor, focusing on renal function. Six patients with relapsed/progressed Wilms tumor were assigned to undergo tandem HDCT/autoSCT. One patient developed transient ARF during the first HDCT/autoSCT. All other patients underwent the second HDCT/autoSCT as scheduled. Acute renal dysfunction during the second HDCT/autoSCT was transient and manageable. Indicators of glomerular function such as creatinine clearance, serum creatinine, and albumin excretion were in the normal range at three yr after tandem HDCT/autoSCT. Subclinical tubular dysfunctions, such as increased excretion of ß-N-acetylglucosaminidase and ß2-microglobulin, were identified at one and three yr after tandem HDCT/autoSCT; however, no patient required treatment for these conditions. These results are helpful to consider tandem HDCT/autoSCT as a treatment option in patients with Wilms tumor. Longer duration of follow-up and close monitoring of tubular function are required if tandem HDCT/autoSCT is indicated in patients with Wilms tumor.

The impact of inflammation on bone mass in children.

Bone is a dynamic tissue. Skeletal bone integrity is maintained through bone modeling and remodeling. The mechanisms underlying this bone mass regulation are complex and interrelated. An imbalance in the regulation of bone remodeling through bone resorption and bone formation results in bone loss. Chronic inflammation influences bone mass regulation. Inflammation-related bone disorders share many common mechanisms of bone loss. These mechanisms are ultimately mediated through the uncoupling of bone remodeling. Cachexia, physical inactivity, pro-inflammatory cytokines, as well as iatrogenic factors related to effects of immunosuppression are some of the common mechanisms. Recently, cytokine signaling through the central nervous system has been investigated for its potential role in bone mass dysregulation in inflammatory conditions. Growing research on the molecular mechanisms involved in inflammation-induced bone loss may lead to more selective therapeutic targeting of these pathological signaling pathways.

Serum cystatin C for estimation of residual renal function in children on peritoneal dialysis.

Residual renal function (RRF) is an important parameter in the management of patients on chronic dialysis. The aim of this cross-sectional study was to determine the efficacy of serum cystatin C (CysC) for RRF estimation in 20 children (16 boys, 4 girls; median age 13.4 years) undergoing peritoneal dialysis (PD). For studies of correlation with serum CysC, the average of creatinine clearance rate (Ccr) and urea clearance rate (Curea), Kt/Vurea, and weekly Ccr were evaluated as parameters reflecting RRF. The serum CysC level was found to be negatively correlated with urine volume (r=-0.717, P<0.001), average of Ccr and Curea (r=-0.851, P<0.001), total and renal weekly Ccr (r=-0.795, P<0.001; r=-0.845, P<0.001, respectively), and renal Kt/Vurea (r=-0.793, P<0.001) and positively correlated with peritoneal weekly Ccr (r=0.738, P<0.001) and peritoneal Kt/Vurea (r=0.785, P<0.001). There was no significant association with total Kt/Vurea (r=-0.335, P=0.148). In non-anuric group of patients, serum CysC had no link to peritoneal Kt/Vurea (r=0.573, P=0.066), but was negatively correlated with renal Kt/Vurea (r=-0.609, P=0.047). In the multiple regression analysis, renal Kt/Vurea significantly contributed to log CysC concentration rather than peritoneal Kt/Vurea. The results of this study suggest that serum CysC could be an appropriate marker for RRF, independent of total and peritoneal Kt/Vurea.

Successful therapeutic plasma exchange in a 3.2-kg body weight neonate with atypical hemolytic uremic syndrome.

Atypical hemolytic uremic syndrome (aHUS) is a rare form of complement dysregulation disease, and recently various reports have shown that it is associated with one or more mutations in the complement regulatory genes including complement factor H (CFH). Plasma exchange is a therapeutic option for adult patients, but not for a very young infant because of a potential side effect of therapeutic plasma exchange (TPE) itself. Herein, we describe a case of successful treatment of early onset aHUS associated with a novel CFH mutation with total 21 sessions of TPE over a period of 46 days in 3.2 kg 23-day-old neonate.

A mother and daughter with the p.R443X mutation of mucopolysaccharidosis type II: Genotype and phenotype analysis.

