Crimean-Congo Hemorrhagic Fever Virus Kinetics in Serum, Saliva, and Urine, Iran, 2018.

Little is known about using noninvasive samples for diagnosing Crimean-Congo hemorrhagic fever (CCHF). We investigated detection of CCHF virus in serum, saliva, and urine samples. Our results indicate that serum is the best sample type for CCHF diagnosis; saliva can be used for noninvasive sampling.

Persistence of IgG and neutralizing antibodies in Crimean-Congo hemorrhagic fever survivors.

The World Health Organization classified Crimean-Congo hemorrhagic fever (CCHF) as a high-priority infectious disease and emphasized the performance of research studies and product development against it. Little information is available about the immune response due to natural CCHF virus (CCHFV) infection in humans. Here, we investigated the persistence of IgG and neutralizing antibodies in serum samples collected from 61 Iranian CCHF survivors with various time points after recovery (<12, 12-60, and >60 months after disease). The ELISA results showed IgG seropositivity in all samples while a pseudotyped based neutralization assay findings revealed the presence of neutralizing antibody in 29 samples (46.77%). For both IgG and neutralizing antibodies, a decreasing trend of titer was observed with the increase in the time after recovery. Not only the mean titer of IgG (772.80 U/mL) was higher than mean neutralizing antibody (25.64) but also the IgG persistence was longer. In conclusion, our findings provide valuable information about the long-term persistence of humoral immune response in CCHF survivors indicating that IgG antibody can be detected at least 8 years after recovery and low titers of neutralizing antibody can be detected in CCHF survivors.

The ins and outs of SARS-CoV-2 variants of concern (VOCs).

SARS-CoV-2, a newly emerging coronavirus that caused the COVID-19 epidemic, has been spreading quickly throughout the world. Despite immunization and some fairly effective therapeutic regimens, SARS-CoV-2 has been ravaging patients, health workers, and the economy. SARS-CoV-2 mutates and evolves to adapt to its host as a result of extreme selection pressure. As a consequence, new SARS-CoV-2 variants have emerged, some of which are classified as variants of concern (VOC) because they exhibit greater transmissibility, cause more-severe disease, are better able to escape immunity, or cause higher mortality than the original Wuhan strain. Here, we introduce these VOCs and review their characteristics, such as transmissibility, immune escape, mortality risk, and diagnostics.

Severe acute respiratory syndrome-coronavirus-2 spike (S) protein based vaccine candidates: State of the art and future prospects.

Coronavirus disease 2019 (Covid-19) is caused by severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2) which is responsible for a global pandemic that started in late 2019 in Wuhan, China. To prevent the worldwide spread of this highly pathogenic virus, development of an effective and safe vaccine is urgently needed. The SARS-CoV-2 and SARS-CoV share a high degree of genetic and pathologic identity and share safety and immune-enhancement concerns regarding vaccine development. Prior animal studies with first generation (whole virus-based) preparations of SARS-CoV vaccines (inactivated and attenuated vaccine modalities) indicated the possibility of increased infectivity or eosinophilic infiltration by immunization. Therefore, development of second and third generation safer vaccines (by using modern vaccine platforms) is actively sought for this viral infection. The spike (S) protein of SARS-CoVs is the main determinant of cell entry and tropism and is responsible for facilitating zoonosis into humans and sustained person-to-person transmission. Furthermore, 'S' protein contains multiple neutralizing epitopes that play an essential role in the induction of neutralizing antibodies (nAbs) and protective immunity. Moreover, T-cell responses against the SARS-CoV-2 'S' protein have also been characterized that correlate to the IgG and IgA antibody titres in Covid-19 patients. Thus, S protein is an obvious candidate antigen for inclusion into vaccine platforms against SARS-CoV-2 viral infection. This manuscript reviews different characteristics of S protein, its potency and 'state of the art' of the vaccine development strategies and platforms using this antigen, for construction of a safe and effective SARS-CoV-2 vaccine.

SARS-CoV-2 re-infection rate in Iranian COVID-19 cases within one-year follow-up.

