Pseudomonas fragariae sp. nov., a novel bacterial species causing leaf spots on strawberry (Fragaria×ananassa).

In Florida, angular leaf spot, caused by Xanthomonas fragariae, was the only known bacterial disease in strawberry, which is sporadic and affects the foliage and calyx. However, from the 2019-2020 to 2023-2024 Florida strawberry seasons, unusual bacterial-like symptoms were observed in commercial farms, with reports of up to 30 % disease incidence. Typical lesions were water-soaked and angular in early stages that later became necrotic with a circular-ellipsoidal purple halo, and consistently yielded colonies resembling Pseudomonas on culture media. Strains were pathogenic on strawberry, fluorescent, oxidase- and arginine-dihydrolase-negative, elicited a hypersensitive reaction on tobacco, and lacked pectolytic activity. Although phenotypic assays, such as fatty acid methyl profiles and Biolog protocols, placed the strains into the Pseudomonas group, there was a low similarity at the species level. Further analysis using 16S rRNA genes, housekeeping genes, and whole genome sequencing showed that the strains cluster into the Pseudomonas group but do not share more than 95 % average nucleotide identity compared to representative members. Therefore, the genomic and phenotypic analysis confirm that the strains causing bacterial spot in strawberry represent a new plant pathogenic bacterial species for which we propose the name Pseudomonas fragariae sp. nov. with 20-417T (17T=LMG 32456T=DSM 113340 T) as the type strain, in relation to Fragaria×ananassa, the plant species from which the pathogen was first isolated. Future work is needed to assess the epidemiology, cultivar susceptibility, chemical sensitivity, and disease management of this possible new emerging strawberry pathogen.

Elucidating the Mode of Action of Hybrid Nanoparticles of Cu/Zn Against Copper-Tolerant Xanthomonas euvesicatoria.

The widespread presence of tolerance to copper in Xanthomonas species has resulted in the need to develop alternative approaches to control plant diseases caused by xanthomonads. In recent years, nanotechnological approaches have resulted in the identification of novel materials to control plant pathogens. With many metal-based nanomaterials having shown promise for disease control, an important question relates to the mode of action of these new materials. In this study, we used several approaches, such as scanning electron microscopy, propidium monoazide quantitative polymerase chain reaction, epifluorescence microscopy, and RNA sequencing to elucidate the mode of action of a Cu/Zn hybrid nanoparticle against copper-tolerant strains of Xanthomonas euvesicatoria. We demonstrate that Cu/Zn did not activate copper resistance genes (i.e., copA and copB) in the copper-tolerant bacterium but functioned by disrupting the bacterial cell structure and perturbing important biological processes such as cell respiration and chemical homeostasis.

TOMMicroNet: Convolutional Neural Networks for Smartphone-Based Microscopic Detection of Tomato Biotic and Abiotic Plant Health Issues.

The image-based detection and classification of plant diseases has become increasingly important to the development of precision agriculture. We consider the case of tomato, a high-value crop supporting the livelihoods of many farmers around the world. Many biotic and abiotic plant health issues impede the efficient production of this crop, and laboratory-based diagnostics are inaccessible in many remote regions. Early detection of these plant health issues is essential for efficient and accurate response, prompting exploration of alternatives for field detection. Considering the availability of low-cost smartphones, artificial intelligence-based classification facilitated by mobile phone imagery can be a practical option. This study introduces a smartphone-attachable 30× microscopic lens, used to produce the novel tomato microimaging data set of 8,500 images representing 34 tomato plant conditions on the upper and lower sides of leaves as well as on the surface of tomato fruits. We introduce TOMMicroNet, a 14-layer convolutional neural network (CNN) trained to classify biotic and abiotic plant health issues, and we compare it against six existing pretrained CNN models. We compared two separate pipelines of grouping data for training TOMMicroNet, either presenting all data at once or separating the data into subsets based on the three parts of the plant. Comparing configurations based on cross-validation and F1 scores, we determined that TOMMicroNet attained the highest performance when trained on the complete data set, with 95% classification accuracy on both training and external data sets. Given TOMMicroNet's capabilities when presented with unfamiliar data, this approach has potential for the identification of plant health issues.

