Access to Workplace Supports is Positively Associated with Exclusive Breastfeeding among Formally Employed Mothers in Kenya.

BACKGROUND: Mothers in low-income settings who work in agricultural employment are challenged to meet breastfeeding (BF) recommendations. Recent legislation in Kenya mandates maternity leave and workplace supports, yet the relation of these benefits with BF practices is poorly understood. OBJECTIVES: We evaluated the associations with workplace-provided BF supports and BF practices among formally employed mothers in Kenya. The availability of supports was hypothesized to be associated with a higher prevalence and greater odds of exclusive breastfeeding (EBF). METHODS: We conducted repeated cross-sectional surveys among formally employed mothers at 1-4 d and 6, 14, and 36 wk (to estimate 24 wk) postpartum in Naivasha, Kenya. We used logistic regression adjusted for maternal age, education, physical burden of work, HIV status, and income to evaluate associations between workplace supports and EBF practices. RESULTS: Among formally employed mothers (n = 564), those who used onsite workplace childcare were more likely to practice EBF than those who used community- or home-based childcare at both 6 wk (95.7% compared with 82.4%, P = 0.030) and 14 wk (60.6% compared with 22.2%, P < 0.001; adjusted OR: 5.11; 95% CI: 2.3, 11.7). Likewise, at 14 wk among mothers who currently used daycare centers, a higher proportion of mothers who visited daycare centers at or near workplaces practiced EBF (70.0%) than of those not visiting daycare centers (34.7%, P = 0.005). EBF prevalence was higher among mothers with access to workplace private lactation spaces than among mothers without such spaces (84.6% compared with 55.6%, P = 0.037), and among mothers who lived in workplace housing than those without onsite housing (adjusted OR: 2.06, 95% CI: 1.25, 3.41). CONCLUSIONS: Formally employed mothers in Kenya who have access to and use workplace-provided BF supports were more likely to practice EBF than mothers who lacked these supports. As the Kenya Health Act is implemented, lactation rooms, onsite housing and daycare, and transportation to visit children can all support BF and EBF among employed mothers.

Society of Cardiovascular Anesthesiologists/European Association of Cardiothoracic Anaesthetists Practice Advisory for the Management of Perioperative Atrial Fibrillation in Patients Undergoing Cardiac Surgery.

Postoperative atrial fibrillation (poAF) is the most common adverse event after cardiac surgery and is associated with increased morbidity, mortality, and hospital and intensive care unit length of stay. Despite progressive improvements in overall cardiac surgical operative mortality and postoperative morbidity, the incidence of poAF has remained unchanged at 30%-50%. A number of evidence-based recommendations regarding the perioperative management of atrial fibrillation (AF) have been released from leading cardiovascular societies in recent years; however, it is unknown how closely these guidelines are being followed by medical practitioners. In addition, many of these society recommendations are based on patient stratification into "normal" and "elevated" risk groups for AF, but criteria for that stratification have not been clearly defined. In an effort to improve the perioperative management of AF, the Society of Cardiovascular Anesthesiologists (SCA) Clinical Practice Improvement Committee developed a multidisciplinary Atrial Fibrillation Working Group that created a summary of current best practice based on a distillation of recent guidelines from professional societies involved in the care of cardiac surgical patients. An evidence-based set of survey questions was then generated to describe the current practice of perioperative AF management. Through collaboration with the European Association of Cardiothoracic Anaesthetists (EACTA), that survey was distributed to the combined memberships of both the SCA and EACTA, yielding 641 responses and resulting in the most comprehensive understanding to date of perioperative AF management in North America, Europe, and beyond. The survey data demonstrated the broad range of therapies utilized for the prevention and treatment of poAF, as well as a spectrum of adherence to published guidelines. With the goal of improving adherence, a graphical advisory tool was created with an easily accessible format that could be utilized for bedside management. Finally, given that no evidence-based threshold currently exists to differentiate patients at normal risk to develop poAF from those at elevated risk, the SCA/EACTA AF working group created a list of poAF risk factors using expert opinion and based on published risk score models for poAF. This approach allows stratification of patients into risk groups and facilitates adherence to the evidence-based recommendations summarized in the graphical advisory tool. It is our hope that these new additions to the clinical toolkit for the management of perioperative AF will improve the evidence-based care and outcomes of cardiac surgical patients worldwide.

