RESUMO
OBJECTIVE: To characterize the correlation, agreement and concordance of cardiac output (CO) measured with transthoracic ultrasound and the correlation and concordance of aortic blood flow (ABF) minute distance (MD) measured by transesophageal Doppler with CO measured by pulmonary artery thermodilution (PATD) in cats. STUDY DESIGN: Experimental study. ANIMALS: A group of six healthy male neutered cats, aged 2-8 years and weighing 5.3 ± 0.3 kg. METHODS: Cats were anesthetized with isoflurane in oxygen. CO was measured by PATD (COPATD) and transthoracic echocardiography (COECHO). ABF MD was measured using an esophageal Doppler flow probe aligned with descending ABF. All measurements were made under three conditions: dexmedetomidine (20 µg kg-1) intravenously; atipamezole (200 µg kg-1) intramuscularly and atropine (20 µg kg-1) intravenously as needed to achieve a minimum heart rate of 140 beats minute-1; and dopamine (20 µg kg-1 minute-1) intravenously in that order. Correlation between COPATD and COECHO, and COPATD and Doppler MD was evaluated using repeated measures correlation. Agreement between COPATD and COECHO was evaluated using Bland-Altman method. Differences between consecutive pairs of CO measurements were calculated for concordance analysis. RESULTS: Correlation between COPATD and COECHO and between COPATD and MD was significant (p < 0.001), with correlation coefficients greater than 0.92. A bias of > 27% and upper limits of agreement of 66% were found between COPATD and COECHO. Concordance rate with COPATD was 76-80% for COECHO and 72% for MD. CONCLUSIONS AND CLINICAL RELEVANCE: Echocardiographic methods for the measurement of CO showed poor agreement and concordance with PATD. MD showed poor concordance with PATD. As such, these methods cannot be used as an alternative to PATD nor can they appropriately track changes in CO in anesthetized cats.
RESUMO
BACKGROUND: Diastolic dysfunction in humans is an age-related process with an overrepresentation in women. In rhesus macaques (Macaca mulatta), the incidence and predictors of diastolic dysfunction have yet to be reported. METHODS: Data from routine echocardiographic evaluations on clinically healthy rhesus macaques was obtained and used for univariate, bivariate, hypothesis testing, and linear regression statistical analyses interrogating differences and predictors of diastolic function. RESULTS: Rhesus macaques fully recapitulate previously reported human hemodynamic studies. Female monkeys display impaired diastology and are at an increased risk for developing diastolic dysfunction. Age, sex, and proxies of exercise activity are confirmed predictors for measures of diastolic dysfunction, regardless of specific pathogen-free status. CONCLUSIONS: Rhesus macaques share common sex- and age-related echocardiographic findings as humans, therefore, serve as a valuable translational nonhuman primate model for future studies of diastolic dysfunction. These findings confirm the importance of sex- and age-matching within future rhesus macaque cardiovascular research.
Assuntos
Ecocardiografia , Masculino , Humanos , Animais , Feminino , Macaca mulatta , Ecocardiografia/veterináriaRESUMO
Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prioritize potential genetic variants. Of the 2,808 variants that significantly associated with the phenotype using an AR mode of inheritance (P<0.02) and located within a region of homozygosity, 1,507 (54%) were located in a 9.7 Mb region on chr4 (44.9-54.6 Mb). Within this region, a nonsense variant (RAPGEF5 c.2624C>A,p.Ser875*) was significantly associated with the hypoparathyroid phenotype (Pallelic = 0.008). Affected foals were homozygous for the variant, with two additional affected foals subsequently confirmed in 2019. Necropsies of all affected foals failed to identify any histologically normal parathyroid glands. Because the nonsense mutation in RAPGEF5 was near the C-terminal end of the protein, the impact on protein function was unclear. Therefore, we tested the variant in our Xenopus overexpression model and demonstrated RAPGEF5 loss-of-function. This RAPGEF5 variant represents the first genetic variant for hypoparathyroidism identified in any domestic animal species.