Whole-Genome-Sequence-Based Classification of Xanthomonas euvesicatoria pv. eucalypti and Computational Analysis of the Type III Secretion System.

Xanthomonas spp. infect a wide range of annual and perennial plants. Bacterial blight in young seedlings of Eucalyptus spp. in Indonesia was originally identified as X. perforans. However, these strains failed to elicit a hypersensitive response (HR) on either tomatoes or peppers. Two of the strains, EPK43 and BCC 972, when infiltrated into tomato and pepper leaves, failed to grow to significant levels in comparison with well-characterized X. euvesicatoria pv. perforans (Xp) strains. Furthermore, spray inoculation of 'Bonny Best' tomato plants with a bacterial suspension of the Eucalyptus strains resulted in no obvious symptoms. We sequenced the whole genomes of eight strains isolated from two Eucalyptus species between 2007 and 2015. The strains had average nucleotide identities (ANIs) of at least 97.8 with Xp and X. euvesicatoria pv. euvesicatoria (Xeu) strains, both of which are causal agents of bacterial spot of tomatoes and peppers. A comparison of the Eucalyptus strains revealed that the ANI values were >99.99% with each other. Core genome phylogeny clustered all Eucalyptus strains with X. euvesicatoria pv. rosa. They formed separate clades, which included X. euvesicatoria pv. alangii, X. euvesicatoria pv. citrumelonis, and X. euvesicatoria pv. alfalfae. Based on ANI, phylogenetic relationships, and pathogenicity, we designated these Eucalyptus strains as X. euvesicatoria pv. eucalypti (Xee). Comparative analysis of sequenced strains provided unique profiles of type III secretion effectors. Core effector XopD, present in all pathogenic Xp and Xeu strains, was absent in the Xee strains. Comparison of the hrp clusters of Xee, Xp, and Xeu genomes revealed that HrpE in Xee strains was very different from that in Xp and Xeu. To determine if it was functional, we deleted the gene and complemented with the Xee hrpE, confirming it was essential for secretion of type III effectors. HrpE has a hypervariable N-terminus in Xanthomonas spp., in which the N-terminus of Xee strains differs significantly from those of Xeu and Xp strains.

Phenotypic and Genetic Diversity of Xanthomonads Isolated from Pepper (Capsicum spp.) in Taiwan from 1989 to 2019.

Bacterial spot caused by Xanthomonas spp. is an economically important disease of pepper causing significant yield losses in Taiwan. Monitoring the pathogen population on a continuous basis is necessary for developing disease management strategies. We analyzed a collection of xanthomonad strains isolated from pepper in Taiwan between 1989 and 2019. Among the sequenced genomes, 65 were identified as Xanthomonas euvesicatoria, and 10 were X. perforans. Thirty-five X. euvesicatoria and 10 X. perforans strains were copper tolerant, whereas only four X. euvesicatoria and none of the X. perforans strains were tolerant to streptomycin. Nine X. euvesicatoria strains were amylolytic, which is considered an unusual characteristic for X. euvesicatoria. Bayesian analysis of the population structure based on core gene single-nucleotide polymorphisms clustered the strains into five clusters for X. euvesicatoria and three clusters for X. perforans. One X. perforans cluster, designated as TP-2019, appears to be a novel genetic cluster based on core genes, accessory gene content, and effector profile. This knowledge of pathogen diversity with whole genomic information will be useful in future comparative studies and in improving breeding programs to develop disease-resistant cultivars and other disease management options.

A multiplex RT-qPCR assay for simultaneous detection of cucurbit viruses from individual whitefly and plant samples.