Society of Cardiovascular Anesthesiologists/European Association of Cardiothoracic Anaesthetists Practice Advisory for the Management of Perioperative Atrial Fibrillation in Patients Undergoing Cardiac Surgery.

Postoperative atrial fibrillation (poAF) is the most common adverse event after cardiac surgery and is associated with increased morbidity, mortality, and increased hospital and intensive care unit length of stay. Despite progressive improvements in overall cardiac surgical operative mortality and postoperative morbidity, the incidence of poAF has remained unchanged at 30% to 50%. A number of evidence-based recommendations regarding the perioperative management of atrial fibrillation (AF) have been released from leading cardiovascular societies in recent years; however, it is unknown how closely these guidelines are being followed by medical practitioners. In addition, many of these society recommendations are based on patient stratification into "normal" and "elevated" risk groups for AF, but criteria for that stratification have not been defined clearly. In an effort to improve the perioperative management of AF, the Society of Cardiovascular Anesthesiologists (SCA) Clinical Practice Improvement Committee developed a multidisciplinary Atrial Fibrillation Working Group that created a summary of current best practices based on distillation of recent guidelines from professional societies involved in the care of cardiac surgical patients. An evidence-based set of survey questions then was generated to describe the current practice of perioperative AF management. Through a collaboration with the European Association of Cardiothoracic Anaesthetists (EACTA), that survey was distributed to the combined memberships of both the SCA and the EACTA, yielding 641 responses and resulting in the most comprehensive understanding to date of perioperative AF management in North America and Europe and beyond. The survey data demonstrated the broad range of therapies used for prevention and treatment of poAF, as well as a spectrum of adherence to published guidelines. With the goal of improving adherence, a graphical advisory tool was created with an easily accessible format that could be used for bedside management. Finally, given that no evidence-based threshold currently exists to differentiate patients at normal risk of developing poAF from those at elevated risk, the SCA/EACTA AF working group created a list of poAF risk factors using expert opinion, based on published risk score models for poAF. This allows stratification of patients into risk groups and facilitates adherence to the evidence-based recommendations summarized in the graphical advisory tool. It is the working group's hope that these new additions to the clinical toolkit for management of perioperative AF will improve the evidence-based care and outcomes of cardiac surgical patients worldwide.

Role of blossom colonization in pepper seed infestation by Xanthomonas euvesicatoria.

Colonization of Xanthomonas euvesicatoria was investigated in pepper blossoms and the relationship between inoculum concentrations and seed infestation was determined. Inoculation of blossoms resulted in asymptomatic pepper fruit. However, real-time polymerase chain reaction detected X. euvesicatoria in 39% of the seed lots assayed and viable colonies were recovered from 35% of them. Successful transmission occurred in 16% of the seed lots tested. In a separate experiment, X. euvesicatoria reached populations of up to 1 × 10(5) CFU/blossom on stigmas 96 h after inoculation. Bacteria colonized stylar and ovary tissues with populations ranging from 1 × 10(5) to 1 × 10(6) CFU/blossom 96 h after inoculation. A positive correlation existed between inoculum concentration and percentage of infested seedlots. Blossoms inoculated with Acidovorax citrulli also resulted in infested pepper seedlots. Furthermore, A. citrulli colonized pepper blossoms significantly better than X. euvesicatoria by 96 h postinoculation. It was concluded that pepper blossoms can be a potential site of ingress for X. euvesicatoria into seed, and blossom colonization may be involved in pepper seed infestation. Data also indicated that seed infestation via blossoms may be nonspecific because nonhost plants can be colonized by incompatible pathogens. Thus, host-pathogen interactions may not be important for bacterial ingress through blossoms.

Relationship Between Fungicide Sensitivity and Control of Gummy Stem Blight of Watermelon Under Field Conditions.

