Comparative Study of Fusogenic Activity of H1 and H5 Subtypes Influenza Virus Hemagglutinins.

Influenza virus hemagglutinins are surface proteins responsible for fusion of the viral and cellular membranes. Their capacity to mediate membrane fusion (fusogenic activity) is studied by various methods, including the syncytium formation and pseudovirus transduction methods. We constructed plasmids coding for genes of three H1 and one H5 hemagglutinins and compared their fusogenic activities. Hemagglutinin capacity to induce syncytium formation did not always correlate with the transduction activity of the respective pseudoviruses. Hemagglutinin H5 exhibited high fusogenic activity in studies by both methods, however, two of the studied H1 hemagglutinins induced the formation of syncytia, but did not mediate pseudovirus transduction. This could be due to different capsid sizes of influenza virus and vesicular stomatitis virus, which determines their different permeability through the fusion pore.

[Synthetic transformations of higher terpenoids. XXX. Synthesis and cytotoxic activity of betulonic acid amides with a piperidine or pyrrolidine nitroxide moiety].

The reaction of betulonic acid chloride with 4-amino-2,2,6,6-tetramethylpeperidine-1-oxyl, 3-amino-2,2,5,5-tetramethylpyrrolidine-1-oxyl and 3-aminomethyl-2,2,5,5-tetramethylpyrrolidine-1-oxyl gave corresponding triterpenoid amides. It was found that new derivatives exhibit cytotoxic activity against tumor cells CEM-13, U-937, MT-4. CCID50 value for most activity compound--N-[3-oxolup-20(29)-en-30-yl]-(2,2,6,6-tetramethylpiperidine-4-yl)-1-oxyl--was 5.7-33.1 microM.

[Antitumor activity of dihydrobetulonic acid amides in vitro and in vivo].

Amides with homopiperidinic and piperazinic cycles were synthesized from dihydrobetulonic acid which was obtained by dihydrobetulin oxidation. All substances have shown high antitumor activity (CCID50 3.5-36.2 microM) in vitro in lymphoid (CEM-13, U-937) and monocytic (MT-4) human cell lines. Amides with methyl- and ethyl-piperazinic residues don't influence viability of Lung Lewis Carcinoma cell in culture and haven't any significant effect to its transplantates in C57BL/6 mice. But such amides inhibit efficiently the metastatic elaboration in lung of these mice. The antimetastatic activity increases followed by the change of aliphatic residue length in piperazinic cycle from methyl to ethyl.

[Synthetic transformations of higher terpenoids. XXVI. 16-Acetylaminomethyllabdanoids and theirs cytotoxicity].

Condensation of methyl 16-aminomethyllambertianate with N-Boc-omega-amino acids leads smoothly to 16-(N-Boc-aminononan)- and 16-(N-Boc-aminoundecan)amidomethyllabdanoids. The amide of bicyclo[2.2.1]heptan-1,2-dicarbocylic acid with a labdanoid substituent was obtained under the reaction of methyl aminomethyllambertianate with bicyclo[2.2.1]hept-5-ene-2,3-dicarboxylic anhydride. Intereaction of methyl 16-aminomethyllambertianate with chloroacetyl chloride leads to methyl 16-(chloroacetylaminomethyl)lambertianate; condensation of this compound with amino acid methyl ethers the corresponding amides of methyl lambertianate was obtained. The resulting compounds are more (compared with lambertianic acid) cytotoxicity in the cell lines CEM-13, MT-4 and U-937 with an CCID50 concentration of 3.9-9.9 microM.

[Effect of nitrogen-containing derivatives of the plant triterpenes betulin and glycyrrhetic acid on the growth of MT-4, MOLT-4, CEM, and Hep G2 tumor cells].