Assuntos
Códon sem Sentido , Doenças dos Cavalos/genética , Hipocalcemia/veterinária , Hipoparatireoidismo/veterinária , Fatores ras de Troca de Nucleotídeo Guanina/genética , Fatores ras de Troca de Nucleotídeo Guanina/metabolismo , Animais , Embrião não Mamífero , Feminino , Homozigoto , Doenças dos Cavalos/etiologia , Cavalos , Hipocalcemia/genética , Hipocalcemia/patologia , Hipoparatireoidismo/genética , Hipoparatireoidismo/patologia , Masculino , Linhagem , Sequenciamento Completo do Genoma , Xenopus/embriologia , Fatores ras de Troca de Nucleotídeo Guanina/químicaRESUMO
Hypertrophic cardiomyopathy (HCM) is the most prevalent cardiac disease in cats and lacks efficacious preclinical pharmacologic intervention, prompting investigation of novel therapies. Genetic mutations encoding sarcomeric proteins are implicated in the development of HCM and small molecule myosin inhibitors are an emerging class of therapeutics designed to target the interaction of actin and myosin to alleviate the detrimental effects of inappropriate contractile protein interactions. The purpose of this study was to characterize the pharmacodynamic effects of a single oral dose of the novel cardiac myosin inhibitor aficamten (CK-274) on cardiac function in purpose bred cats with naturally occurring A31P MYBPC3 mutation and a clinical diagnosis of HCM with left ventricular outflow tract obstruction (LVOTO). Five purpose bred cats were treated with aficamten (2 mg/kg) or vehicle and echocardiographic evaluations were performed at 0, 6, 24, and 48 h post-dosing. High dose aficamten (2 mg/kg) reduced left ventricular fractional shortening (LVFS%) by increasing the LV systolic internal dimension (LVIDs) and reduced isovolumic relaxation time (IVRT) compared with baseline without significant adverse effects. The marked reduction in systolic function and reduced IVRT coupled with an increased heart rate in treated cats, suggest a lower dose may be optimal. Further studies to determine optimal dosing of aficamten are indicated.
Assuntos
Cardiomiopatia Hipertrófica , Doenças do Gato , Gatos , Animais , Proteínas de Transporte/genética , Proteínas de Transporte/metabolismo , Cardiomiopatia Hipertrófica/tratamento farmacológico , Cardiomiopatia Hipertrófica/genética , Cardiomiopatia Hipertrófica/veterinária , Mutação , Contração Miocárdica , Ecocardiografia/veterinária , Doenças do Gato/tratamento farmacológicoRESUMO
BACKGROUND: Glanzmann's thrombasthenia (GT) is a congenital platelet disorder affecting approximately 1:1 000 000 people globally and characterized by impaired platelet aggregation and clot retraction. Autosomal recessive, loss-of-function, variants in ITGA2B or ITGB3 of the αIIbß3 receptor cause the disease in humans. A cat affected by Glanzmann's and macrothrombocytopenia was presented to the UC Davis VMTH. HYPOTHESIS/OBJECTIVES: Severe thrombopathia in this cat has an underlying genetic etiology. ANIMALS: A single affected patient, 2 age-matched clinically healthy controls, and a geriatric population (n = 20) of normal cats. METHODS: Physical examination and clinical pathology tests were performed on the patient. Flow cytometry and platelet aggregometry analyses for patient phenotyping were performed. Patient and validation cohort gDNA samples were extracted for Sanger sequencing of a previously identified ITGA2B (c.1986delC) variant. Reverse transcriptase PCR was performed on patient and healthy control PRP samples to verify ITGA2B variant consequence. RESULTS: A novel c.1986_1987insCC autosomal recessive variant in ITGA2B was identified. This variant was absent in a population of 194 unrelated cats spanning 44 different breeds. Complete loss of ITGA2B transcript and protein expression was verified by RT-PCR and flow cytometry, explaining the underlying etiology of GT, and likely macrothrombocytopenia, in this cat. CONCLUSIONS AND CLINICAL IMPORTANCE: This study emphasizes the role of precision medicine in cardiovascular disease of cats and identified yet another variant that may be of utility for screening in the feline population. This study provides a small-volume, standardized, successful protocol for adequate platelet RNA isolation and subsequent molecular assessment of gene expression in cats.