Gummy stem blight (GSB), caused by the fungus Didymella bryoniae, is the most destructive disease of watermelon and is managed primarily with fungicides. D. bryoniae has developed resistance to many fungicides that were once very effective, including azoxystrobin, boscalid, and thiophanate-methyl. Field experiments were conducted in Tifton (TN) and Reidsville (RV), GA in 2009 and 2010 to establish a relationship between frequency of resistance to a fungicide based on in vitro assays and its efficacy in the management of GSB. Frequency of resistance to boscalid, thiophanate-methyl, and azoxystrobin was >0.80 in isolates collected from nontreated plots in both locations and years. All isolates collected after six applications of boscalid, thiophanate-methyl, or azoxystrobin were resistant to the respective fungicide. All isolates collected from treated and nontreated plots were sensitive to tebuconazole and difenoconazole. GSB severity was assessed on a weekly basis from 63 days after planting. GSB severity in plots treated with boscalid, thiophanate-methyl, or azoxystrobin was not significantly different from that in the nontreated plots (39%, TN-2009; 45%, TN-2010; and 16%, RV-2010). GSB severity in tebuconazole-treated plots (27%, TN-2009; 14%, TN-2010; and 4%, RV-2010) was significantly lower than all other treatments and the nontreated control. There was a consistent negative association between frequency of fungicide resistance and disease control in the field. Thus, knowledge of the frequency of fungicide resistance in the pathogen population will be helpful in selecting the most effective fungicides for the management of GSB in watermelon fields.

First Report of a New Disease of Onion in Georgia Caused by a Nonfluorescent Pseudomonas Species.

Since 2007, a new disease of onion (Allium cepa) called yellow bud has been a problem in Georgia. Emerging leaves display intense chlorosis and older leaves exhibit extensive leaf blight. Yield reductions can be severe due to stand loss and reduced bulb size. Symptomatic plants are also more prone to freeze damage. The suspected causal agent is a slow-growing, white bacterium isolated onto nutrient agar (NA) by streak isolation. The bacterium grew more vigorously on NA supplemented with 0.5% yeast extract (NA+). Six strains of the bacterium all had gram-negative, rod-shaped cells and were strict aerobes. The strains produced levan, were negative for oxidase, potato rot, and arginine dihydrolase, and produced a hypersensitive reaction in tobacco. These are all characteristics of Pseudomonas group Ia as outlined by Lelliott et al. (2) and differ from characteristics of known Pseudomonas pathogens of onion such as P. aeruginosa, P. marginalis, and P. viridiflava that belong to groups Va, IVa, and II, respectively. The yellow bud bacterial strains were also nonfluorescent on King's medium B and were ice nucleation active. Universal primers PA16SF and PA16SR (ATCCTGGCTCAGATTGAACG and TTCCCCTACGGTTACCTTGTT) were used to amplify the 16S rRNA gene. The resulting consensus nucleotide sequence (GenBank Accession No. JF939841) of the six isolates matched those strains of P. syringae pv. atropurpurea, P. syringae pv. maculicola, P. syringae pv. porri, and P. amygdali (96 to 98% similarity). Primers 1 and 2 (GGCGCTCCCTCGCACTT and GGTATTGGCGGGGGTGC) were used to amplify the coronafacate ligase (cfl) gene. The resulting consensus nucleotide sequence for the six isolates (GenBank Accession No. JF939842) matched the cfl gene from P. syringae pv. tomato, P. syringae pv. morsprunorum, P. syrinage pv. aesculi, and P. syringae pv. glycinea (97 to 99% similarity). Representative strains had 0.95 to 0.99% similarity to P. syringae pv. coronafaciens using Biolog (Biolog, Hayward, CA), and 0.72 to 0.96% similarity to P. syringaepv. tomato using fatty acid analysis (MIDI Inc., Newark, DE). For each of eight representative yellow bud strains, 10 greenhouse-grown onion seedlings of cv. Pegasus were inoculated on one leaf. Bacteria grown on NA+ were suspended in sterile tap water and adjusted to ~1 × 108 CFU/ml. With a hypodermic syringe and needle, 1.0 ml of inoculum was injected in to the hollow cavity of an emerging onion leaf. Chlorosis developed on inoculated leaves in 5 days and was identical to that observed with natural infections. All inoculated plants died within 14 days, confirming pathogenicity. Bacteria with characteristics described above were reisolated from symptomatic leaves. Ten control plants inoculated with sterile water remained asymptomatic. Based on the methods listed above, the yellow bud bacterium was identified as P. syringae, but pathovar designation or genomospecies (1) could not be determined because results varied among the different methods tested. The disease has been spreading throughout the Vidalia onion-growing region since it was first observed. There is significant potential for the disease to become more widespread since it also has been observed in direct-seeded, onion transplant beds. References: (1) J. P. Euzéby. List of Prokaryotic Names with Standing in Nomenclature-Genus Pseudomonas. Online publication. Retrieved from http://www.bacterio.cict.fr/p/pseudomonas.html , 2010. (2) R. A. Lelliott et al. J. Appl. Bact. 29:470, 1966.

