First report of pothos latent virus infecting upland cotton (Gossypium hirsutum) in the United States.

Pothos latent virus (PoLV) is a virus with isometric virions and a positive-sense RNA genome, approximately 4.4 kb in size, currently classified in the genus Aureusvirus, family Tombusviridae (Martelli et al. 1998; Rubino et al. 1995). After its original discovery from hydroponic-grown pothos plants (Scindapsus aureus) in Italy (Sabanadzovic et al. 1995), additional PoLV isolates were reported from pigeonpea (Cajanus cajan) and lisianthus (Eustoma grandiflorum) in India and Taiwan, respectively (Chen et al. 2016; Kumar et al. 2001). PoLV has not been previously reported on the American continent. During 2019, we carried out a state-wide, RT-PCR-based survey for cotton leafroll dwarf virus (CLRDV), as previously described (Aboughanem-Sabanadzovic et al. 2019). Plants exhibiting symptoms reported associated with CLRDV (Avelar et al. 2019) were collected from cotton fields throughout Mississippi. Samples consisted of individually bagged, six inch-long, apical portions collected from five to twelve cotton plants per field. At the end of the season, the total RNAs extracted from a subset of CLRDV-infected samples using a Spectrum RNA extraction kit (Sigma, St Louis, MO), were randomly selected for additional characterization by Illumina 150 nt paired-end high-throughput sequencing at the UIUC Core Sequencing Facility (University of Illinois, Urbana, IL). De novo assembly of 46 to 60 million raw reads/sample was performed by metaSPAdes (Nurk et al. 2017). In addition to several CLRDV-specific contigs, analyses of 184,173 contigs assembled from a sample collected in Clay County (lab code CL-112) revealed a large contig # 63556 of 4298 nt in size with identities ranging from 90.5% to 94.3% with three PoLV genome sequences available in GenBank, suggesting that an isolate of this virus (PoLV-cot; GenBank OP584699) was coinfecting the sample along with CLRDV. Sequence analyses showed that contig #63556 represents approx. 97-98% of the entire PoLV-cot genome. To verify HTS data, specific primers (PoLV-F 5'ACATATATCAGAGAGAGCTCAGGTC3' and PoLV-R 5'GCTCCCATGACAGACCTCACT3') were designed on conserved sequences of all four PoLV genomes and used in a single-tube RT-PCR. The initial tests on RNAs from CL-112 and six other samples from the same field confirmed PoLV-cot infections in the original and an additional cotton plant. Sanger sequencing of the two 294 bp-long RT-PCR products revealed >99% nt mutual identity and 97.5-99% with PoLV isolates. However, none of the additional 226 cotton samples collected in 2019 across the state of Mississippi and 12 samples collected in the same field in 2020 tested positive for PoLV-cot. At this moment, it is not clear whether the PoLV infections originated from infected seeds or, more likely, from soil-borne inoculum. Indeed, several aureusviruses are known to be transmitted by soil either involving vectors belonging to the fungal genera Olpidium and/or Polymyxa (i.e., cucumber leaf spot virus, maize white line mosaic virus), or in a vectorless manner (Rochon et al. 2012). Previous studies on this virus demonstrated low-rate experimental transmission through the soil with no apparent involvement of specific vectors (Chen et al. 2016; Kumar et al. 2001; Sabanadzovic et al. 1995). In summary, results of our study indicate an original report of PoLV on the North American continent, along with description of a new host. Possible impact of PoLV-cot on the cotton industry, or any other susceptible crop in the US, is yet to be understood. Funding: This work has been partially supported by financial support from Cotton Inc, Cotton Foundation, USDA-ARS 58-6066-9-033 and 2020 MAFES-SRI grants. NAS and SS acknowledge partial support from the National Institute of Food and Agriculture, US Department of Agriculture, Hatch Projects Numbers 7001412 and1021494, respectively. The author(s) declare no conflict of interest. 1. Aboughanem-Sabanadzovic, N., et al. 2019. Plant Dis 103: 1798. 2. Avelar, S., et al. 2019. Plant Dis 103: 592. 3. Chen, Y-K., et al. 2016. J Phytopath 164: 650. 4. Kumar, P.L., et al. 2001. Plant Dis 85: 208. 5. Martelli, G.P., et al. 1998. Arch Virol 143: 1847. 6. Nurk, S., et al. 2017. Genome Res 27: 824. 7. Rochon, D., et al. 2012. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Amsterdam, NL, Elsevier Academic Press, pp 1111-1138. 8. Rubino, L., et al. 1995. J Gen Virol 76: 2835. 9. Sabanadzovic, S., et al.1995. Eur J Plant Pathol 101:171.