Assuntos
Doenças do Gato , Mutação da Fase de Leitura , Integrina alfa2 , Trombastenia , Animais , Gatos , Trombastenia/veterinária , Trombastenia/genética , Doenças do Gato/genética , Integrina alfa2/genética , Masculino , FemininoRESUMO
Hypertrophic cardiomyopathy (HCM) remains the most common cardiomyopathy in humans and cats with few preclinical pharmacologic interventional studies. Small-molecule sarcomere inhibitors are promising novel therapeutics for the management of obstructive HCM (oHCM) patients and have shown efficacy in left ventricular outflow tract obstruction (LVOTO) relief. The objective of this study was to explore the 6-, 24-, and 48-hour (h) pharmacodynamic effects of the cardiac myosin inhibitor, CK-586, in six purpose-bred cats with naturally occurring oHCM. A blinded, randomized, five-treatment group, crossover preclinical trial was conducted to assess the pharmacodynamic effects of CK-586 in this oHCM model. Dose assessments and select echocardiographic variables were assessed five times over a 48-h period. Treatment with oral CK-586 safely ameliorated LVOTO in oHCM cats. CK-586 treatment dose-dependently eliminated obstruction (reduced LVOTOmaxPG), increased measures of systolic chamber size (LVIDs Sx), and decreased select measures of heart function (LV FS% and LV EF%) in the absence of impact on heart rate. At all tested doses, a single oral CK-586 dose resulted in improved or resolved LVOTO with well-tolerated, dose-dependent, reductions in LV systolic function. The results from this study pave the way for the potential use of CK-586 in both the veterinary and human clinical setting.
Assuntos
Miosinas Cardíacas , Cardiomiopatia Hipertrófica , Animais , Gatos , Cardiomiopatia Hipertrófica/tratamento farmacológico , Miosinas Cardíacas/metabolismo , Doenças do Gato/tratamento farmacológico , Masculino , Feminino , Obstrução do Fluxo Ventricular Externo/tratamento farmacológico , Sístole/efeitos dos fármacos , Ecocardiografia , Estudos Cross-OverRESUMO
Cardiomyopathies remain one of the most common inherited cardiac diseases in both human and veterinary patients. To date, well over 100 mutated genes are known to cause cardiomyopathies in humans with only a handful known in cats and dogs. This review highlights the need and use of personalized one-health approaches to cardiovascular case management and advancement in pharmacogenetic-based therapy in veterinary medicine. Personalized medicine holds promise in understanding the molecular basis of disease and ultimately will unlock the next generation of targeted novel pharmaceuticals and aid in the reversal of detrimental effects at a molecular level.
Assuntos
Cardiologia , Cardiomiopatias , Doenças do Gato , Doenças do Cão , Drogas Veterinárias , Humanos , Animais , Gatos , Cães , Animais de Estimação , Medicina de Precisão/veterinária , Cardiomiopatias/genética , Cardiomiopatias/terapia , Cardiomiopatias/veterinária , Doenças do Gato/tratamento farmacológico , Doenças do Gato/genética , Doenças do Cão/tratamento farmacológico , Doenças do Cão/genéticaRESUMO
Feline HCM is the most common cardiovascular disease in cats, leading to devastating outcomes, including congestive heart failure (CHF), arterial thromboembolism (ATE), and sudden death. Evidence demonstrating long-term survival benefit with currently available therapies is lacking. Therefore, it is imperative to explore intricate genetic and molecular pathways that drive HCM pathophysiology to inspire the development of novel therapeutics. Several clinical trials exploring new drug therapies are currently underway, including those investigating small molecule inhibitors and rapamycin. This article outlines the key work performed using cellular and animal models that has led to and continues to guide the development of new innovative therapeutic strategies.
RESUMO
Hypertrophic cardiomyopathy (HCM) remains the single most common cardiomyopathy in cats, with a staggering prevalence as high as 15%. To date, little to no direct therapeutical intervention for HCM exists for veterinary patients. A previous study aimed to evaluate the effects of delayed-release (DR) rapamycin dosing in a client-owned population of subclinical, non-obstructive, HCM-affected cats and reported that the drug was well tolerated and resulted in beneficial LV remodeling. However, the precise effects of rapamycin in the hypertrophied myocardium remain unknown. Using a feline research colony with naturally occurring hereditary HCM (n = 9), we embarked on the first-ever pilot study to examine the tissue-, urine-, and plasma-level proteomic and tissue-level transcriptomic effects of an intermittent low dose (0.15 mg/kg) and high dose (0.30 mg/kg) of DR oral rapamycin once weekly. Rapamycin remained safe and well tolerated in cats receiving both doses for eight weeks. Following repeated weekly dosing, transcriptomic differences between the low- and high-dose groups support dose-responsive suppressive effects on myocardial hypertrophy and stimulatory effects on autophagy. Differences in the myocardial proteome between treated and control cats suggest potential anti-coagulant/-thrombotic, cellular remodeling, and metabolic effects of the drug. The results of this study closely recapitulate what is observed in the human literature, and the use of rapamycin in the clinical setting as the first therapeutic agent with disease-modifying effects on HCM remains promising. The results of this study establish the need for future validation efforts that investigate the fine-scale relationship between rapamycin treatment and the most compelling gene expression and protein abundance differences reported here.