Whiteflies (Bemisia tabaci) are a significant pest of cucurbits and vectors many viruses leading to substantial economic losses. Modern diagnostic tools offer the potential for early detection of viruses in the whiteflies before crop production. One such tool is the multiplex reverse transcriptase quantitative PCR (RT-qPCR) probe-based technique, which can detect multiple targets in a single reaction and simultaneously quantify the levels of each target, with a detection limit of 100 copies per target. In this study, a multiplex RT-qPCR-based detection system capable of identifying one DNA virus and three RNA viruses in whiteflies: cucurbit leaf crumple virus (CuLCrV), cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and squash vein yellowing virus (SqVYV) was developed. To ensure the reliability of the assay, an internal gene control as the fifth target to monitor false-negative results was incorporated. This newly developed molecular diagnostic tool possesses several advantages. It can detect up to five desired targets from a single whitefly RNA sample, even at concentrations as low as 1 ng/µl. To evaluate its sensitivity, we conducted experiments using serially diluted cloned plasmids and in vitro transcribed RNA transcripts of the target viruses. We also assessed the specificity of the assay by including aphid-transmitted viruses and other viruses known to infect cucurbits. The diagnostic method successfully detected all five targets simultaneously and allowed for the quantification of up to 100 copies using a mixture of healthy? RNA and in vitro transcribed RNA. Our aim with this study was to develop a highly specific and sensitive one-step multiplex RT-qPCR system for the simultaneous detection of viruses transmitted by whiteflies in cucurbits. This system offers significant advantages for early detection, enabling prompt control measures to mitigate the further spread of viral infections and reduce yield losses. Additionally, we demonstrated the ability to simultaneously detect mixed viruses (CCYV, CYSDV, CuLCrV, and SqVYV) in individual whiteflies and quantify the number of viral copies carried by each whitefly. The multiplex RT-qPCR assay outperforms currently available techniques for detecting many samples at a given time and can be effectively utilized for early monitoring of plant viruses in individual whiteflies and symptomless plants.

Unexpected Diversity of Pseudomonads Associated with Bacterial Leaf Spot of Cucurbits in the Southeastern United States.

Bacterial leaf spot of cucurbits (BLS) is an emerging disease in the southeastern United States that is capable of causing widespread outbreaks under conducive conditions. Historically attributed solely to the bacterium Pseudomonas syringae pv. lachrymans, recent studies have identified additional P. syringae pathovars as causal agents of the disease. To further investigate the identity and diversity of P. syringae strains associated with BLS in the southeastern United States, 47 bacterial isolates were recovered from symptomatic cucurbits from Florida, Alabama, and Georgia. Strains were characterized using the LOPAT testing scheme, fluorescence, and pathogenicity to watermelon and squash seedlings. Thirty-eight fluorescent isolates underwent whole-genome sequencing and were further characterized with 16S rRNA, four gene multilocus sequence analysis (MLSA) phylogeny, and average nucleotide identity analysis. Thirty-four isolates were identified as members of the P. syringae species complex, including P. syringae sensu stricto (12), P. alliivorans (12), P. capsici (nine), and P. viridiflava (one). An additional four isolates were found to belong to the Pseudomonas genus outside of the syringae species complex, though they did not share 95% or greater average nucleotide identity to any validly published species and are believed to belong to three novel Pseudomonas species. These results reveal an unpredicted level of diversity of Pseudomonas strains associated with BLS in the region and show the benefits of whole-genome sequencing for strain identification. Identification of P. capsici, which is capable of causing disease at higher temperatures than P. syringae, as a causal agent of BLS may also affect management strategies in the future.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Improved Persistence of Bacteriophage Formulation with Nano N-Acetylcysteine-Zinc Sulfide and Tomato Bacterial Spot Disease Control.