Since the COVID-19 pandemic initiation, the possibility of re-infection has been unclearly present. Although herd immunity has a potential reliance through natural infection, human corona viruses has the ability to subvert immunity and re-infection happens for seasonal corona viruses. Currently, the frequency of SARS-CoV-2 re-infection incidence is not exactly defined. In this study we aimed at determination of SARS-CoV-2 re-infection rate in Iranian population. In a total of 5696 COVID-19 suspicious individuals, RT-PCR was applied to diagnose the infection. The confirmed patients were followed for 12 months and serology tests were applied to measure the specific antibodies. Among 1492 confirmed COVID-19 cases, five individuals experienced the subsequent infection. The re-infection/reactivation incidence rate was totally 0.33% after one year of follow-up. The interval ranged from 63 to 156 days. All the cases had viral mutations in the second episode of the infection. All of them were symptomatic cases with moderate severity. The estimated rate of SARS-CoV-2 in Persian population is therefore rare and natural infection seems to induce good protection against re-infection which clarifies that mass vaccination can hugely affect the society.

Clinical characteristics of SARS-CoV-2 by re-infection vs. reactivation: a case series from Iran.

COVID-19 immunity in infected individuals may not be persistent. The specific response wanes in patients who have recovered from this infection. Nevertheless, it has not been fully understood whether true re-infection occurs or the viral reactivation. In this study, we investigated three COVID-19 patients who represented the symptoms after recovery. Chest CT scan was applied to assess the patients along with the viral samples from oropharyngeal/nasopharyngeal which were subjected to RT-PCR. The viral genome sequencing was applied where possible to distinguish possible re-infection or latent reactivation. Moreover, COVID-19-specific antibodies available data were evaluated in each incidence. The second episode of SARS-CoV-2 infection was different among the investigated subjects who experienced an interval between positive PCR tests ranged between 63 and 156 days. The disease presentation was less or more severe in the second infection. All cases were found IgG positive in the re-infection phase. The sequencing of SARS-CoV-2 sample obtained from two cases revealed a D614G mutation of S gene from the second isolated sample strengthens the case for the re-infection. The possibility of re-infection and reactivation could have significant effect on clinical implications and also vaccination. Our data supports clear warning of SARS-CoV-2 continuous circulation potency among the populations in spite of herd immunity either with natural infection or vaccination. This issue is critical in term of the patients, clinical investigate, and viral transmission.

Antiviral Therapeutic Potential of Curcumin: An Update.

The treatment of viral disease has become a medical challenge because of the increasing incidence and prevalence of human viral pathogens, as well as the lack of viable treatment alternatives, including plant-derived strategies. This review attempts to investigate the trends of research on in vitro antiviral effects of curcumin against different classes of human viral pathogens worldwide. Various electronic databases, including PubMed, Scopus, Web of Science, and Google Scholar were searched for published English articles evaluating the anti-viral activity of curcumin. Data were then extracted and analyzed. The forty-three studies (published from 1993 to 2020) that were identified contain data for 24 different viruses. The 50% cytotoxic concentration (CC50), 50% effective/inhibitory concentration (EC50/IC50), and stimulation index (SI) parameters showed that curcumin had antiviral activity against viruses causing diseases in humans. Data presented in this review highlight the potential antiviral applications of curcumin and open new avenues for further experiments on the clinical applications of curcumin and its derivatives.

Efficient production of a lentiviral system for displaying Crimean-Congo hemorrhagic fever virus glycoproteins reveals a broad range of cellular susceptibility and neutralization ability.

Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne disease with a mortality rate of up to 50% in humans. To avoid safety concerns associated with the use of live virus in virus neutralization assays and to detect human serum neutralizing antibodies, we prepared lentiviral particles containing the CCHF glycoprotein (lenti-CCHFV-GP). Incorporation of the GP into the lentiviral particle was confirmed by electron microscopy and Western blotting. Lenti-CCHFV-GP was found to be able to infect a wide range of cell lines, including BHK-21, HeLa, HepG2, and AsPC-1 cells. In addition, lenti-CCHFV-GP was successfully used as an alternative to CCHFV for the detection of neutralizing antibodies. Sera collected from CCHF survivors neutralized lenti-CCHFV-GP particles in a dose-dependent manner. Our results suggest that the lenti-CCHFV-GP pseudovirus can be used as a safe tool for neutralization assays in low-containment laboratories.

Hantavirus infection in Iranian patients suspected to viral hemorrhagic fever.