Formal maternal employment is associated with lower odds of exclusive breastfeeding by 14 weeks postpartum: a cross-sectional survey in Naivasha, Kenya.

BACKGROUND: In many low- and middle-income countries, improvements in exclusive breastfeeding (EBF) have stalled, delaying reductions in child mortality. Maternal employment is a potential barrier to EBF. OBJECTIVES: We evaluated associations between maternal employment and breastfeeding (BF) status. We compared formally and non-formally employed mothers in Naivasha, Kenya, where commercial floriculture and hospitality industries employ many women. METHODS: We conducted a cross-sectional survey among mothers (n = 1186) from September 2018 to October 2019 at 4 postpartum time points: at hospital discharge (n = 296) and at 6 wk (n = 298), 14 wk (n = 295), and 36 wk (to estimate BF at 24 wk; n = 297) postpartum. Mothers reported their BF status and reasons for EBF cessation. We used multivariable logistic regression models to test the association between formal maternal employment and 3 outcomes: early BF initiation (within 1 h of birth), EBF at each time point, and continued BF at 9 mo. Models were informed by a directed acyclic graph: a causal diagram used to characterize the relationship among variables that influence the independent (employment) and dependent (BF status) variables. RESULTS: EBF did not differ by employment status at hospital discharge or at 6 wk postpartum. However, formally employed mothers were less likely than those not formally employed to report EBF at 14 wk (59.0% compared with 95.4%, respectively; AOR: 0.19; 95% CI: 0.10, 0.34) and at 24 wk (19.0% compared with 49.6%, respectively; AOR: 0.25; 95% CI: 0.14, 0.44). The prevalence of continued BF at 36 wk did not differ by group (98.1% for formally employed compared with 98.5% for non-formally employed women; AOR: 0.80; 95% CI: 0.10, 6.08). The primary reasons reported for early EBF cessation were returning to work (46.5%), introducing other foods based on the child's age (33.5%), or perceived milk insufficiency (13.7%). CONCLUSIONS: As more women engage in formal employment in low- and middle-income countries, additional supports to help prolong the period of EBF may be beneficial for formally employed mothers and their children.

Using chemical fractionation and speciation to describe uptake of technetium, iodine and selenium by Agrostis capillaris and Lolium perenne.

To understand the dynamic mechanisms governing soil-to-plant transfer of selenium (Se), technetium-99 (99Tc) and iodine (I), a pot experiment was undertaken using 30 contrasting soils after spiking with 77Se, 99Tc and 129I, and incubating for 2.5 years. Two grass species (Agrostis capillaris and Lolium perenne) were grown under controlled conditions for 4 months with 3 cuts at approximately monthly intervals. Native (soil-derived) 78Se and127I, as well as spiked 77Se, 99Tc and 129I, were assayed in soil and plants by ICP-MS. The grasses exhibited similar behaviour with respect to uptake of all three elements. The greatest uptake observed was for 99Tc, followed by 77Se, with least uptake of 129I, reflecting the transformations and interactions with soil of the three isotopes. Unlike soil-derived Se and I, the available pools of 77Se, 99Tc and 129I were substantially depleted by plant uptake across the three cuts with lower concentrations observed in plant tissues in each subsequent cut. Comparison between total plant offtake and various soil species suggested that 77SeO42-, 99TcO4- and 129IO3-, in soluble and adsorbed fractions were the most likely plant-available species. A greater ratio of 127I/129I in the soil solid phase compared to the solution phase confirmed incomplete mixing of spiked 129I with native 127I in the soil, despite the extended incubation period, leading to poor buffering of the spiked available pools. Compared to traditional expressions of soil-plant transfer factor (TFtotal), a transfer factor (TFavailable) expressed using volumetric concentrations of speciated 'available' fractions of each element showed little variation with soil properties.