Bacteriophages are biocontrol agents used to manage bacterial diseases. They have long been used against plant pathogenic bacteria; however, several factors impede their use as a reliable disease management strategy. Short-lived persistence on plant surfaces under field conditions results mainly from rapid degradation by exposure to ultraviolet (UV) light. Currently, there are no effective commercial formulations that protect phages from UV. The phage ΦXp06-02-1, which lyses strains of the tomato bacterial spot pathogen Xanthomonas perforans, was mixed with different concentrations of the nanomaterial N-acetylcysteine surface-coated manganese-doped zinc sulfide (NAC-ZnS; 3.5 nm). In vitro, NAC-ZnS at 10,000 µg/ml formulated phage, when exposed to UV for 1 min, provided statistically equivalent plaque-forming unit (PFU) recovery as phages that were not exposed to UV. NAC-ZnS had no negative effect on the phage's ability to lyse bacterial cells under in vitro conditions. NAC-ZnS reduced phage degradation over time in comparison with the nontreated control, whereas N-acetylcysteine-zinc oxide (NAC-ZnO) had no effect. In fluorescent light, without UV exposure, NAC-ZnO-formulated phages were more infective than NAC-ZnS-formulated phages. The nanomaterial-phage mixture did not cause any phytotoxicity when applied to tomato plants. Following exposure to sunlight, the NAC-ZnS formulation improved phage persistence in the phyllosphere by 15 times compared with nonformulated phages. NAC-ZnO-formulated phage populations were undetectable within 32 h, whereas NAC-ZnS-formulated phage populations were detected at 103 PFU/g. At 4 h of sunlight exposure, NAC-ZnS-formulated phages at 1,000 µg/ml significantly reduced tomato bacterial spot disease severity by 16.4% compared with nonformulated phages. These results suggest that NAC-ZnS can be used to improve the efficacy of phages for bacterial diseases.

Novel magnesium-copper hybrid nanomaterials for management of bacterial spot of tomato.

Bacterial spot of tomato (BST), predominantly caused by Xanthomonas perforans (Xp) in Florida, is one of the most devastating diseases in hot, humid environments. Bacterial resistance to copper-based bactericides and antibiotics makes disease management extremely challenging. This necessitates alternative solutions to manage the disease. In this study, we used two novel hybrid copper and magnesium nanomaterials noted as magnesium double-coated (Mg-Db) and magnesium-copper (Mg-Cu), to manage BST. In in vitro experiments, no viable cells were recovered following 4 h exposure to 500 µg/ml of both Mg-Db and Mg-Cu, while 100 and 200 µg/ml required 24 h of exposure for complete inhibition. In viability assay using live/dead cell straining method and epifluorescence microscopy, copper tolerant Xp cells were killed within 4 h by both Mg-Cu and Mg-Db nanomaterials at 500 µg/ml, but not by copper hydroxide (Kocide 3000). In the greenhouse, Mg-Db and Mg-Cu at 100-500 µg/ml significantly reduced BST severity compared to micron-sized commercial Cu bactericide Kocide 3000 and the growers' standard (copper hydroxide + mancozeb) (P < 0.05). In field studies, Mg-Db and Mg-Cu nanomaterials significantly reduced disease severity in two out for field trials. Mg-Db at 500 µg/ml reduced BST severity by 34% compared to the non-treated control without affecting yield in Fall, 2020. The use of hybrid nanomaterials at the highest concentrations (500 µg/ml) used in the field experiments can reduce copper use by 90% compared to the growers' standard. In addition, there was no phytotoxicity observed with the use of hybrid nanomaterials in the field. These results suggest the potential of novel magnesium-copper based hybrid nanomaterials to manage copper-tolerant bacterial pathogens.

Pseudomonas californiensis sp. nov. and Pseudomonas quasicaspiana sp. nov., isolated from ornamental crops in California.