Molecular insight into cotton leaf curl geminivirus disease resistance in cultivated cotton (Gossypium hirsutum).

Cultivated cotton (Gossypium hirsutum) is the most important fibre crop in the world. Cotton leaf curl disease (CLCuD) is the major limiting factor and a threat to textile industry in India and Pakistan. All the local cotton cultivars exhibit moderate to no resistance against CLCuD. In this study, we evaluated an exotic cotton accession Mac7 as a resistance source to CLCuD by challenging it with viruliferous whiteflies and performing qPCR to evaluate the presence/absence and relative titre of CLCuD-associated geminiviruses/betasatellites. The results indicated that replication of pathogenicity determinant betasatellite is significantly attenuated in Mac7 and probably responsible for resistance phenotype. Afterwards, to decipher the genetic basis of CLCuD resistance in Mac7, we performed RNA sequencing on CLCuD-infested Mac7 and validated RNA-Seq data with qPCR on 24 independent genes. We performed co-expression network and pathway analysis for regulation of geminivirus/betasatellite-interacting genes. We identified nine novel modules with 52 hubs of highly connected genes in network topology within the co-expression network. Analysis of these hubs indicated the differential regulation of auxin stimulus and cellular localization pathways in response to CLCuD. We also analysed the differential regulation of geminivirus/betasatellite-interacting genes in Mac7. We further performed the functional validation of selected candidate genes via virus-induced gene silencing (VIGS). Finally, we evaluated the genomic context of resistance responsive genes and found that these genes are not specific to A or D sub-genomes of G. hirsutum. These results have important implications in understanding CLCuD resistance mechanism and developing a durable resistance in cultivated cotton.

Whole genome sequencing of Asia II 1 species of whitefly reveals that genes involved in virus transmission and insecticide resistance have genetic variances between Asia II 1 and MEAM1 species.

BACKGROUND: Whiteflies (Bemisia tabaci) are phloem sap-sucking pests that because of their broad host range and ability to transmit viruses damage crop plants worldwide. B. tabaci are now known to be a complex of cryptic species that differ from each other in many characteristics such as mode of interaction with viruses, invasiveness, and resistance to insecticides. Asia II 1 is an indigenous species found on the Indian sub-continent and south-east Asia while the species named as Middle East Asia Minor 1 (MEAM1), likely originated from the Middle-East and has spread worldwide in recent decades. The purpose of this study is to find genomic differences between these two species. RESULTS: Sequencing of the nuclear genome of Asia II 1 with Illumina HiSeq and MiSeq generated 198.90 million reads that covers 88% of the reference genome. The sequence comparison with MEAM1 identified 2,327,972 SNPs and 202,479 INDELs. In Total, 1294 genes were detected with high impact variants. The functional analysis revealed that some of the genes are involved in virus transmission including 4 genes in Tomato yellow leaf curl virus (TYLCV) transmission, 96 in Tomato crinivirus (ToCV) transmission, and 14 genes in insecticide resistance. CONCLUSIONS: These genetic differences between Asia II 1 and MEAM1 may underlie the major biological differences between the two species such as virus transmission, insecticide resistance, and range of host plants. The present study provides new genomic data and information resources for Asia II 1 that will not only contribute to the species delimitation of whitefly, but also help in conceiving future research studies to develop more targeted management strategies against whitefly.

Genes regulating gland development in the cotton plant.