RESUMO
Hypertrophic cardiomyopathy (HCM) is the most prevalent inherited cardiac disease in humans and cats and lacks efficacious pharmacologic interventions in the preclinical phase of disease. LV outflow tract obstruction (LVOTO) is commonly observed in HCM-affected patients and is a primary driver of heart failure symptoms and reduced quality of life. Novel small-molecule cardiac myosin inhibitors target actin-myosin interactions to alleviate overactive protein interactions. A prospective, randomized, controlled cross-over study was performed to evaluate pharmacodynamic effects of two doses (0.3 and 1 mg/kg) of a next-in-class cardiac myosin inhibitor, aficamten (CK-3773274, CK-274), on cardiac function in cats with the A31P MYBPC3 mutation and oHCM. Dose-dependent reductions in LV systolic function, LVOT pressure gradient, and isovolumetric relaxation times compared to baseline were observed. Promising beneficial effects of reduced systolic function warrant further studies of this next-in-class therapeutic to evaluate the benefit of long-term administration in this patient population.
Assuntos
Cardiomiopatia Hipertrófica , Qualidade de Vida , Humanos , Gatos , Animais , Estudos Prospectivos , Estudos Cross-Over , Cardiomiopatia Hipertrófica/tratamento farmacológico , Cardiomiopatia Hipertrófica/genética , Contração MiocárdicaRESUMO
BACKGROUND: Dual antithrombotic treatment (DAT) with clopidogrel and rivaroxaban sometimes is prescribed to cats with hypertrophic cardiomyopathy at risk of thromboembolism. To date, no studies have evaluated their combined effects on platelet function. OBJECTIVES/HYPOTHESIS: Evaluate the safety of DAT in healthy cats and compare, ex vivo, platelet-dependent thrombin generation and agonist-induced platelet activation and aggregation in cats treated with clopidogrel, rivaroxaban, or DAT. We hypothesized that DAT would safely modulate agonist-induced platelet activation and aggregation more effectively than single agent treatment. ANIMALS: Nine apparently healthy 1-year-old cats selected from a research colony. METHODS: Unblinded, nonrandomized ex vivo cross-over study. All cats received 7 days of rivaroxaban (0.6 ± 0.1 mg/kg PO), clopidogrel (4.7 ± 0.8 mg/kg PO), or DAT with defined washout periods between treatments. Before and after each treatment, adenosine diphosphate (ADP)- and thrombin-induced platelet P-selectin expression was evaluated using flow cytometry to assess platelet activation. Platelet-dependent thrombin generation was measured by fluorescence assay. Platelet aggregation was assessed using whole blood impedance platelet aggregometry. RESULTS: No cats exhibited adverse effects. Of the 3 treatments, only DAT significantly decreased the number of activated platelets (P = .002), modulated platelet activation in response to thrombin (P = .01), dampened thrombin generation potential (P = .01), and delayed maximum reaction velocity (P = .004) in thrombin generation. Like clopidogrel, DAT inhibited ADP-mediated platelet aggregation. However, rivaroxaban alone resulted in increased aggregation and activation in response to ADP. CONCLUSION AND CLINICAL IMPORTANCE: Treatment combining clopidogrel and rivaroxaban (DAT) safely decreases platelet activation, platelet response to agonists, and thrombin generation in feline platelets more effectively than monotherapy with either clopidogrel or rivaroxaban.