Five bacterial strains were isolated from symptomatic leaves of Achillea millefolium, Delphinium sp. and Hydrangea sp. in California. Colonies isolated on King's medium B (KMB) appeared white, mucoid and round, similar to Pseudomonas species. Phylogenetic analyses based on 16S rRNA, rpoB, rpoD and gyrB genes placed the bacteria into three distinct groups within Pseudomonas that were most closely related to Pseudomonas viridiflava, Pseudomonas cichorii or Pseudomonas caspiana. To further characterize the strains, phenotypic analyses and the following tests were performed: fatty acid methyl ester composition, LOPAT, fluorescence on KMB, Biolog assay, and transmission electron microscopy. Finally, whole genome sequencing of the strains was conducted, and the sequences were compared with reference genomes of Pseudomonas species based on average nucleotide identity (ANI). The first group, which consists of three strains isolated from delphinium, hydrangea and achillea, had 95.6-96.9 % pairwise ANI between each other; the second group consists of two strains isolated from delphinium that had 100 % pairwise ANI. Although comparisons of the two groups with publicly available genomes revealed closest relationships with P. viridiflava (91.6 %), P. caspiana (88.3 %) and P. asturiensis (86.7 %), ANI values were less than 95 % compared to all validly published pseudomonads. Combining genomic and phenotypic data, we conclude that these strains represent two new species and the names proposed are Pseudomonas quasicaspiana sp. nov. (type strain DSMZ 11 30 42T=LMG 32 434T) for the strains isolated from delphinium, achillea and hydrangea and Pseudomonas californiensis sp. nov. (DSMZ 11 30 43T=LMG 32 432T) for the two strains isolated from delphinium. The specific epithets quasicaspiana and californiensis were selected based on the close phylogenetic relationship of strains with P. caspiana and on the geographic location of isolation, respectively.

Impact of Foliar Application of Acibenzolar-S-Methyl on Rose Rosette Disease and Rose Plant Quality.

Rose rosette disease (RRD) caused by rose rosette emaravirus (RRV) is a major issue in the U.S. rose industry with no effective method for its management. This study evaluated the effect of foliar application of acibenzolar-S-methyl (ASM), a plant systemic acquired resistance inducer, in reducing RRD disease severity on Rosa species cv. Radtkopink ('Pink Double Knock Out') under greenhouse conditions, and the effect of ASM on plant growth under commercial nursery production conditions. ASM at 50- or 100-mg/liter concentrations at weekly intervals significantly reduced RRD severity compared with the untreated control in two of the three greenhouse trials (P < 0.05). The plants in these trials were subsequently pruned and observed for symptoms, which further indicated that application of ASM at 50- or 100-mg/liter concentrations lowered disease severity compared with the untreated control (P < 0.05) in these two trials. Plants treated with ASM at 50- or 100-mg/liter concentrations had delayed incidence of RRD compared with the nontreated controls. Plants treated with ASM at the 50- or 100-mg/liter rate in all three trials either did not have RRV present or the virus was present in fewer leaf samples than untreated controls as indicated by quantitative reverse transcription PCR analysis. Overall, plants treated with ASM at the 50-mg/liter concentration had 36 to 43% reduced RRD incidence compared with the water control. The treatment of two cultivars of rose, 'Radtkopink' and 'Meijocos' ('Pink Drift'), with weekly foliar applications of ASM at the three rates (0.5, 0.75, and 1.0 oz/A) indicated that ASM had no negative effect on flowering or plant growth at even the highest rate of application.

Magnesium Oxide Nanomaterial, an Alternative for Commercial Copper Bactericides: Field-Scale Tomato Bacterial Spot Disease Management and Total and Bioavailable Metal Accumulation in Soil.