BACKGROUND: Hantaviruses are a group of emerging pathogens causing hemorrhagic fever with renal syndrome and Hantavirus cardiopulmonary syndrome in human. This study was conducted to investigate Hantavirus infection among Iranian viral hemorrhagic fever suspected patients. METHODS: From April 2014 to June 2016, 113 cases from 25 different provinces of Iran were analyzed for Hantavirus infection by IgM/IgG ELISA and pan-Hantavirus RT-PCR tests. RESULTS: Although, viral genome was detected in none of the subjects, IgM and IgG antibodies were detected in 19 and 4 cases, respectively. Differentiation of the anti-Hantavirus antibodies according to virus species by EUROLINE Anti-Hantavirus Profile Kit revealed three Puumala virus IgM positive, one Hantaan virus IgM positive, one Hantaan virus IgM borderline, and two Puumala virus IgG borderline cases. CONCLUSIONS: This study demonstrates the circulation of Hantaviruses in Iran and calls for further investigations of these life-threatening viruses in the country.

Imported cases of Chikungunya virus in Iran.

BACKGROUND: Chikungunya virus (CHIKV) is a widespread mosquito-borne virus representing a serious challenge to public health. The largest outbreak in the Middle-East was recorded in 2016-2017 in Pakistan. Sistan and Baluchistan Province of Iran shares a wide border with Pakistan; accordingly, introduction of CHIKV from Pakistan to Iran seems to be probable. The current study is aimed at investigating CHIKV infection in Sistan and Baluchistan Province. METHODS: Between April 2017 and June 2018, a total of 159 serum samples of CHIK suspected cases from 10 cities of Sistan and Baluchistan Province were tested by molecular and serological assays. Samples obtained up to 4 days after onset of illness were tested by real time PCR (n = 8). Samples collected 5-10 days after disease onset were subjected to ELISA, as well as real time PCR tests (n = 72). Samples obtained after the 10th day of disease onset were tested by only ELISA (n = 79). Phylogenetic analysis of real time PCR positive samples was carried out by sequencing of a 1014-bp region of Envelope 1 gene (E1 gene). Chi-square and independent t tests were used to evaluate the association between variables and CHIKV infection. RESULTS: In total, 40 (25.1%) out of 159 samples tested positive either by real time PCR or ELISA tests.Out of 151 samples serologically analyzed, 19 (12.6%) and 28 (18.6%) cases were positive for anti-CHIKV IgM and anti-CHIKV IgG antibodies, respectively. Of 80 samples tested by real time PCR, CHIKV RNA was detected in 11 (13.7%) sera, all of them had recent travel history to Pakistan. Additionally, phylogenetic analysis of 5 samples indicated their similarity with recent isolates of Pakistan outbreak 2016-2017 belonging to Indian Ocean sub-lineage of ECSA genotype. A significant correlation between abroad travel history and CHIKV infection was observed (P < 0.001). The most common clinical symptoms included fever, arthralgia/arthritis, myalgia, headache, and chill. CONCLUSIONS: These results present substantial evidence of CHIKV introduction to Iran from Pakistan and emphasize the need for the enhancement of surveillance system and preventive measures.

Seroprevalence of West Nile virus in Khuzestan province, southwestern Iran, 2016-2017.

BACKGROUND & OBJECTIVES: West Nile virus (WNV) is a neurotropic Flavivirus transmitted to humans through mosquito bites. As there is no specific antiviral treatment or approved vaccine against WNV, control and prevention of the infection is the best strategy to reduce the burden of WNV-related diseases. The circulation of WNV has been indicated in several regions of Iran including the Khuzestan province. Considering the complex ecology of WNV, the latest data are necessary for the implementation of preventive measures. Therefore, the present study was designed to provide updated information on the seroepidemiology of WNV in Khuzestan province. METHODS: A total of 408 sera were taken from volunteers living in Khuzestan. The presence of specific immunoglobulin G (IgG) antibody against WNV was tested by the enzyme-linked immunosorbent assay (ELISA) method. All the data and participants' demographic information were analyzed by SPSS and Esri's ArcMap GIS software programs. RESULTS: Anti-WNV IgG antibody was detected in 97 (23.8%) out of the 408 tested sera. The highest seropositivity rate was observed in cases aged between 20-29 yr and the lowest seropositivity rate was seen in those <19 yr of age (p = 0.001). There was no statistically significant association between WNV infection and gender, occupation, and educational level. The majority of positive cases were from the city of Ahvaz (47 cases, 48.4%) and Andimeshk (32 cases, 33%). INTERPRETATION & CONCLUSION: This study supports the earlier findings suggesting the circulation of WNV in Khuzestan province. Therefore, the implementation of an integrated surveillance system and training of health care workers and general population regarding the infection would be valuable to reduce the burden of possible outbreaks.