Derivatives of the available plant triterpenes glycyrrhetic acid and betulin (betulin succinates and amides of betulonic and 18beta-glycyrrhetic acids containing fragments of long-chain amino acids and a peptide) were synthesized. The inhibitory action of these compounds on the growth of MT-4, MOLT-4, CEM. and Hep G2 tumor cells and their effect on the apoptosis of these cells were studied. It was shown that betulonic acid amides are more effective inhibitors of the tumor cell growth than the corresponding amides of glycyrrhetic acid. It was also found that betulonic acid amides containing fragments of caprylic, pelargonic, and undecanoic acids are more effective inhibitors of tumor cell growth than betulinic acid. The 17-dipeptide derivative of betulonic acid N-{N-[3-oxo-20(29)-lupen-28-oyl]-9-aminononanoyl}-3-amino-3-phenylpropionic acid exhibited the maximum inhibitory activity toward the tumor cells studied. Data on the induction of apoptosis in tumor cells by betulin derivatives at a concentration of 10 microg/ml were obtained by flow cytometry. The amides of betulonic acid proved to be the most effective inducers of apoptosis.

[New derivatives of alkyl- and aminocarbonylphosphonic acids containing 3'-azido-3'-deoxythymidine].

New 5'-phosphonates of 3'-azido-3'-deoxythymidine were synthesized and shown to be low-toxic and markedly active in MT-4 cell cultures infected with HIV-1.

[Antiviral activity of vegetable triterpens, their derivatives and ribavirin phosphonates]. / Protivovirusnaia aktivnost' triterpenov rastitel'nogo proiskhozhdeniia, ikh proizvodnykh i fosfonatov ribavirina.

The purpose of the study was to investigate, in the Vero cell culture, the antiviral activity of vegetable tritrpens derivatives and ribavirin analogues against the viruses of measles, herpes simple (type 1), cytomegaloviruses and filoviruses. The toxicity and antiviral activity of compounds were determined after coloring of cells with crystal violate. Additionally, the combined action of triterpens' derivatives and ribavirin was investigated. The studied compounds showed relatively low antiviral activity, nonetheless, further research of vegetable triterpens and their derivatives as well as ribavirin analogues would be promising.

[In vitro selection and phenotyping of HIV-1 mutants resistant to azidothymidine and didanosine].

In vitro selection of HIV-1(EVK) variants resistant to highly effective nucleoside reverse transcriptase inhibitors (NNRTIs), i.e. azidothymidine (AZT) and didanosine (ddI) was performed. In case of AZT resistant mutants, subcloning by limiting dilutions was used. The isolated AZT resistant mutants and subclones had a broad spectrum of phenotypic resistance (8, 25, 53, 80, 114, 160-fold). The ddI resistant mutant possessed 10-fold resistance. The AZT resistant mutants and subclones had a high level of cross-resistance to H-phosphonate of AZT (H-phAZT) and a moderate level of cross-resistance to d4T. Still, they were effectively inhibited by a new compound, i.e. phosphonate of d4T.

[Study of anti-HIV activity of azidothymidine and fluorothymidine 5'-phosphonates]. / Izuchenie anti-HIV-aktivnosti 5'-fosfonatov azidotimidina i ftortimidina.

It was established that 5'-phosphonates of 3'-azido-2',3'-dideoxythymidine (AZT) inhibit HIV reproduction in the MT-4 cell line as well as AZT. However, the viability of HIV-infected MT-4 cells after treatment with phosphonates was considerable higher that after AZT treatment. Inhibitory activities of 5'-phosphonates of 3'-fluoro-2',3'-dideoxythymidine (FLT) on HIV-infected MT-4 cells were rather low. The mechanism of action of these derivatives and prospects for their application for suppressing HIV infection are discussed.

[A new approach to detect a particular DNA sequence by UV-immobilization of its hybridization complex with a highly specific probe resulting from ligation of a tandem of short oligonucleotides in solution]. / Novyi podkhod k vyiavleniiu analiziruemoi posledovatel'nosti DNK putem UF-immobilizatsii ee gibridizatsionnogo kompleksa s vysokospetsifichnym zondom, obrazuiushchimsia pri ligirovanii tandema korotkikh oligonukleotidov v rastvore.

A new approach was proposed for detecting amplified DNA fragments by hybridization with a highly selective oligonucleotide probe obtained by ligation of a tandem of three short oligonucleotides (pN8 + pN4 + pN8' Bio) in solution, with subsequent UV-immobilization of the hybridization product on a nylon membrane and its colorimetric detection with the streptavidin-alkaline phosphatase technique. Owing to the high selectivity of ligation, the 20-mer ligation product was detected on a membrane only when it was completely complementary to a template fragment. The results showed that any single-nucleotide substitution in the tetramer-binding site can be localized and identified with the use of all 12 possible tetramers.