Assuntos
Inibidores da Agregação Plaquetária , Rivaroxabana , Gatos , Animais , Clopidogrel/farmacologia , Clopidogrel/metabolismo , Rivaroxabana/farmacologia , Inibidores da Agregação Plaquetária/uso terapêutico , Trombina/metabolismo , Trombina/farmacologia , Ticlopidina/farmacologia , Estudos Cross-Over , Aspirina , Plaquetas , Agregação Plaquetária , Difosfato de AdenosinaRESUMO
We sought to establish a large animal model of inherited hypertrophic cardiomyopathy (HCM) with sufficient disease severity and early penetrance for identification of novel therapeutic strategies. HCM is the most common inherited cardiac disorder affecting 1 in 250-500 people, yet few therapies for its treatment or prevention are available. A research colony of purpose-bred cats carrying the A31P mutation in MYBPC3 was founded using sperm from a single heterozygous male cat. Cardiac function in four generations was assessed by periodic echocardiography and measurement of blood biomarkers. Results showed that HCM penetrance was age-dependent, and that penetrance occurred earlier and was more severe in successive generations, especially in homozygotes. Homozygosity was also associated with progression from preclinical to clinical disease. A31P homozygous cats represent a heritable model of HCM with early disease penetrance and a severe phenotype necessary for interventional studies aimed at altering disease progression. The occurrence of a more severe phenotype in later generations of cats, and the occasional occurrence of HCM in wildtype cats suggests the presence of at least one gene modifier or a second causal variant in this research colony that exacerbates the HCM phenotype when inherited in combination with the A31P mutation.
Assuntos
Cardiomiopatia Hipertrófica , Predisposição Genética para Doença , Animais , Masculino , Sêmen , Cardiomiopatia Hipertrófica/genética , Cardiomiopatia Hipertrófica/veterinária , Mutação , Fenótipo , Proteínas do Citoesqueleto/genética , Miosinas Cardíacas/genéticaRESUMO
OBJECTIVE: Feline hypertrophic cardiomyopathy (HCM) remains a disease with little therapeutic advancement. Rapamycin modulates the mTOR pathway, preventing and reversing cardiac hypertrophy in rodent disease models. Its use in human renal allograft patients is associated with reduced cardiac wall thickness. We sought to evaluate the effects of once-weekly delayed-release (DR) rapamycin over 6 months on echocardiographic, biochemical, and biomarker responses in cats with subclinical, nonobstructive HCM. ANIMALS: 43 client-owned cats with subclinical HCM. METHODS: Cats enrolled in this double-blinded, multicentered, randomized, and placebo-controlled clinical trial were allocated to low- or high-dose DR rapamycin or placebo. Cats underwent physical examination, quality-of-life assessment, blood pressure, hematology, biochemistry, total T4, urinalysis, N-terminal pro-B-type natriuretic peptide, and cardiac troponin I at baseline and days 60, 120, and 180. Fructosamine was analyzed at screening and day 180. Echocardiograms were performed at all time points excluding day 120. Outcome variables were compared using a repeated measures ANCOVA. RESULTS: No demographic, echocardiographic, or clinicopathologic values were significantly different between study groups at baseline, confirming successful randomization. At day 180, the primary study outcome variable, maximum LV myocardial wall thickness at any location, was significantly lower in the low-dose DR rapamycin group compared to placebo (P = .01). Oral DR rapamycin was well tolerated with no significant differences in adverse events between groups. CLINICAL RELEVANCE: Results demonstrate that DR rapamycin was well tolerated and may prevent or delay progressive LV hypertrophy in cats with subclinical HCM. Additional studies are warranted to confirm and further characterize these results.
Assuntos
Cardiomiopatia Hipertrófica , Doenças do Gato , Hipertrofia Ventricular Esquerda , Sirolimo , Animais , Gatos , Cardiomiopatia Hipertrófica/tratamento farmacológico , Cardiomiopatia Hipertrófica/veterinária , Cardiomiopatia Hipertrófica/patologia , Doenças do Gato/tratamento farmacológico , Doenças do Gato/patologia , Coração , Hipertrofia Ventricular Esquerda/tratamento farmacológico , Hipertrofia Ventricular Esquerda/veterinária , Hipertrofia Ventricular Esquerda/patologia , Miocárdio/patologia , Sirolimo/administração & dosagem , Preparações de Ação Retardada/administração & dosagemRESUMO