Correlation Study Between IL-28B Gene Polymorphism (rs8099917SNP) and Sustained Virological Response in Iranian Patients with Chronic Hepatitis C.

BACKGROUND: The current standard treatment for hepatitis C is a combination of pegylated interferon alpha and ribavirin (peg-IFNα/RBV). Recent studies have shown that single nucleotide polymorphisms (SNPs) near the interleukin 28B (IL28B) gene coding for IFN-λ3 were associated with the antiviral treatment response. Therefore, in this study, we determined the distribution of the rs8099917 (T/G) polymorphism with sustained virological response (SVR) to chronic hepatitis C virus infection among Iranian patients. METHODS: This cross-sectional study was performed on 150 blood samples based on 93 patients with chronic HCV genotypes 1 and 3 including 71 SVR positive, 22 negative, and 57 healthy individual controls. DNA was extracted from the samples and the frequency of the polymorphism was analyzed the using PCR-RFLP method. Finally, the products were detected on 3.5% agarose gel electrophoresis. RESULTS: The analysis of the data for G/T polymorphism showed that the GG genotype was identified in 6 patients of 71 who achieved SVR, while the GT heterozygous was found in 33 patients and SVR was achieved in 19. Finally, the TT was detected in 53 patients and 7 patients were resistant to treatment. CONCLUSIONS: The results showed significant effects of G allele carriers on susceptibility to HCV infection com-pared to the other allele (T) in our studied population (p = 0.013, OR = 2.23, 95% CI = 1.18-4.21), but we did not find a significant correlation for SVR to therapy in patients with genotype TT (p = 0.055, OR = 0.48, 95% CI = 0.23-1.01). However, further studies with more samples are necessary.

Engineered dendritic cells-derived exosomes harboring HIV-1 Nefmut-Tat fusion protein and heat shock protein 70: A promising HIV-1 safe vaccine candidate.

Antigen presenting cells (APCs)-derived exosomes are nano-vesicles that can induce antigen-specific T cell responses, and possess therapeutic effects in clinical settings. Moreover, dendritic cells (DCs)-based vaccines have been developed to combat human immunodeficiency virus-1 (HIV-1) infection in preclinical and clinical trials. We investigated the immunostimulatory effects (B- and T-cells activities) of DCs- and exosomes-based vaccine constructs harboring HIV-1 Nefmut-Tat fusion protein as an antigen candidate and heat shock protein 70 (Hsp70) as an adjuvant in mice. The modified DCs and engineered exosomes harboring Nefmut-Tat protein or Hsp70 were prepared using lentiviral vectors compared to electroporation, characterized and evaluated by in vitro and in vivo immunological tests. Our data indicated that the engineered exosomes induced high levels of total IgG, IgG2a, IFN-γ, TNF-α and Granzyme B. Moreover, co-injection of exosomes harboring Hsp70 could significantly increase the secretion of antibodies, cytokines and Granzyme B. The highest levels of IFN-γ and TNF-α were observed in exosomes harboring Nefmut-Tat combined with exosomes harboring Hsp70 (Exo-Nefmut-Tat + Exo-Hsp70) regimen after single-cycle replicable (SCR) HIV-1 exposure. Generally, Exo-Nefmut-Tat + Exo-Hsp70 regimen can be considered as a promising safe vaccine candidate due to high T-cells (Th1 and CTL) activity and its maintenance against SCR HIV-1 exposure.

Inactivated herpes simplex virus-1 vaccine formulated in aqueous and alcoholic extracts of propolis boosts cellular and IgG responses.