Mucopolysaccharidosis type II (Hunter syndrome) is a lysosomal storage disease caused by a deficiency of iduronate-2-sulfatase. Most reported patients are males because of X-linked recessive inheritance pattern. Only a few female patients with Hunter syndrome have been reported, and there is no prior report of offspring from a patient with Hunter syndrome. In this report, we describe a woman with mild manifestations of Hunter syndrome who gave birth to a daughter. Both the mother and daughter carried the p.R443X mutation in exon 9 of the ID2S gene. Iduronate-2-sulfatase activity in the mother was as low as that found in male Hunter syndrome patients, but it was in the low-normal range in her daughter. Unlike her mother, the daughter did not show any physical signs of Hunter syndrome, and urinary excretion of glycosaminoglycan was within normal range. However, she had severe pulmonary vein stenosis with pulmonary hypertension and a large atrial septal defect and died at 11 months of age.

Plasma adiponectin level and sleep structures in children with Prader-Willi syndrome.

Adiponectin, an adipose tissue-derived hormone, has been negatively related to obstructive sleep apnea syndrome. Besides sleep apnea, children with Prader-Willi syndrome (PWS) may have excessive daytime sleepiness and rapid eye movement (REM) sleep abnormality. The aim of this study is to determine whether changes in sleep structures are related to plasma adiponectin levels in PWS. Correlations between adiponectin level and sleep variables were analyzed in 28 children with PWS and 18 controls. Overnight polysomnography was performed. The fasting plasma adiponectin levels were higher in the children with PWS than in the controls (P = 0.0006). In the PWS, Epworth sleepiness scale was significantly higher (P = 0.002); sleep latency (P = 0.003) and REM latency (P = 0.001) were significantly shortened; the apnea-hypopnea index (AHI) was significantly increased (P = 0.0001); and the duration of non-rapid eye movement (NREM) sleep stages 3 and 4 was decreased (P = 0.005). Multiple regression analysis revealed correlations between the adiponectin level and the total sleep time (beta = 0.688, P = 0.009), AHI (beta = 1.274, P = 0.010), REM latency (beta = -0.637, P = 0.021) and the percentage of NREM sleep (beta = -7.648, P = 0.002) in PWS. In children with PWS, higher plasma adiponectin levels were independently associated with several sleep variables, which was not observed in the control group. These results suggest a potential influence of elevated adiponectin level on the sleep structures in PWS.

Inflammation and cachexia in chronic kidney disease.

Chronic inflammation is associated with cachexia and increased mortality risk in patients with chronic kidney disease (CKD) and end-stage renal disease (ESRD). Inflammation suppresses appetite and causes the loss of protein stores. In CKD patients, increased serum levels of pro-inflammatory cytokines may be caused by reduced renal function, volume overload, oxidative or carbonyl stress, decreased levels of antioxidants, increased susceptibility to infection in uremia, and the presence of comorbid conditions. Cachexia is brought about by the synergistic combination of a dramatic decrease in appetite and an increase in the catabolism of fat and lean body mass. Pro-inflammatory cytokines act on the central nervous system to alter appetite and energy metabolism and to provide a signal-through the nuclear factor-kappaB and ATP-ubiquitin-dependent proteolytic pathways-that causes muscle wasting. Further research into the molecular pathways leading to inflammation and cachexia may lead to novel therapeutic therapies for this devastating and potentially fatal complication of chronic disease.

Comparative study of the effects of different growth hormone doses on growth and spatial performance of hypophysectomized rats.

This study was designed to examine the effects of recombinant human growth hormone replacement on somatic growth and cognitive function in hypophysectomized (HYPOX) female Sprague-Dawley rats. Rats (5 per group) were randomized by weight to 3 experimental groups: group 1, administered 200 microg/kg of GH once daily for 9 days; group 2, administered 200 microg/kg of GH twice daily; and group 3, administered saline daily. Somatic growth was evaluated by measurement of body weight daily and of the width of the proximal tibial growth plate of the HYPOX rats. Cognitive function was evaluated using the Morris water maze (MWM) test. The results indicated that GH replacement therapy in HYPOX rats promoted an increase in the body weight and the width of the tibial growth plate in a dose-dependent manner. On the third day of the MWM test, the escape latency in the GH-treated groups 1 and 2 was significantly shorter than that in the control rats (P<0.001 and P=0.032, respectively), suggesting that rhGH improved spatial memory acquisition in the MWM test. Therefore it is concluded that rhGH replacement therapy in HYPOX rats stimulates an increase in somatic growth in a dose-dependent manner and also has beneficial effects on cognitive functions.