BACKGROUND: Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder associated with a vitamin E deficiency within the first year of life. Vitamin E consists of 8 isoforms metabolized by the CYP4F2 enzyme. No antemortem diagnostic test currently exists for eNAD/EDM. HYPOTHESIS/OBJECTIVES: Based on the association of α-tocopherol deficiency with the development of eNAD/EDM, we hypothesized that the rate of α-tocopherol, but not γ-tocopherol or tocotrienol metabolism, would be increased in eNAD/EDM-affected horses. ANIMALS: Vitamin E metabolism: Proof of concept (POC) study; eNAD/EDM-affected (n = 5) and control (n = 6) horses. Validation study: eNAD/EDM-affected Quarter Horses (QHs; n = 6), cervical vertebral compressive myelopathy affected (n = 6) horses and control (n = 29) horses. CYP4F2 expression and copy number: eNAD/EDM-affected (n = 12) and age- and sex-matched control (n = 11-12) horses. METHODS: The rates of α-tocopherol/tocotrienol and γ-tocopherol/tocotrienol metabolism were assessed in equine serum (POC and validation) and urine (POC only) using liquid chromatography tandem mass spectrometry (LC-MS/MS). Quantitative reverse-transcriptase PCR (qRT-PCR) and droplet digital (dd)-PCR were used to assay expression and genomic copy number of a CYP4F2 equine ortholog. RESULTS: Metabolic rate of α-tocopherol was increased in eNAD/EDM horses (POC,P < .0001; validation, P = .03), with no difference in the metabolic rate of γ-tocopherol. Horses with eNAD/EDM had increased expression of the CYP4F2 equine orthologue (P = .02) but no differences in copy number. CONCLUSIONS AND CLINICAL IMPORTANCE: Increased α-tocopherol metabolism in eNAD/EDM-affected QHs provides novel insight into alterations in vitamin E processing in eNAD/EDM and highlights the need for high-dose supplementation to prevent the clinical phenotype in genetically susceptible horses.
Assuntos
Doenças dos Cavalos , Distrofias Neuroaxonais , Animais , Cromatografia Líquida/veterinária , Cavalos , Distrofias Neuroaxonais/genética , Distrofias Neuroaxonais/veterinária , Espectrometria de Massas em Tandem/veterinária , Vitamina E , alfa-TocoferolRESUMO
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.
Assuntos
Epilepsia/veterinária , Doenças dos Cavalos/genética , Cavalos/genética , Ribonuclease P/genética , Ubiquitina-Proteína Ligases/genética , Animais , Egito , Eletroencefalografia , Epilepsia/diagnóstico , Epilepsia/genética , Genótipo , Convulsões/genética , Convulsões/veterinária , Deleção de SequênciaRESUMO
BACKGROUND: It is widely accepted that genomic instability is associated with several mechanisms involving oxidative stress, which can increase the rate of DNA breaks. Such factors include smoking, impairments in body composition, an unhealthy lifestyle, and a hereditary history of cancer. The aim was to evaluate the degree of association of genomic instability in smokers and non-smokers, and how the risk could change depending on the lifestyle and other causes. For this purpose, a survey of tobacco consumption, dietary patterns, physical activity, antecedents of cancer, and body composition assessment was carried out. Genomic instability was evaluated through a single-cell gel electrophoresis using peripheral blood mononuclear cells in three different conditions of oxidative stress. The analysis of genomic damage degree was performed through a dimension reduction procedure (principal component analysis) from 16 parameters per treatment (adding up 48 parameters of genomic damage per subject) and a binary logistic regression model for DNA fragmentation risk. RESULTS: The sample consisted of 82 participants, divided into three age groups: young adults (18-35 years), adults (36-59 years), and older adults (60-95 years). As expected, the results showed a significant positive correlation of age with genomic damage rates, represented by 2 PCA groups (p = 0.027, p = 0.004). There were consistent significant positive associations of genomic damage rates with smoking index and three PCA groups (p = 0.007, p = 0.004, p = 0.009). The smoking status and age group analysis revealed that there were significant differences for adult smokers with the same aforementioned PCA groups (p = 0.002, p = 0.001, p = 0.010). In addition, higher DNA damage rates were found in subjects with incorrect diet patterns, long sitting hours, and previous exposure to radiation. The analysis with binary logistic regression displayed two models in which lifestyles (age, diet, and/or sedentarism) did not change the significance of smoking index for DNA fragmentation risk; however, when physical activity was present in the model, the smoking index was not a significant factor for DNA damage risk. CONCLUSIONS: Although it is well known that smoking affects human health in different ways, DNA fragmentation can be analyzed by a damage phenotypic analysis and integrate a risk analysis reshaped by diet and lifestyle in general.