Predicting Metabolic Syndrome With Machine Learning Models Using a Decision Tree Algorithm: Retrospective Cohort Study.

BACKGROUND: Metabolic syndrome is a cluster of disorders that significantly influence the development and deterioration of numerous diseases. FibroScan is an ultrasound device that was recently shown to predict metabolic syndrome with moderate accuracy. However, previous research regarding prediction of metabolic syndrome in subjects examined with FibroScan has been mainly based on conventional statistical models. Alternatively, machine learning, whereby a computer algorithm learns from prior experience, has better predictive performance over conventional statistical modeling. OBJECTIVE: We aimed to evaluate the accuracy of different decision tree machine learning algorithms to predict the state of metabolic syndrome in self-paid health examination subjects who were examined with FibroScan. METHODS: Multivariate logistic regression was conducted for every known risk factor of metabolic syndrome. Principal components analysis was used to visualize the distribution of metabolic syndrome patients. We further applied various statistical machine learning techniques to visualize and investigate the pattern and relationship between metabolic syndrome and several risk variables. RESULTS: Obesity, serum glutamic-oxalocetic transaminase, serum glutamic pyruvic transaminase, controlled attenuation parameter score, and glycated hemoglobin emerged as significant risk factors in multivariate logistic regression. The area under the receiver operating characteristic curve values for classification and regression trees and for the random forest were 0.831 and 0.904, respectively. CONCLUSIONS: Machine learning technology facilitates the identification of metabolic syndrome in self-paid health examination subjects with high accuracy.

Incidence of Atrioventricular Block After Valve Replacement in Carcinoid Heart Disease.

BACKGROUND: Carcinoid heart disease (CaHD) is a rare condition that has a high impact on the morbidity and mortality of its patients. Once heart failure symptoms develop in the patient with CaHD, cardiac valve surgery is often the only effective treatment. Although atrioventricular block (AVB) is a known postoperative complication of the valve surgery, the incidence of AVB in this population has not been well described. METHODS: Comprehensive records were collected retrospectively on consecutive patients with CaHD who underwent a valve surgery at a tertiary medical center from January 2001 to December 2015. We excluded patients with pre-existing permanent pacemaker (PPM). RESULTS: Nineteen consecutive patients were included in this study and 18 of them underwent at least dual valve (tricuspid and pulmonary valve) replacement surgery. Our 30-day post-surgical mortality was 0%. During the 6-month observation period following the surgery, 31.5% (n = 6) required PPM implantation due to complete AVB. There was no statistical difference in baseline characteristics and electrocardiographic and echocardiographic parameters between the patients who did or did not require PPM placement. CONCLUSIONS: Our study revealed that almost one-third of CaHD patients who underwent a valve replacement surgery developed AVB requiring PPM implantation. Due to high incidence of PPM requirement, we believe that prophylactic placement of an epicardial lead during the valve surgery can be helpful in these patients to reduce serious complication from placement of pacemaker lead on a later date through a prosthetic valve.

Reproductive system of Hutchinsoniella macracantha.

The cephalocarid crustacean Hutchinsoniella macracantha is a hermaphroditic species. Ova and sperm develop simultaneously. Ovaries and testes are separate, but the oviducts and vasa deferentia join and exit through a pair of common genital ducts.

Cost conscious care: preoperative evaluation by a cardiologist prior to low-risk procedures.