In seeds and other parts of cultivated, tetraploid cotton (Gossypium hirsutum L.), multicellular groups of cells lysigenously form dark glands containing toxic terpenoids such as gossypol that defend the plant against pests and pathogens. Using RNA-seq analysis of embryos from near-isogenic glanded (Gl2 Gl2 Gl3 Gl3 ) versus glandless (gl2 gl2 gl3 gl3 ) plants, we identified 33 genes that expressed exclusively or at higher levels in embryos just prior to gland formation in glanded plants. Virus-induced gene silencing against three gene pairs led to significant reductions in the number of glands in the leaves, and significantly lower levels of gossypol and related terpenoids. These genes encode transcription factors and have been designated the 'Cotton Gland Formation' (CGF) genes. No sequence differences were found between glanded and glandless cotton for CGF1 and CGF2 gene pairs. The glandless cotton has a transposon insertion within the coding sequence of the GoPGF (synonym CGF3) gene of the A subgenome and extensive mutations in the promoter of D subgenome homeolog. Overexpression of GoPGF (synonym CGF3) led to a dramatic increase in gossypol and related terpenoids in cultured cells, whereas CRISPR/Cas9 knockout of GoPGF (synonym CGF3) genes resulted in glandless phenotype. Taken collectively, the results show that the GoPGF (synonym CGF3) gene plays a critical role in the formation of glands in the cotton plant. Seed-specific silencing of CGF genes, either individually or in combination, could eliminate glands, thus gossypol, from the cottonseed to render it safe as food or feed for monogastrics.

Diversity analysis of cotton (Gossypium hirsutum L.) germplasm using the CottonSNP63K Array.

BACKGROUND: Cotton germplasm resources contain beneficial alleles that can be exploited to develop germplasm adapted to emerging environmental and climate conditions. Accessions and lines have traditionally been characterized based on phenotypes, but phenotypic profiles are limited by the cost, time, and space required to make visual observations and measurements. With advances in molecular genetic methods, genotypic profiles are increasingly able to identify differences among accessions due to the larger number of genetic markers that can be measured. A combination of both methods would greatly enhance our ability to characterize germplasm resources. Recent efforts have culminated in the identification of sufficient SNP markers to establish high-throughput genotyping systems, such as the CottonSNP63K array, which enables a researcher to efficiently analyze large numbers of SNP markers and obtain highly repeatable results. In the current investigation, we have utilized the SNP array for analyzing genetic diversity primarily among cotton cultivars, making comparisons to SSR-based phylogenetic analyses, and identifying loci associated with seed nutritional traits. RESULTS: The SNP markers distinctly separated G. hirsutum from other Gossypium species and distinguished the wild from cultivated types of G. hirsutum. The markers also efficiently discerned differences among cultivars, which was the primary goal when designing the CottonSNP63K array. Population structure within the genus compared favorably with previous results obtained using SSR markers, and an association study identified loci linked to factors that affect cottonseed protein content. CONCLUSIONS: Our results provide a large genome-wide variation data set for primarily cultivated cotton. Thousands of SNPs in representative cotton genotypes provide an opportunity to finely discriminate among cultivated cotton from around the world. The SNPs will be relevant as dense markers of genome variation for association mapping approaches aimed at correlating molecular polymorphisms with variation in phenotypic traits, as well as for molecular breeding approaches in cotton.

Genome resources for three modern cotton lines guide future breeding efforts.

Cotton (Gossypium hirsutum L.) is the key renewable fibre crop worldwide, yet its yield and fibre quality show high variability due to genotype-specific traits and complex interactions among cultivars, management practices and environmental factors. Modern breeding practices may limit future yield gains due to a narrow founding gene pool. Precision breeding and biotechnological approaches offer potential solutions, contingent on accurate cultivar-specific data. Here we address this need by generating high-quality reference genomes for three modern cotton cultivars ('UGA230', 'UA48' and 'CSX8308') and updating the 'TM-1' cotton genetic standard reference. Despite hypothesized genetic uniformity, considerable sequence and structural variation was observed among the four genomes, which overlap with ancient and ongoing genomic introgressions from 'Pima' cotton, gene regulatory mechanisms and phenotypic trait divergence. Differentially expressed genes across fibre development correlate with fibre production, potentially contributing to the distinctive fibre quality traits observed in modern cotton cultivars. These genomes and comparative analyses provide a valuable foundation for future genetic endeavours to enhance global cotton yield and sustainability.