Copper (Cu) is the most extensively used bactericide worldwide in many agricultural production systems. However, intensive application of Cu bactericide have increased the selection pressure toward Cu-tolerant pathogens, including Xanthomonas perforans, the causal agent of tomato bacterial spot. However, alternatives for Cu bactericides are limited and have many drawbacks including plant damage and inconsistent effectiveness under field conditions. Also, potential ecological risk on nontarget organisms exposed to field runoff containing Cu is high. However, due to lack of alternatives for Cu, it is still widely used in tomato and other crops around the world in both conventional and organic production systems. In this study, a Cu-tolerant X. perforans strain GEV485, which can tolerate eight tested commercial Cu bactericides, was used in all the field trials to evaluate the efficacy of MgO nanomaterial. Four field experiments were conducted to evaluate the impact of intensive application of MgO nanomaterial on tomato bacterial spot disease severity, and one field experiment was conducted to study the impact of soil accumulation of total and bioavailable Cu, Mg, Mn, and Zn. In the first two field experiments, twice-weekly applications of 200 µg/mL MgO significantly reduced disease severity by 29-38% less in comparison to a conventional Cu bactericide Kocide 3000 and 19-30% less in comparison to the water control applied at the same frequency (p = 0.05). The disease severity on MgO twice-weekly was 12-32% less than Kocide 3000 + Mancozeb treatment. Single weekly applications of MgO had 13-19% higher disease severity than twice weekly application of MgO. In the second set of two field trials, twice-weekly applications of MgO at 1000 µg/mL significantly reduced disease severity by 32-40% in comparison to water control applied at the same frequency (p = 0.05). There was no negative yield impact in any of the trials. The third field experiment demonstrated that application of MgO did not result in significant accumulation of total and bioavailable Mg, Mn, Cu, or Zn in the root-associated soil and in soil farther away from the production bed compared to the water control. However, Cu bactericide contributed to significantly higher Mn, Cu, and Zn accumulation in the soil compared to water control (p = 0.05). This study demonstrates that MgO nanomaterial could be an alternative for Cu bactericide and have potential in reducing risks associated with development of tolerant strains and for reducing Cu load in the environment.

First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA.

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

A rapid fluorescence-based real-time isothermal assay for the detection of Cucurbit yellow stunting disorder virus in squash and watermelon plants.

Cucurbit yellow stunting disorder virus (CYSDV) is a single-stranded positive-sense RNA virus that produces devastating disease in watermelon and squash. Foliar symptoms of CYSDV consist of interveinal yellowing, brittleness, and thickening of older leaves leading to reduced plant vigor. A rapid diagnostic method for CYSDV would facilitate early detection and implementation of best viral-based management practices. We developed a rapid isothermal reverse transcription-recombination polymerase amplification (exo RT-RPA) assay for the detection of CYSDV. The primers and a 6-fluorescein amidite (6-FAM) probe were developed to target the nucleocapsid gene. The real-time assay detected CYSDV at 2.5 pg purified total RNA extracted from CYSDV-infected leaf tissue and corresponded to 10 copies of the target molecule. The assay was specific and did not cross-react with other common cucurbit viruses found in Florida and Georgia. The performance of the exo RT-RPA was evaluated using crude extract from 21 cucurbit field samples and demonstrated that the exo RT-RPA is a rapid procedure, thus providing a promising novel alternative approach for the detection of CYSDV.

Comparing Stagonosporopsis spp. Fungicide Resistance Profiles in Florida and East China Cucurbit Production Systems.

Gummy stem blight, caused by Stagonosporopsis spp., is a major disease of cucurbits in the United States and China that is managed primarily through the use of fungicides. The objective of this study was to monitor and compare the recent fungicide resistance profiles of Stagonosporopsis spp. in Florida open-field and East China protected-structure production systems. Isolates of Stagonosporopsis spp. were evaluated for sensitivity to the commonly used fungicides azoxystrobin, boscalid, tebuconazole, and thiophanate-methyl at discriminatory rates of 0.096, 0.034, 0.128, and 100 mg/liter, respectively. Isolates were collected from Jiangsu, Jiangxi, Zhejiang, and Anhui provinces in China (n = 69), 12 counties in Florida (n = 89), and one county in Georgia (n = 6). More than 50% of isolates from Florida and East China were resistant to thiophanate-methyl. Boscalid resistance was detected in both isolate collections but was two times more frequent in China. Resistance to azoxystrobin was detected in 66% of isolates in Florida but only 7% in China. Tebuconazole was effective in controlling the mycelia growth of Stagonosporopsis spp. in both collections. The results indicate that both production systems currently face similar challenges related to the development of fungicide resistance in Stagonosporopsis spp. However, the resistance profiles are unique for both production systems.