Development of Korean Academy of Medical Sciences Guideline rating the physical impairment; kidney, bladder, urethra, male and female reproductive systems (preliminary report).

For the evaluation of the kidney impairment, serum creatinine concentrations or glomerular filtration rates are mainly used, and the conditions of solitary or transplanted kidney and chronic dialysis are also taken into the considerations. Some symptoms and signs of the chronic renal disability in spite of adequate treatment add one additional grade. For evaluating bladder and urethral impairment, the criteria include voiding symptoms and signs. The patients with urinary diversions have impairment grades depending on the alteration of upper urinary tract function. For penile impairment, the degrees are evaluated using the international index of erectile function, nocturnal penile tumescence and color doppler ultrasonography. For evaluating impairment of other male reproductive organs, functional and anatomical changes of these organs, analysis of the semen or hormones and the state of solitary testis are used as the criteria. For evaluating impairment of female reproductive organs, pregnancy potential, requirement of continuous treatment and the ability of sexual intercourse are used. Also, degree of impairment is modified according to the ages in evaluating female reproductive systems. We have tried to make this evaluation system objective, scientific, and convenient, but still find it leaving much to be desired.

Obestatin is not elevated or correlated with insulin in children with Prader-Willi syndrome.

CONTEXT: Obestatin is a peptide hormone derived from the proteolytic cleavage of ghrelin preprohormone. In Prader-Willi syndrome (PWS), the levels of total ghrelin (TG) and acylated ghrelin (AG) are increased, and these hormones are regulated by insulin. OBJECTIVE: Our objective was to analyze the changes in the obestatin levels after glucose loading and to characterize the correlations of obestatin with TG, AG, and insulin. DESIGN: Plasma obestatin, TG, AG, and insulin levels were measured in PWS children (n = 15) and controls (n = 18) during an oral glucose tolerance test. SETTING: All subjects were admitted to the Samsung Medical Center. INTERVENTIONS: An oral glucose tolerance test was performed after an overnight fast. MAIN OUTCOME MEASURES: The plasma levels of obestatin, TG, AG, and serum insulin were measured at 0, 30, 60, 90, and 120 min after glucose challenge, and areas under the curves (AUCs) were calculated. RESULTS: No significant difference in AUC of the plasma obestatin was found between the PWS children and normal obese controls (P = 0.885), although AUC of AG (P = 0.002) and TG (P = 0.003) were increased in the PWS children. Moreover, There was a negative correlation between the AUC of AG and AUC of insulin both in PWS (r = -0.432; P = 0.049) and in controls (r = -0.507; P = 0.016). However, AUC of obestatin was not significantly correlated with AUC of insulin (in PWS, r = 0.168 and P = 0.275; in controls, r = -0.331 and P = 0.09). CONCLUSIONS: Our results indicate that plasma obestatin is not elevated in PWS children and is not regulated by insulin both in PWS children and in obese controls.

Suppression of acylated ghrelin during oral glucose tolerance test is correlated with whole-body insulin sensitivity in children with Prader-Willi syndrome.