Discovery and Analyses of Caulimovirid-like Sequences in Upland Cotton (Gossypium hirsutum).

Analyses of Illumina-based high-throughput sequencing data generated during characterization of the cotton leafroll dwarf virus population in Mississippi (2020-2022) consistently yielded contigs varying in size (most frequently from 4 to 7 kb) with identical nucleotide content and sharing similarities with reverse transcriptases (RTases) encoded by extant plant pararetroviruses (family Caulimoviridiae). Initial data prompted an in-depth study involving molecular and bioinformatic approaches to characterize the nature and origins of these caulimovirid-like sequences. As a result, here, we report on endogenous viral elements (EVEs) related to extant members of the family Caulimoviridae, integrated into a genome of upland cotton (Gossypium hirsutum), for which we propose the provisional name "endogenous cotton pararetroviral elements" (eCPRVE). Our investigations pinpointed a ~15 kbp-long locus on the A04 chromosome consisting of head-to-head orientated tandem copies located on positive- and negative-sense DNA strands (eCPRVE+ and eCPRVE-). Sequences of the eCPRVE+ comprised nearly complete and slightly decayed genome information, including ORFs coding for the viral movement protein (MP), coat protein (CP), RTase, and transactivator/viroplasm protein (TA). Phylogenetic analyses of major viral proteins suggest that the eCPRVE+ may have been initially derived from a genome of a cognate virus belonging to a putative new genus within the family. Unexpectedly, an identical 15 kb-long locus composed of two eCPRVE copies was also detected in a newly recognized species G. ekmanianum, shedding some light on the relatively recent evolution within the cotton family.

Whole-Genome Resequencing Deciphers New Insight Into Genetic Diversity and Signatures of Resistance in Cultivated Cotton Gossypium hirsutum.

Cotton is an important crop that produces fiber and cottonseed oil for the textile and oil industry. However, cotton leaf curl virus disease (CLCuD) stress is limiting its yield in several Asian countries. In this study, we have sequenced Mac7 accession, a Gossypium hirsutum resistance source against several biotic stresses. By aligning with the Gossypium hirsutum (AD1) 'TM-1' genome, a total of 4.7 and 1.2 million SNPs and InDels were identified in the Mac7 genome. The gene ontology and metabolic pathway enrichment indicated SNPs and InDels role in nucleotide bindings, secondary metabolite synthesis, and plant-pathogen interaction pathways. Furthermore, the RNA-seq data in different tissues and qPCR expression profiling under CLCuD provided individual gene roles in resistant and susceptible accessions. Interestingly, the differential NLR genes demonstrated higher expression in resistant plants rather than in susceptible plants expression. The current resequencing results may provide primary data to identify DNA resistance markers which will be helpful in marker-assisted breeding for development of Mac7-derived resistance lines.

Detecting Cotton Leaf Curl Virus Resistance Quantitative Trait Loci in Gossypium hirsutum and iCottonQTL a New R/Shiny App to Streamline Genetic Mapping.

Cotton leaf curl virus (CLCuV) causes devastating losses to fiber production in Central Asia. Viral spread across Asia in the last decade is causing concern that the virus will spread further before resistant varieties can be bred. Current development depends on screening each generation under disease pressure in a country where the disease is endemic. We utilized quantitative trait loci (QTL) mapping in four crosses with different sources of resistance to identify single nucleotide polymorphism (SNP) markers associated with the resistance trait to allow development of varieties without the need for field screening every generation. To assist in the analysis of multiple populations, a new publicly available R/Shiny App was developed to streamline genetic mapping using SNP arrays and to also provide an easy method to convert and deposit genetic data into the CottonGen database. Results identified several QTL from each cross, indicating possible multiple modes of resistance. Multiple sources of resistance would provide several genetic routes to combat the virus as it evolves over time. Kompetitive allele specific PCR (KASP) markers were developed and validated for a subset of QTL, which can be used in further development of CLCuV-resistant cotton lines.