Objectives: In this study, the adjuvant activity of aqueous and alcoholic extracts of propolis was examined on the inactivated herpes simplex virus-1 (HSV-1). Materials and Methods: BALB/C mice were administered with inactivated (HSV-1; the KOS strain) plus alcoholic and aqueous extracts, followed by assessment of the cellular and humoral immune responses. Results: Alcoholic and aqueous extracts, as an adjuvant, revealed a significant increase in lymphocyte proliferation and cytotoxic T lymphocyte (CTL) responses versus the HSV-1 group. In addition, HSV-1 plus alcoholic extract showed a remarkable increase in IFN-γ cytokine and IFN-γ/IL-4 ratio. On the other hand, both alcoholic and aqueous extracts in the HSV-1 vaccine suppressed the IL-4 cytokine response as compared with the HSV-1 vaccine. In addition, HSV-1 plus alcoholic extract showed a significant increment in IgG1, IgG2a, and IgG2b isotypes as compared with the HSV-1 vaccine. Conclusion: Propolis extracts seem to modulate the immune response against inactivated HSV-1 model and can be used as a suitable vaccine adjuvant or a component of a complex adjuvant against infectious diseases.

Dendrosomal nanocurcumin prevents EBV-associated cell transformation by targeting the lytic cycle genes of the Epstein-Barr virus in the generation of lymphoblastoid cell line.

Objectives: Targeting the lytic cycle of the Epstein-Barr virus (EBV) has been considered a new treatment strategy for malignancies caused by this virus. This study aimed to investigate the effect of Dendrosomal NanoCurcumin (DNC) to prevent cell transformation and inhibit the expression of viral lytic gene expression in the generation of lymphoblastoid cell line (LCL). Materials and Methods: Cell viability of LCLs and PBMCs was performed by MTT assay, and flow cytometry (Annexin/PI) was used for evaluation of apoptosis. CD markers on the surface of generated LCL (CD19) cells were examined for cell validation. The effect of DNC on transformation was evaluated by examining cell morphology and determining the expression level of lytic genes BZLF1, Zta, BHRF1, and BRLF1 of EBV using Real-time PCR. Student's t-test was used for statistical analysis. Results: The MTT assay showed that DNC can inhibit the proliferation of LCL in a dose-dependent manner. The 50% cytotoxic concentration (CC50) of DNC and curcumin for LCL was determined 38.8 µg/ml and 75 µg/ml, respectively after 72 hr. Also, Real-time PCR data analysis showed that DNC in 30 µg/ml concentration significantly inhibited cell transformation in the LCL and significantly reduced viral lytic genes such as BZLF1, Zta, BHRF1, and BRLF1expression compared to control. Conclusion: Overall, these findings show that DNC reduces the expression of the viral lytic cycle genes and also the induction of cell apoptosis and finally prevents the generation of LCL.

Efficacy and Safety of a Protein-Based SARS-CoV-2 Vaccine: A Randomized Clinical Trial.