First Report of Bacterial Wilt Disease of Tomato, Pepper and Gboma Caused by the Ralstonia solanacearum Species Complex in Togo.

Tomato (Solanum lycopersicum), pepper (Capsicum annum), and gboma (Solanum macrocarpon) are major vegetables in Togo, with many people depending on these crops for their livelihood. In December 2018, during the dry season with temperatures between 21°C to 35°C, tomato ('Petomech'), pepper ('Gboyebesse') and gboma (local landrace) showing wilt symptoms without foliar yellowing were collected from two locations, Tchouloum and CECO-AGRO sites in the Sotouboua Prefecture of Togo, ~300 km from the capital city of Lome. Disease incidence ranged between 10% to 50% in multiple fields. Cut stems of most wilting tomato, pepper and gboma plants produced bacterial ooze in water and vascular discoloration was visible in longitudinal stem sections. Ground cut stem tissue tested positive with Rs ImmunoStrips specific to the Ralstonia solanacearum species complex (RSSC) (Agdia Inc., Elkhart, IN, USA). Collected samples were stored at ambient temperature and cultured within 36 hr. Culturing sap from cut stems plated on modified SMSA medium (Engelbrecht 1994) yielded colonies with typical RSSC morphology: slow-growing, irregular, mucoid, and white with red centers. Genomic DNA was extracted from thirteen isolates: two from gboma, five from tomato and six from pepper. The expected 280-bp band was amplified from all 13 genomic DNAs following polymerase chain reaction (PCR) using the 759/760 RSSC-specific primer pair (Opina et al. 1997). PCR with the 630/631 primers, which identify the Race 3 biovar 2 RSSC subgroup, did not yield a product from any Togo isolate (Opina et al. 1997). The phylotype multiplex PCR identified all Togo isolates as belonging to the phylotype I subgroup, also called R. pseudosolanacearum (Prior et al. 2016; Fegan and Prior 2005). Phylotype control DNAs were from strains GMI1000 (phylotype I, Asia), K60 (phylotype II, Americas), CMR15 (phylotype III, Africa), and PSI07 (phylotype IV, Indondesia). Comparative genomic analysis of the partial endoglucanase (egl) gene, amplified with the Endo primer pairs (Poussier et al. 2000), revealed all Togo strains belonged to sequevar 17, a group known to cause bacterial wilt of peanut in China. (Xu et al. 2009). The egl sequences are in NCBI GenBank accessions MT572393 to MT572405. Koch's postulates were completed by inoculating 28-day-old bacterial wilt-susceptible 'Bonny Best' tomato plants by soil soak (Khokhani et al. 2018). Briefly, soil around each unwounded plant was drenched with 50 ml of a 108 CFU/mL suspension of bacteria grown from a single colony. Five plants were inoculated with each of four randomly selected Togo strains. RSSC phylotype I strain GMI1000 served as a positive control and water treated plants as negative controls. Plants were kept in a 28°C growth chamber with a 12 hr photoperiod. All RSSC inoculated plants were fully wilted within a week; symptoms resembled to those observed in the field. Water treated control plants did not wilt. Culturing sap from all inoculated plants on SMSA medium yielded colonies with typical RSSC morphology that tested positive with the Rs ImmunoStrips. This is the first identification of RSSC in Togo. These results will guide development of disease management strategies and regionally appropriate breeding of vegetable lines with resistance to the phylotype I RSSC strains present in Togo.

An Improved Crop Scouting Technique Incorporating Unmanned Aerial Vehicle-Assisted Multispectral Crop Imaging into Conventional Scouting Practice for Gummy Stem Blight in Watermelon.