Background: Preoperative testing before low-risk procedures remains overutilised. Few studies have looked at factors leading to increased testing. We hypothesised that consultation to a cardiologist prior to a low-risk procedure leads to increased cardiac testing. Methods and results: 907 consecutive patients who underwent inpatient endoscopy/colonoscopy at a single academic centre were identified. Of those patients, 79 patients (8.7%) received preoperative consultation from a board certified cardiologist. 158 control patients who did not receive consultation from a cardiologist were matched by age and gender. Clinical and financial data were obtained from chart review and hospital billing. Logistic and linear regression models were constructed to compare the groups. Patients evaluated by a cardiologist were more likely to receive preoperative testing than patients who did not undergo evaluation with a cardiologist (OR 47.5, (95% CI 6.49 to 347.65). Specifically, patients seen by a cardiologist received more echocardiograms (60.8% vs 22.2%, p<0.0001) and 12-lead electrocardiograms (98.7% vs 54.4%, p<0.0001). There was a higher rate of ischaemic evaluations in the group evaluated by a cardiologist, but those differences did not achieve statistical significance. Testing led to longer length of stay (4.35 vs 3.46 days, p=0.0032) in the cohort evaluated by a cardiologist driven primarily by delay to procedure of 0.76 days (3.14 vs 2.38 days, p=0.001). Estimated costs resulting from the longer length of stay and increased testing was $10 624 per patient. There were zero major adverse cardiac events in either group. Conclusion: Preoperative consultation to a cardiologist before a low-risk procedure is associated with more preoperative testing. This preoperative testing increases length of stay and cost without affecting outcomes.

A 1 MA, variable risetime pulse generator for high energy density plasma research.

COBRA is a 0.5 Omega pulse generator driving loads of order 10 nH inductance to >1 MA current. The design is based on independently timed, laser-triggered switching of four water pulse-forming lines whose outputs are added in parallel to drive the load current pulse. The detailed design and operation of the switching to give a wide variety of current pulse shapes and rise times from 95 to 230 ns is described. The design and operation of a simple inductive load voltage monitor are described which allows good accounting of load impedance and energy dissipation. A method of eliminating gas bubbles on the underside of nearly horizontal insulator surfaces in water was required for reliable operation of COBRA; a novel and effective solution to this problem is described.

First Report of Colletotrichum gloeosporioides Causing 'Twister Disease' of Onion (Allium cepa) in Georgia.

In the fall of 2007, onion seedlings with twisted and distorted leaves were observed in seedbeds in multiple fields in the Vidalia onion region of Georgia. Tests for viruses and bacteria were negative and chemical injury was deemed improbable because of disease distribution in the fields. Upon further investigation, fungal fruiting bodies were observed on the outside sheath of a few of the seedlings. Symptomatic plants were cut into 1-cm segments and surface sterilized in 70% ethanol for 3 min. After rinsing in sterile water, the segments were placed onto potato dextrose agar amended with tetracycline. The fungus isolated from symptomatic plants fit the description of Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. Conidia were aseptate, cylindrical, and hyaline. Sequencing of the internal transcribed spacer region and a BLAST search in GenBank (99% sequence similarity to C. gloeosporioides accessions) confirmed the identification. Ten onion seedlings were spray inoculated with a suspension of 1 × 107 spores/ml until runoff, and four seedlings were inoculated with water as negative controls. Plants were bagged for 12 h to maintain high relative humidity. Five plants were placed in the greenhouse and five plants placed in a growth chamber at 22°C. All plants inoculated with C. gloeosporioides developed distorted and twisted leaves 3 weeks after inoculation in the growth chamber and 5 weeks after inoculation in the greenhouse. Night time temperatures in the greenhouse (15°C) were lower than those in the growth chamber (22°C). Seedlings inoculated with water showed no symptoms. The fungus was reisolated from symptomatic plants. C. gloeosporioides has been reported to cause a disease called twister on onion in tropical regions (1). The fall of 2007 was unusually warm with maximum temperatures reaching 26°C during the day. The pathogen is present on many crops in the United States, but to our knowledge, this is the first report of C. gloeosporioides causing twister disease of onion in the United States. In Nigeria and Brazil, yield losses as much as 100% were observed in fields with infected onions (1). The impact of infection on the growth of the transplants and subsequent yield in Vidalia onions is currently unknown. References: (1) J. P. Hill. Compendium of Onion and Garlic Diseases. 2nd ed. The American Phytopathological Society, St. Paul, MN, 2008.

Use of Fatty Acid Methyl Ester Profiles to Compare Copper-Tolerant and Copper-Sensitive Strains of Pantoea ananatis.