Leveraging National Germplasm Collections to Determine Significantly Associated Categorical Traits in Crops: Upland and Pima Cotton as a Case Study.

Observable qualitative traits are relatively stable across environments and are commonly used to evaluate crop genetic diversity. Recently, molecular markers have largely superseded describing phenotypes in diversity surveys. However, qualitative descriptors are useful in cataloging germplasm collections and for describing new germplasm in patents, publications, and/or the Plant Variety Protection (PVP) system. This research focused on the comparative analysis of standardized cotton traits as represented within the National Cotton Germplasm Collection (NCGC). The cotton traits are named by 'descriptors' that have non-numerical sub-categories (descriptor states) reflecting the details of how each trait manifests or is absent in the plant. We statistically assessed selected accessions from three major groups of Gossypium as defined by the NCGC curator: (1) "Stoneville accessions (SA)," containing mainly Upland cotton (Gossypium hirsutum) cultivars; (2) "Texas accessions (TEX)," containing mainly G. hirsutum landraces; and (3) Gossypium barbadense (Gb), containing cultivars or landraces of Pima cotton (Gossypium barbadense). For 33 cotton descriptors we: (a) revealed distributions of character states for each descriptor within each group; (b) analyzed bivariate associations between paired descriptors; and (c) clustered accessions based on their descriptors. The fewest significant associations between descriptors occurred in the SA dataset, likely reflecting extensive breeding for cultivar development. In contrast, the TEX and Gb datasets showed a higher number of significant associations between descriptors, likely correlating with less impact from breeding efforts. Three significant bivariate associations were identified for all three groups, bract nectaries:boll nectaries, leaf hair:stem hair, and lint color:seed fuzz color. Unsupervised clustering analysis recapitulated the species labels for about 97% of the accessions. Unexpected clustering results indicated accessions that may benefit from potential further investigation. In the future, the significant associations between standardized descriptors can be used by curators to determine whether new exotic/unusual accessions most closely resemble Upland or Pima cotton. In addition, the study shows how existing descriptors for large germplasm datasets can be useful to inform downstream goals in breeding and research, such as identifying rare individuals with specific trait combinations and targeting breakdown of remaining trait associations through breeding, thus demonstrating the utility of the analytical methods employed in categorizing germplasm diversity within the collection.

Analysis of a tetraploid cotton line Mac7 transcriptome reveals mechanisms underlying resistance against the whitefly Bemisia tabaci.

Whitefly inflicts both direct and indirect losses to cotton crop. Whitefly resistant cotton germplasm is a high priority and considered among the best possible solutions to mitigate this issue. In this study, we evaluated cotton leaf curl disease (CLCuD) resistant cotton line Mac7 under whitefly stress. Furthermore, we utilized the already available transcriptome data of Mac7 concerning whitefly stress to elucidate associated mechanisms and identify functionally important genes in cotton. In transcriptomic data analysis, differentially expressed genes (DEGs) were found involved in complex relay pathways, activated on whitefly exposure. The response implicates signalling through resistance genes (R-genes), MAPK, ROS, VQs or RLKs, transcription factors, which leads to the activation of defence responses including, Ca2+messengers, phytohormonal cross-talk, gossypol, flavonoids, PhasiRNA and susceptibility genes (S-genes). The qRT-PCR assay of 10 functionally important genes also showed their involvement in differential responses at 24 and 48 h post whitefly infestation. Briefly, our study helps in understanding the resistant nature of Mac7 under whitefly stress.

Effects of Interspecific Chromosome Substitution in Upland Cotton on Cottonseed Macronutrients.