CONTEXT: Decreased fasting ghrelin levels and decreased ghrelin suppression in overweight children have been reported to be associated with insulin resistance. However, Prader-Willi syndrome (PWS) is associated with increased total ghrelin levels and relative hypoinsulinemia. OBJECTIVE: The objective of the study was to analyze changes in acylated ghrelin (AG) and des-acylated ghrelin (DAG) levels after glucose loading and characterize correlations between insulin sensitivity and ghrelin suppression. DESIGN: Plasma glucose, insulin, AG, and DAG levels were measured in PWS children (n = 11) and normal obese controls (n = 10) during oral glucose tolerance testing. SETTING: All subjects were admitted to the Samsung Medical Center. INTERVENTIONS: Oral glucose tolerance testing was performed in all subjects after an overnight fast. MAIN OUTCOME MEASURES: Plasma levels of the hormones AG, DAG, and insulin, and those of glucose at 0, 30, 60, 90, and 120 min after glucose challenge were measured, and whole-body insulin sensitivity index (WBISI) values were calculated. RESULTS: AG levels fell markedly more from fasting levels in PWS children than normal healthy obese controls at 30, 60, and 90 min after glucose challenge, but no significant differences in DAG levels were observed at any time between PWS patients and controls. Fasting AG and DAG levels were found to correlate with WBISI in PWS, and absolute suppressions (Delta from baseline) in AG at 30 min after glucose challenge (nadir) were also correlated with WBISI in PWS (r = 0.64, P = 0.035). CONCLUSIONS: Our results suggest that AG is sensitively suppressed by insulin and that this suppression correlated with insulin sensitivity in PWS children.

Regional cerebral glucose metabolic abnormality in Prader-Willi syndrome: A 18F-FDG PET study under sedation.

UNLABELLED: Prader-Willi syndrome (PWS) is a genetic disorder caused by the nonexpression of paternal genes in the PWS region of chromosome 15q11-13 and is the most common cause of human syndromic obesity. METHODS: We investigated regional brain metabolic impairment in children with PWS by 18F-FDG PET. Sixteen children with PWS (9 males, 7 females; mean age +/- SD, 4.2 +/- 1.1 y) and 7 healthy children (4 males, 3 females; mean age +/- SD, 4.0 +/- 1.7 y) underwent brain 18F-FDG PET in the resting state. The images of PWS children were compared using statistical parametric mapping analysis with those of healthy children in a voxelwise manner. RESULTS: Group comparison showed that children with PWS had decreased glucose metabolism in the right superior temporal gyrus and left cerebellar vermis, regions that are associated with taste perception/food reward and cognitive and emotional function, respectively. Metabolism was increased in the right orbitofrontal, bilateral middle frontal, right inferior frontal, left superior frontal, and bilateral anterior cingulate gyri, right temporal pole, and left uncus, regions that are involved in cognitive functions related to eating or obsessive-compulsive behavior. Interestingly, no significant metabolic abnormality was found in the hypothalamus, the brain region believed to be most involved in energy intake and expenditure. CONCLUSION: This study describes the neural substrate underlying the abnormal eating behavior and psychobehavioral problems of PWS.

Identification of mutations in the GNPTA (MGC4170) gene coding for GlcNAc-phosphotransferase alpha/beta subunits in Korean patients with mucolipidosis type II or type IIIA.

Mucolipidosis types II and III are autosomal recessive inherited diseases caused by a deficiency in the lysosomal enzyme N-acetylglucosamine-1 phosphotransferase (GlcNAc-phosphotransferase), which adds phosphate to function as a recognition marker for the uptake and transport of lysosomal enzymes. We investigated mutations in the GNPTA (MGC4170) gene, which codes for the alpha/beta subunits of phosphotransferase, and in the GNPTAG gene, which codes for its gamma subunits in five Korean patients with mucolipidosis type II or IIIA. We identified seven mutations in the GNPTA gene, but none in GNPTAG. The mutations in type II patients included p.Q104X (c.310C>T), p.R1189X (c.3565C>T), p.S1058X (c.3173C>G), p.W894X (c.2681G>A), and p.H1158fsX15 (c.3474_3475delTA), all of which are nonsense or frameshift mutations. However, a splicing site mutation, IVS13+1G>A (c.2715+1G>A) was detected along with a nonsense or a frameshift mutation (p.R1189X or p.E858fsX3 (c.2574_2575delGA)) in two mucolipidosis type IIIA patients. This report shows that mutations in the GNPTA gene coding for the alpha/beta subunits of phosphotransferase, and not mutations in the GNPTAG gene, account for most of the genetic mutations found in Korean patients with mucolipidosis type II or IIIA.