[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides]. / Ingibirovanie reproduktsii virusa immunodefitsita cheloveka smyslovymi i antismyslovymi oligodezoksinukleotidami.

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.

[Immunogenetic properties of peptides mimicking a human immunodeficiency virus gp41 (HIV-1) epitope recognized by virus-neutralizing antibody 2F5]. / Immunogennye svoistva peptidov-imitatorov épitopa belka gp41 virusa immunodefitsita cheloveka (VICh-1), uznavaemogo neitralizuiushchim antitelom 2F5.

Phage display was used to obtain peptides mimicking a HIV-1 gp41 conserved epitope recognized by virus-neutralizing monoclonal antibodies (MCA) 2F5. Rabbits and mice were immunized with the peptides exposed on the surface of filamentous bacteriophages. Antibodies to gp41 were detected in the sera of immunized animals. The virus-neutralizing activity of the sera was examined.

[Determination of glycyrrhizic acid binding sites by a phage display method]. / Opredelenie uchastkov sviazyvaniia glitsirrizinovoi kisloty metodom fagovogo displeia.

Phages that expose peptides specifically interacting with glycyrrhizic acid (GA) were selected from a phage peptide library by affinity selection and ELISA. Amino acid sequence analysis of the selected peptides and human proteins with the SIM program revealed homology to tyrosine protein kinases, serine/threonine protein kinases, tyrosine phosphatases, and some receptors. Analysis of the peptide and virus protein sequences with the BLAST program showed that GA has affinity for various surface proteins of several human viruses such as HIV-1, hepatitis C virus, and herpesviruses.

[The synthesis and antiviral activity of glycyrrhizic acid conjugates with alpha-D-glucosamine and some glycosylamines]. / Sintez kon''iugatov glitsirrizinovoi kisloty s al'fa-D-gliukozaminom i nekotorymi glikozilaminami i ikh protivovirusnaia aktivnost'.

Glycyrrhizic acid and its 30-methyl ester were conjugated with 2-amino-1,3,4,6-tetra-O-acetyl-2-deoxy-alpha-D-glucopyranose, 2,3,4,6-tetra-O-acetyl-beta-D-glucopyranosyl amine, 2,3,4-tri-O-acetyl-apha-L-arabinopyranosyl amine, 2-acetamido-2-deoxy-beta-D-glucopyranosyl amine, and beta-D-galactopyranosyl amine using N,N'-dicyclohexylcarbodiimide and its mixtures with N-hydroxybenzotriazole. Structures of the conjugates were confirmed by IR, UV, 1H, and 13C NMR spectroscopy. The glycoconjugate with the residues of 2-acetamido-2-deoxy-beta-D-glucopyranosyl amine in the carbohydrate part of its molecule exhibited antiviral activity (ID50 4 microg/ml) toward the herpes simplex type 1 virus (HSV-1) in the VERO cell culture. Two compounds demonstrated anti-HIV-1 activity (50-70% inhibition of p24) in a culture of MT-4 cells at concentrations of 0.5-20 microg/ml. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2004, vol. 30, no. 3; see also http://www.maik.ru.

[New phosphonoformic acid derivatives of 3'-azido-3'-deoxythymidine]. / Novye proizvodnye 3'-azido-3'-dezoksitimidina i fosfonomurav'inoi kisloty.

New 5'-alkyl ethoxy- and aminocarbonylphosphonates of 3'-azido-3'-deoxythymidine (AZT) were synthesized, and their antiviral properties in HIV-1-infected cell cultures and stability to chemical hydrolysis were studied. The AZT 5'-aminocarbonylphosphonates were shown to be significantly more stable in phosphate buffer (pH 7.2) than the corresponding ethoxycarbonylphosphonates. The therapeutic (selectivity) index of some of the compounds exceeded that of the parent AZT due to their higher antiviral activity. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2004, vol. 30, no. 3; see also http://www.maik.ru.