Multispectral imaging is increasingly used in specialty crops, but its benefits in assessment of disease severity and improvements in conventional scouting practice are unknown. Multispectral imaging was conducted using an unmanned aerial vehicle (UAV), and data were analyzed for five flights from Florida and Georgia commercial watermelon fields in 2017. The fields were rated for disease incidence and severity by extension agents and plant pathologists at randomized locations (i.e., conventional scouting) followed by ratings at locations that were identified by differences in normalized difference vegetation index (NDVI) and stress index (i.e., UAV-assisted scouting). Diseases identified by the scouts included gummy stem blight, anthracnose, Fusarium wilt, Phytophthora fruit rot, Alternaria leaf spot, and cucurbit leaf crumple disease. Disease incidence and severity ratings were significantly different between conventional and UAV-assisted scouting (P < 0.01, Bhapkar/exact test). Higher severity ratings of 4 and 5 on a scale of 1 to 5 from no disease to complete loss of the canopy were more consistent after the scouts used the multispectral images in determining sampling locations. The UAV-assisted scouting locations had significantly lower green, red, and red edge NDVI values and higher stress index values than the conventional scouting areas (P < 0.05, ANOVA/Tukey), and this corresponded to areas with higher disease severity. Conventional scouting involving human evaluation remains necessary for disease validation. Multispectral imagery improved watermelon field scouting owing to increased ability to identify disease foci and areas of concern more rapidly than conventional scouting practices with early detection of diseases 20% more often using UAV-assisted scouting.

Recombinase polymerase amplification applied to plant virus detection and potential implications.

Several isothermal techniques for the detection of plant pathogens have been developed with the advent of molecular techniques. Among them, Recombinase Polymerase Amplification (RPA) is becoming an important technique for the rapid, sensitive and cost-effective detection of plant viruses. The RPA technology has the advantage to be implemented in field-based scenarios because the method requires a minimal sample preparation, and is performed at constant low temperature (37-42 °C). The RPA technique is rapidly becoming a promising tool for use in rapid detection and further diagnostics in plant clinics and monitoring quarantine services. This paper presents a review of studies conducted using RPA for detection/diagnosis of plant viruses with either DNA genomes (Banana bunchy top virus, Bean golden yellow mosaic virus, Tomato mottle virus, Tomato yellow leaf curl virus) or RNA genomes (Little Cherry virus 2, Plum pox virus and Rose rosette virus).

Transgenic Expression of EFR and Bs2 Genes for Field Management of Bacterial Wilt and Bacterial Spot of Tomato.

Field trials were conducted at two locations in Florida to evaluate transgenic tomato expressing the ELONGATION FACTOR TU RECEPTOR (EFR) gene from Arabidopsis thaliana, the Bs2 gene from pepper, or both Bs2 and EFR (Bs2/EFR) for managing bacterial wilt caused by Ralstonia solanacearum and bacterial spot caused by Xanthomonas perforans. Expression of EFR or Bs2/EFR in the susceptible genotype Fla. 8000 significantly reduced bacterial wilt incidence (50 to 100%) and increased total yield (57 to 114%) relative to lines expressing only Bs2 or the nontransformed Fla. 8000 control, although the marketable yield was not significantly affected. Following harvest, surviving symptomatic and nonsymptomatic plants were assessed for colonization by R. solanacearum. There were no significant differences in the population at the lower stem. Interestingly, in the middle stem, no bacteria could be recovered from EFR or Bs2/EFR lines but viable bacterial populations were recovered from Bs2 and nontransformed control lines at 102 to 105 CFU/g of stem tissue. In growth-chamber experiments, the EFR transgenic tomato lines were found to be effective against seven different R. solanacearum strains isolated from the southeastern United States, indicating utility across the southeastern United States. In all of the bacterial spot trials, EFR and Bs2/EFR lines had significantly reduced disease severity (22 to 98%) compared with the Fla. 8000 control. The marketable and total yield of Bs2/EFR were significantly higher (43 to 170%) than Fla. 8000 control in three of four field trials. These results demonstrate for the first time the potential of using the EFR gene for field management of bacterial wilt and bacterial spot diseases of tomato.