Increased density of ghrelin-expressing cells in the gastric fundus and body in Prader-Willi syndrome.

CONTEXT: The levels of ghrelin, an orexigenic hormone secreted by oxyntic cells in the digestive tract, are elevated in Prader-Willi syndrome (PWS) and GH deficiency (GHD) patients. In this study, we hypothesized that the hyperghrelinemia observed in PWS is related to IGF-I or GH/IGF axis deficiency. DESIGN: We investigated the densities of ghrelin-expressing cells (GECs), the amounts of ghrelin in gastric tissues, and ghrelin levels in plasma in 16 PWS patients and compared these results with those of 13 GHD patients and comparison groups (19 normal lean and 10 normal obese subjects). RESULTS: In the gastric body and fundus, 2- to 3-fold increases in the numbers of GECs (P < 0.001) and in the amounts of ghrelin (P < 0.018) were noted in PWS patients vs. comparison groups, whereas GEC numbers in GHD patients were similar to those of the comparison group despite elevated fasting plasma ghrelin levels. In addition, IGF-I sd scores in PWS were not found to be correlated with GEC densities, the amounts of ghrelin expressed in gastric tissues, or plasma ghrelin levels. CONCLUSIONS: Our results suggest that IGF-I or GH/IGF axis deficiency appears to be unrelated to observed GEC increases in the stomach of patients with PWS.

Hyperghrelinemia does not accelerate gastric emptying in Prader-Willi syndrome patients.

Prader-Willi syndrome (PWS) is the most common form of syndromic obesity associated with hyperphagia. Because ghrelin stimulates gastric motility in rodents, and PWS patients have 3- to 4-fold higher fasting plasma ghrelin concentrations than normal subjects, we hypothesized that hyperphagia associated with PWS may be partly explained by rapid gastric emptying due to the increased gastric motility caused by ghrelin. We determined gastric emptying times (GETs) and measured ghrelin levels in 11 PWS children and 11 age-, sex-, and body mass index-matched controls using a standard meal containing [(99m)Tc]diaminetriaminepentacetate. Median plasma ghrelin levels before (precibum) and after the GET study were higher in PWS patients than in controls (P = 0.004 and P = 0.001, respectively). Median percent gastric retentions at 90 min after the standard meal were 57.1% (range, 34.0-83.2%) in PWS patients and 40.2% (range, 27.2-60.2%) in controls (P = 0.03). In particular, precibum ghrelin concentrations were not significantly correlated with the rate of gastric emptying in PWS patients (P = 0.153; r = 0.461) or controls (P = 0.911; r = 0.048). Our results show that gastric emptying in PWS is reduced despite higher ghrelin levels, and that the voracious appetite associated with PWS is related to another mechanism.

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

Correlation between fasting plasma ghrelin levels and age, body mass index (BMI), BMI percentiles, and 24-hour plasma ghrelin profiles in Prader-Willi syndrome.

Ghrelin is a GH-releasing acylated peptide found in the stomach and a centrally acting food intake stimulator. Prader-Willi syndrome (PWS) is a genetic disorder characterized by a voracious appetite and increased fasting ghrelin levels. In this report we describe 24-h ghrelin profiles in PWS children (n = 5) and compare these with age, sex, and body mass index (BMI)-matched controls (n = 5). A 3- to 4-fold increase in ghrelin levels was found in PWS over a 24-h period, compared with controls (P < 0.001). Interestingly, there was a greater tendency for the up-regulation of ghrelin level in lean PWS than in obese PWS. To confirm this finding, we measured fasting ghrelin levels in 39 patients with PWS. Inverse correlations were found between plasma ghrelin levels and the following: age (r = -0.408, P = 0.005), BMI (r = -0.341, P = 0.017), percentage of the ideal weight for age (r = -0.382, P = 0.008), and BMI percentile (r = -0.311, P = 0.027). Our data show that there may be a suppressive (or up-regulating) controlling mechanism of ghrelin secretion in obese (or lean) PWS children. We hope that our data may further explain the mechanisms underlying the insatiable appetite and obesity characteristic of PWS.