Assuntos
Metilação de DNA , Instabilidade Genômica , Análise de Célula Única/métodos , Fumar/genética , Adulto , Distribuição por Idade , Idoso , Idoso de 80 Anos ou mais , Estudos Transversais , Humanos , Estilo de Vida , Modelos Logísticos , Masculino , México , Pessoa de Meia-Idade , Análise de Sequência de DNA , Adulto JovemRESUMO
Mice with deficiency in tocopherol (alpha) transfer protein gene develop peripheral tocopherol deficiency and sensory neurodegeneration. Ttpa-/- mice maintained on diets with deficient α-tocopherol (α-TOH) had proprioceptive deficits by six months of age, axonal degeneration and neuronal chromatolysis within the dorsal column of the spinal cord and its projections into the medulla. Transmission electron microscopy revealed degeneration of dorsal column axons. We addressed the potential pathomechanism of α-TOH deficient neurodegeneration by global transcriptome sequencing within the spinal cord and cerebellum. RNA-sequencing of the spinal cord in Ttpa-/- mice revealed upregulation of genes associated with the innate immune response, indicating a molecular signature of microglial activation as a result of tocopherol deficiency. For the first time, low level Ttpa expression was identified in the murine spinal cord. Further, the transcription factor liver X receptor (LXR) was strongly activated by α-TOH deficiency, triggering dysregulation of cholesterol biosynthesis. The aberrant activation of transcription factor LXR suppressed the normal induction of the transcription factor retinoic-related orphan receptor-α (RORA), which is required for neural homeostasis. Thus we find that α-TOH deficiency induces LXR, which may lead to a molecular signature of microglial activation and contribute to sensory neurodegeneration.
Assuntos
Imunidade Inata/genética , Receptores X do Fígado/biossíntese , Degeneração Neural , Medula Espinal/metabolismo , Deficiência de Vitamina E/imunologia , Animais , Proteínas de Transporte/genética , Cerebelo/metabolismo , Feminino , Masculino , Camundongos , Camundongos Knockout , Degeneração Neural/genética , Degeneração Neural/imunologia , Degeneração Neural/patologia , Transcriptoma , Deficiência de Vitamina E/genética , alfa-TocoferolRESUMO
Introduction: There are different protocols for the management of anticoagulated patients that can be used when performing oral surgical procedures. Objective: To report the previous eva-luation and management of a hemorrhagic complication in the maxillofacial region in a patient undergoing oral anticoagulant therapy and the recommendations described in the literature for these patients. Clinical Case: Sixty-eight year old male patient, hospitalized in the cardiology unit due to heart failure, pending surgery for valve replacement. Treating physician requests evaluation for dental infection foci by a maxillofacial surgeon. Prior to medical examination and corresponding blood tests, four carious teeth are extracted, controlling hemostasis with local measures. During the night of the same day, the patient is referred again to the dental unit be-cause of an alveolorrhagia, being treated and controlled with new local measures; new standard blood tests are performed. Forty-eight hours later the patient presents an increase of volume in the right mandibular region compatible with hematoma and ecchymosis. It is decided to perform treatment, removing sutures, collagen and draining through the alveolus. Subsequently, new local measures are performed and the anticoagulant is suspended for 24 hrs. Conclusion: There are different care protocols for patients undergoing anticoagulant treatment in the literature, so each patient should be studied in advance to define what is the best therapeutic procedure to prevent complications.
Assuntos
Humanos , Masculino , Idoso , Hemorragia Bucal/complicações , Anticoagulantes/uso terapêutico , Procedimentos Cirúrgicos Bucais , Anticoagulantes/efeitos adversosRESUMO
La presente investigación desarrolla un análisis acerca de la depresión en las personas adultas mayores y la relación de factores para la aparición de dicha enfermedad. Para realizar la investigación se hizo un estudio del tipo observacional descriptivo tomando como universo los pacientes de la tercera edad que habitaban en la comunidad Minerva en el periodo de mayo a junio del 2016. Participaron en el estudio 52 adultos mayores de un total de 70. Se buscó hacer tamizaje de estados depresivos por medio del test de Yessavagee identificar factores de riesgo que contribuyan a la aparición de dicha enfermedad, para ello se usó la escala de valoración de calidad de vida de Whoqol-breef, y para evaluar la funcionalidad familiar el FF-SIL. Los resultados obtenidos en la población estudiada se encontró una frecuencia de depresión de 55.8% del total, del cual se dividió en depresión leve 72.4% y depresión severa 27.6%. Además, se determinó que los factores que se relacionan a la depresión son la pobre salud física, inadecuada salud psicológica y un ambiente no apropiado