Nutrients, including macronutrients such as Ca, P, K, and Mg, are essential for crop production and seed quality, and for human and animal nutrition and health. Macronutrient deficiencies in soil lead to poor crop nutritional qualities and a low level of macronutrients in cottonseed meal-based products, leading to malnutrition. Therefore, the discovery of novel germplasm with a high level of macronutrients or significant variability in the macronutrient content of crop seeds is critical. To our knowledge, there is no information available on the effects of chromosome or chromosome arm substitution on cottonseed macronutrient content. The objective of this study was to evaluate the effects of chromosome or chromosome arm substitution on the variability and content of the cottonseed macronutrients Ca, K, Mg, N, P, and S in chromosome substitution lines (CS). Nine chromosome substitution lines were grown in two-field experiments at two locations in 2013 in South Carolina, USA, and in 2014 in Mississippi, USA. The controls used were TM-1, the recurrent parent of the CS line, and the cultivar AM UA48. The results showed major variability in macronutrients among CS lines and between CS lines and controls. For example, in South Carolina, the mean values showed that five CS lines (CS-T02, CS-T04, CS-T08sh, CS-B02, and CS-B04) had higher Ca level in seed than controls. Ca levels in these CS lines varied from 1.88 to 2.63 g kg-1 compared with 1.81 and 1.72 g kg-1 for TM-1 and AMUA48, respectively, with CS-T04 having the highest Ca concentration. CS-M08sh exhibited the highest K concentration (14.50 g kg-1), an increase of 29% and 49% over TM-1 and AM UA48, respectively. Other CS lines had higher Mg, P, and S than the controls. A similar trend was found at the MS location. This research demonstrated that chromosome substitution resulted in higher seed macronutrients in some CS lines, and these CS lines with a higher content of macronutrients can be used as a genetic tool towards the identification of desired seed nutrition traits. Also, the CS lines with higher desired macronutrients can be used as parents to breed for improved nutritional quality in Upland cotton, Gossypium hirsutum L., through improvement by the interspecific introgression of desired seed nutrient traits such as Ca, K, P, S, and N. The positive and significant (p ≤ 0.0001) correlation of P with Ca, P with Mg, S with P, and S with N will aid in understanding the relationships between nutrients to improve the fertilizer management program and maintain higher cottonseed nutrient content.

Isolation and characterization of a cotton cdh-like gene.

Cotton fiber cells elongate without dividing to form economically valuable spinnable fiber. Reports of the ploidy level of fiber cells are variable. Early reports indicated an increase in nuclear DNA content in young fibers; however, subsequent reports failed to observe such a significant increase in ploidy level. Evaluation and analysis of genes involved in regulation of DNA synthesis and other aspects of cell cycle regulation identified relevant genes that were present in fiber cells though usually at low levels. We report the isolation and characterization of another gene likely to be involved in cell cycle/DNA synthesis control. This gene was similar to a gene from Medicago species that controls entry into anaphase by regulating the activity of the anaphase promoting complex ability to ubiquinate selected proteins. The cotton gene was composed of nine exons and the deduced translational sequences have motifs similar to a Medicago gene expressed in highly polyploid cells. Based on this similarity the cotton gene was designated Ghcdh. Ghcdh is highly expressed in meristems and leaves but is present at much lower levels in fiber cells. These data are consistent with the lower levels of polyploidy reported for cotton fiber. A simple sequence repeat was identified in the gene that may be exploited as a marker to map this gene and associate it with important traits in cotton.

Characterization of two cotton (Gossypium hirsutum L) invertase genes.

Two cotton vacuolar-invertase genes were identified and sequenced. Both genes had seven exons, including an unusually small second exon typical of acid invertases. These genes encode peptides with many features shared by acid invertases from other species including, leader sequences that probably target the peptide to the vacuole, active site motifs and substrate binding motifs. Expression analyses indicated that one of the genes was expressed in roots during the starch filling stage of development. However, expression of the same gene fluctuated during the starch utilization stage of development. Therefore this gene was unlikely to play a role in determining sink strength of this tissue. Both genes were expressed in elongating fibers where they were likely to play a role in cell expansion. The invertase gene uniquely expressed in fiber had a simple sequence repeat (SSR) in the third intron that was polymorphic among various cotton species. An EST was identified with an expansion of the SSR that included the third intron indicating this SSR is associated with a splice variant. The polymorphic SSR may be useful in investigating the function of this gene in fiber development.

Effects of Interspecific Chromosome Substitution in Upland Cotton on Cottonseed Micronutrients.