[Detection of unintegrated forms of proviral DNA in HIV infections]. / Opredelenie kol'tsevykh form provirusnoi DNK pri VICh-infektsii.

The content of 1-LTR and 2-LTR circular forms of HIV-1 proviral DNA was determined by nested PCR. Outer and inner primers for the first and second stages of PCR were selected in the env and gag regions that allowed the authors to simultaneously test 1- and 2 LTR of DNA HIV-1 forms in the analyzed samples. The accumulation of circular species of HIV-1 DNA was shown to occur during HIV infection as well for acutely infected cell lines as chronically infected mononuclear cells. The cell cultures providing productive infection was characterized by higher levels of 2-LTR circular HIV-1 DNA. Analysing the clinical samples demonstrated greater differences in the accumulation of the circular forms of proviral DNA. It was detected in 16 tested clinical samples both of 1-LTR and 2-LTR circular DNA in 6 samples and 1-LTR in 11 samples of 2-LTR of HIV-1 DNA is a minor fraction in most clinical samples, but in some samples the relative content of 1-LTR/2-LTR DNA was shown to be 1:1.

[The anti-HIV activity of glycyrrhizic acid penta-O-nicotinate]. / Anti-VICh-aktivnost' penta-O-nikotinata glitsirrizinovoi kisloty.

The anti-HIV activity of niglizin (penta-O-nicotinate of glycyrrhizic acid) and of its combinations was studied in the culture of infected MT-4 cells and in respect to the recombinant reverse HIV-1 transcriptase. Niglizin was shown to suppress effectively the HIV replication and to be a noncompetitive inhibitor of reverse transcriptase. Research of a combined anti-HIV action of niglizin and of azidothimidine (AZT) demonstrated that the preparations, when used at ratios of 1:20, 1:50, 1:200 and 1:2000, suppressed the synergetic effect both in the cell culture and in the recombinant reverse HIV transcriptase. A study of the antiviral activity of niglizin and of its joint use with AZT in respect to the AZT-resistant HIV-1 mutant showed niglizin to be more effective (ID50 = 0.134 microM) versus the "wild" strain. (ID50 = 9.64 micriM); whereas, its combined use AZT:niglizin = 1:100 displayed synergism (FIC = 0.553). The efficiency of the combined AZT/niglizin anti-HIV effect both in respect to the "wild" strain and to the AZT-resistant mutant confirms that such combinations are promising for the treatment of HIV infection.

[Study of antigenic structure of HIV-1 protein p24 using monoclonal antibodies]. / Izuchenie antigennoi struktury belka p24 VICh-1 s pomoshch'iu monoklonal'nykh antitel.

During the experiments 4 murine and 3 rat hybridomas producing monoclonal antibodies (MAb) against the protein p24 of human immunodeficiency virus type 1 (HIV-1) have been obtained. Using the immunoblotting technique, it was established that all the species of MAb reacted with the same viral proteins which are derivatives of gag gene--p24 and p55. The properties of MAb have been studied in competitive binding. Their ability of binding to different fragments of the gag protein produced by the recombinant plasmids in E. coli cells have been investigated in ELISA. The analysis of the findings suggests that the HIV-1 protein p24 contains at least 3 antigenic epitopes. All species of MAb reacted with 3 different HIV-1 strains and 2 HIV-1 isolates, but failed with 2 different HIV-2 strains. The only MAb NS5E4 can be used as an immunosorbent in the antigenic capture reaction.

[Isolation of a panel of HIV-positive serum by blocking them with various HIV antigens]. / Poluchenie otsenochnoi paneli VICh-polozhitel'nykh syvorotok metodom istoshcheniia ikh razlichnymi antigenami VICh.

A new methodological approach to preparation of a panel of positive sera containing antibodies to individual viral proteins has been developed. The method consists in exhaustion of initial sera from HIV-infected patients with the known titers of antibodies by HIV antigens differing by the spectrum of virus proteins. Antigen preparations containing the least amounts of envelope proteins were selected for exhaustion. A set of HIV-positive sera containing antibodies mainly to envelope proteins and differing in ELISA was obtained.