ABSTRACT A survey was conducted to evaluate differences in fatty acid methyl ester (FAME) profiles among strains of Pantoea ananatis, causal agent of center rot of onion (Allium cepa), isolated from 15 different onion cultivars in three different sites in Georgia. Differences in FAME composition were determined by plotting principal components (PCs) in two-dimensional plots. Euclidean distance squared (ED(2)) values indicated a high degree of similarity among strains. Plotting of PCs calculated from P. ananatis strains capable of growing on media amended with copper sulfate pentahydrate (200 mug/ml) indicated that copper-tolerant strains grouped into tight clusters separate from clusters formed by wild-type strains. However, unlike copper-sensitive strains, the copper-tolerant strains tended to cluster by location. A total of 80, 60, and 73% of the strains from Tift1, Tift2, and Tattnall, respectively, exhibited either confluent growth or partial growth on copper-amended medium. However, all strains were sensitive to a mixture of copper sulfate pentahydrate (200 mug/ml) and maneb (40 mug/ml). When copper-tolerant clones were analyzed and compared with their wild-type parents, in all cases the plotting of PCs developed from copper-tolerant clones formed tight clusters separate from clusters formed by the parents. Eigenvalues generated from these tests indicated that two components provided a good summary of the data, accounting for 98, 98, and 96% of the standardized variance for strains Pna 1-15B, Pna 1-12B, and Pna 2-5A, respectively. Furthermore, feature 4 (cis-9-hexadecenoic acid/2-hydroxy-13-methyltetradecanoic acid) and feature 7 (cis-9/trans-12/cis-7-octadecenoic acid) were the highest or second highest absolute values for PC1 in all three strains of the parents versus copper-tolerant clones, and hexadecanoic acid was the highest absolute value for PC2 in all three strains. Along with those fatty acids, dodecanoic acid and feature 3 (3-hydroxytetradecanoic acid/14-methylpentadecenoic acid) also had an impact on the differences observed between copper-sensitive parents and copper-resistant mutants. Finding these changes in bacterial fatty acid composition could lead to the development of a laboratory assay to identify copper-tolerant strains using gas chromatography as well as providing clues to further elucidate the mode of action of copper tolerance.

Echocardiography fails to detect left ventricular noncompaction in a cohort of patients with noncompaction on cardiac magnetic resonance imaging.

BACKGROUND: Left ventricular noncompaction (LVNC) is a rare disorder characterized by increased left ventricular trabeculation, deep intertrabecular recesses, and a thin compacted myocardial layer with associated clinical sequelae. Cardiac imaging with echocardiogram and cardiac magnetic resonance (CMRI) can detect variable myocardial morphology including excessive trabeculations. Multiple CMRI and echocardiographic criteria have been offered that attempt to identify LVNC morphology. The aim of this study was to assess the utility of echocardiogram in identifying LVNC in a cohort of patients with LVNC detected on CMRI. HYPOTHESIS: Echocardiography fails to identify LVNC morphology in a large proportion of patients with LVNC/hypertrabeculation detected on CMRI. METHODS: There were 1060 CMRI studies collected from 2009 to 2015 at 2 institutions. The patients included in this study (n = 37) met the criteria for LVNC on CMRI and had complete CMRI and echocardiogram images Clinical and imaging data were retrospectively reviewed. RESULTS: Of the 37 patients with LVNC on CMRI, only 10 patients (27%) had LVNC identified on echocardiogram (P < 0.0001, 95% confidence interval: 25.7%-66.2%). Echocardiography and CMRI were also significantly different in terms of identification of distribution of LVNC. Although 21 of 37 patients (57%) had evidence of LVNC in either the anterior or lateral walls on CMRI, there were 0 patients with LVNC detected in the anterior or lateral walls on echocardiogram (P = 0.019). CONCLUSIONS: Echocardiogram fails to detect LVNC morphology/hypertrabeculation in a significant number of a cohort of patients with LVNC on CMRI. LVNC may be missed if echocardiogram is the only imaging modality performed in a cardiac evaluation.

Gender-Specific Differences for Risk of Disability and Death in Atrial Fibrillation-Related Stroke.