Importance: The protein-based SARS-CoV-2 vaccines FINLAY-FR-2 (Soberana 02) and FINLAY-FR-1A (Soberana Plus) showed good safety and immunogenicity in phase 1 and 2 trials, but the clinical efficacy of the vaccine remains unknown. Objective: To evaluate the efficacy and safety of a 2-dose regimen of FINLAY-FR-2 (cohort 1) and a 3-dose regimen of FINLAY-FR-2 with FINLAY-FR-1A (cohort 2) in Iranian adults. Design, Setting, and Participants: A multicenter, randomized, double-blind, placebo-controlled, phase 3 trial was conducted at 6 cities in cohort 1 and 2 cities in cohort 2. Participants included individuals aged 18 to 80 years without uncontrolled comorbidities, coagulation disorders, pregnancy or breastfeeding, recent immunoglobulin or immunosuppressive therapy, and clinical presentation or laboratory-confirmed COVID-19 on enrollment. The study was conducted from April 26 to September 25, 2021. Interventions: In cohort 1, 2 doses of FINLAY-FR-2 (n = 13 857) or placebo (n = 3462) were administered 28 days apart. In cohort 2, 2 doses of FINLAY-FR-2 plus 1 dose of FINLAY-FR-1A (n = 4340) or 3 placebo doses (n = 1081) were administered 28 days apart. Vaccinations were administered via intramuscular injection. Main Outcomes and Measures: The primary outcome was polymerase chain reaction-confirmed symptomatic COVID-19 infection at least 14 days after vaccination completion. Other outcomes were adverse events and severe COVID-19. Intention-to-treat analysis was performed. Results: In cohort 1 a total 17 319 individuals received 2 doses and in cohort 2 5521 received 3 doses of the vaccine or placebo. Cohort 1 comprised 60.1% men in the vaccine group and 59.1% men in the placebo group; cohort 2 included 59.8% men in the vaccine group and 59.9% in the placebo group. The mean (SD) age was 39.3 (11.9) years in cohort 1 and 39.7 (12.0) years in cohort 2, with no significant difference between the vaccine and placebo groups. The median follow-up time in cohort 1 was 100 (IQR, 96-106) days and, in cohort 2, 142 (137-148) days. In cohort 1, 461 (3.2%) cases of COVID-19 occurred in the vaccine group and 221 (6.1%) in the placebo group (vaccine efficacy: 49.7%; 95% CI, 40.8%-57.3%) vs 75 (1.6%) and 51 (4.3%) in cohort 2 (vaccine efficacy: 64.9%; 95% CI, 49.7%-59.5%). The incidence of serious adverse events was lower than 0.1%, with no vaccine-related deaths. Conclusions and Relevance: In this multicenter, randomized, double-blind, placebo-controlled, phase 3 trial of the efficacy and safety of FINLAY-FR-2 and FINLAY-FR-1A, 2 doses of FINLAY-FR-2 plus the third dose of FINLAY-FR-1A showed acceptable vaccine efficacy against symptomatic COVID-19 as well as COVID-19-related severe infections. Vaccination was generally safe and well tolerated. Therefore, Soberana may have utility as an option for mass vaccination of the population, especially in resource-limited settings, because of its storage condition and affordable price. Trial Registration: isrctn.org Identifier: IRCT20210303050558N1.

SARS-CoV-2 in domestic cats (Felis catus) in the northwest of Iran: Evidence for SARS-CoV-2 circulating between human and cats.

This study aimed to investigate the prevalence of COVID-19 in domestic cats, focusing on the disease in the northwest of Iran and then showing the natural transmission of SARS-COV-2 circulating between domestic cats and humans. After receiving ethic codes from Tehran University of Medical Sciences (IR.TUMS.VCR.REC.1399.303) and confirmed by the Center of Communicable Diseases Control (CDC) of Iran, 124 domestic cats were collected from the homes and only one hospital of Meshkin -Shahr district from northwestern Iran where SARS-CoV-2 patients were hospitalized and quarantined during 2020. Samples were prepared from fluid materials of oropharynx and nasopharynx. All samples were tested by real-time PCR (RT-PCR) using specific genes N and ORF1ab in Pasteur Institute of Iran, and then partial sequence analyses of S gene were performed. All collected cats were kept in separated cages until SARS-COV-2 infection was confirmed with the RT-PCR. RT- PCR Ct values of 123 collected cats were ≥40; thus, all of them showed negative results, but one of the collected cats with close contact with its owner, whom confirmed SARS-CoV-2 showed positive results with gene N(Ct=30) and gene ORF1ab (Ct=32). Furthermore, the positive pet cat showed respiratory and gastro-intestinal clinical manifestations, and its owner was infected with SARS-CoV-2 two weeks ago. Cats are susceptible animals to SARS-CoV-2 infection. Epidemiological evidence showed that SARS-COV-2 is able to transmit to healthy cats due to having close contact with its owner as a reverse zoonosis.

Full length antigen priming enhances the CTL epitope-based DNA vaccine efficacy.

Although CD8+ cytotoxic T lymphocyte (CTL) epitope-based DNA vaccination is valuable experience on vaccine research but many attempts are still continued to achieve acceptable protective response. To study the role of full length antigen in CTL epitope immunization, we evaluated cellular immunity of diverse patterns of complete Herpes simplex virus type 1 (HSV-1) glycoprotein B (gB) and the immunodominant CTL epitope (498-505) DNA injection in C57BL/6 mice. Optimal immune response was observed in the group immunized with the full length of gB in the first injection and CTL epitope in the second and third vaccination as assessed by lymphocyte proliferation assay (MTT), cytokine assay (ELISA) and CTL assay. B cell and spatially CD4+ T cell epitopes in full length protein might be important for appropriate priming of CTL immune response. These findings may have important implication for the improvement of CTL epitope based DNA vaccine against HSV and other pathogens.

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens.

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.