In the latest American Heart Association/American College of Cardiology/Heart Rhythm Society atrial fibrillation (AF) guidelines, CHA2DS2-VASc replaced the CHADS2 stroke risk assessment to determine prophylactic anticoagulation, reflecting female gender's association with stroke incidence in AF. However, little investigation has been pursued of potential risk factors associated with worsened stroke severity. In this study, we examined patients with AF with ischemic stroke patient characteristics associated with increased stroke severity. Using the Get With The Guidelines-Stroke database, we retrospectively identified 221 consecutive patients with AF diagnosed with acute ischemic stroke and performed in depth chart review, evaluating demographics, labs, and co-morbidities. We analyzed the modified Rankin Scale (mRS) at discharge as a surrogate for stroke severity, defining severe stroke as fatal (mRS of 6) or disabling (mRS 4 to 5), requiring max assistance with ambulation or activities of daily living. Female gender, advanced age, and decreased body surface area were associated with disabling or fatal stroke (68.3% of patients with mRS 4 to 6 vs 50% with mRS 0 to 3, 78.4 vs 71.1 year, and 1.83 vs 1.92, respectively). Using a backward elimination approach revealed a logistic regression model with statistically significant odds ratios (ORs) for female gender (OR 1.99) and age (OR 1.04), and borderline significant for a history of coronary artery disease (OR 1.89). In conclusion, female gender is associated in the AF population with a twofold risk of severe disabling or fatal ischemic stroke, a finding that persists after controlling for potential confounders. This finding highlights the potential benefit from appropriate anticoagulation use for stroke prophylaxis in the AF population.

A novel meningococcal outer membrane vesicle vaccine with constitutive expression of FetA: A phase I clinical trial.

OBJECTIVES: Outer membrane vesicle (OMV) vaccines are used against outbreaks of capsular group B Neisseria meningitidis (MenB) caused by strains expressing particular PorA outer membrane proteins (OMPs). Ferric enterobactin receptor (FetA) is another variable OMP that induces type-specific bactericidal antibodies, and the combination of judiciously chosen PorA and FetA variants in vaccine formulations is a potential approach to broaden protection of such vaccines. METHODS: The OMV vaccine MenPF-1 was generated by genetically modifying N. meningitidis strain 44/76 to constitutively express FetA. Three doses of 25 µg or 50 µg of MenPF-1 were delivered intra-muscularly to 52 healthy adults. RESULTS: MenPF-1 was safe and well tolerated. Immunogenicity was measured by serum bactericidal assay (SBA) against wild-type and isogenic mutant strains. After 3 doses, the proportion of volunteers with SBA titres ≥1:4 (the putative protective titre) was 98% for the wild-type strain, and 77% for the strain 44/76 FetA(on)PorA(off) compared to 51% in the strain 44/76 FetA(off)PorA(off), demonstrating that vaccination with MenPF-1 simultaneously induced FetA and PorA bactericidal antibodies. CONCLUSION: This study provides a proof-of-concept for generating bactericidal antibodies against FetA after OMV vaccination in humans. Prevalence-based choice of PorA and FetA types can be used to formulate a vaccine for broad protection against MenB disease.

Hypothalamo-hypophyseal thyroid and gonadal function before and after erythropoietin therapy in dialysis patients.

We examined the effects of administration of two hypothalamic neurohormones, TRH and GnRH, for 3 days in five anemic male dialysis patients and five age-matched normal male volunteers. Patients on chronic hemodialysis have abnormal hypothalamo-hypophyseal thyroid and gonadal functions, including blunted TSH response to TRH, hyperprolactinemia, elevated basal levels of LH with exaggerated response to GnRH, and depressed FSH secretory response to GnRH. After correction of anemia with exogenous erythropoietin, these dialysis patients were given a single injection of the same hypothalamic hormones. The repeat studies after the correction of anemia showed normalization of 1) the TSH response to TRH, 2) basal GH and PRL levels, and 3) the FSH response to GnRH. Although these patients appear to have biochemical evidence of testicular failure, the gonadotropin response (FSH) to GnRH was not exaggerated. In addition, there was no increase in total T4 and free T4 after TRH administration. Although a free T3 response to TRH was present, it was remarkably blunted compared to that of controls. At the present time, it is not known whether these hormonal responses after the correction of anemia are due to better oxygenation or a trophic action of the erythropoietin.