Micronutrients are essential for plant growth and development, and important for human health nutrition and livestock feed. Therefore, the discovery of novel germplasm with significant variability or higher micronutrients content in crop seeds is critical. Currently, there is no information available on the effects of chromosome or chromosome arm substitution in cotton on cottonseed micronutrients. Thus, the objective of this study was to evaluate the effects of chromosome or chromosome arm substitution on the variability and levels of micronutrients B, Fe, Cu, Zn, Mn, and Ni in cottonseed from chromosome substitution (CS) cotton lines. Our hypothesis was that interspecific chromosome substitution in cotton can affect cottonseed micronutrients content, resulting in significant differences and variabilities of these nutrients among CS lines and between CS lines and the controls. Nine CS lines were grown in two-field experiments at two locations (in 2013 in South Carolina, USA; and in 2014 in Mississippi, USA). TM-1 (the recurrent parent of the CS line) and AM UA48 (cultivar) were used as control. The results showed significant variability among CS lines compared to the controls AM UA48 and TM-1. For example, in South Carolina (SC), B concentration in cottonseed ranged from 10.35 mg kg-1 in CS-M02 to 13.67 mg kg-1 in CS-T04. The concentration of Cu ranged from 4.81 mg kg-1 in CS-B08sh to 7.65 mg kg-1 in CS-T02, and CS-T02 was higher than both controls. The concentration of Fe ranged from 36.09 mg kg-1 to 56.69 mg kg-1 (an increase up to 57%), and six CS lines (CS-B02, CS-B08sh, CS-M02, CS-M04, CS-T02, and CS-T04) had higher concentration than both controls in 2013. In 2014 at the Mississippi location (MS), similar observation was found with CS lines for micronutrients content. The CS lines with higher concentrations of these micronutrients can be used as a genetic tool toward QTL identification for desired seed traits because these lines are genetically similar with TM-1, except the substituted chromosome or chromosome segment pairs from the alien species. Chromosome substitution provides an effective means for upland cotton improvement by targeted interspecific introgression, yielding CS lines that facilitate trait discovery, such as seed micronutritional qualities, due to increased isogenicity and markedly reduced complexity from epistatic interactions with non-target alien chromosomes. The positive correlation between B, Cu, and Fe at both locations, between Ni and Mn, between Zn and Cu, and between Zn and Ni at both locations signify the importance of a good agricultural and fertilizer management of these nutrients to maintain higher cottonseed nutrient content.

Expression of genes associated with carbohydrate metabolism in cotton stems and roots.

BACKGROUND: Cotton (Gossypium hirsutum L) is an important crop worldwide that provides fiber for the textile industry. Cotton is a perennial plant that stores starch in stems and roots to provide carbohydrates for growth in subsequent seasons. Domesticated cotton makes these reserves available to developing seeds which impacts seed yield. The goals of these analyses were to identify genes and physiological pathways that establish cotton stems and roots as physiological sinks and investigate the role these pathways play in cotton development during seed set. RESULTS: Analysis of field-grown cotton plants indicated that starch levels peaked about the time of first anthesis and then declined similar to reports in greenhouse-grown cotton plants. Starch accumulated along the length of the stem and the shape and size of the starch grains from stems were easily distinguished from transient starch. Microarray analyses compared gene expression in tissues containing low levels of starch with tissues rapidly accumulating starch. Statistical analysis of differentially expressed genes indicated increased expression among genes associated with starch synthesis, starch degradation, hexose metabolism, raffinose synthesis and trehalose synthesis. The anticipated changes in these sugars were largely confirmed by measuring soluble sugars in selected tissues. CONCLUSION: In domesticated cotton starch stored prior to flowering was available to support seed production. Starch accumulation observed in young field-grown plants was not observed in greenhouse grown plants. A suite of genes associated with starch biosynthesis was identified. The pathway for starch utilization after flowering was associated with an increase in expression of a glucan water dikinase gene as has been implicated in utilization of transient starch. Changes in raffinose levels and levels of expression of genes controlling trehalose and raffinose biosynthesis were also observed in vegetative cotton tissues as plants age.

Identification and genomic location of a reniform nematode (Rotylenchulus reniformis) resistance locus (Ren ari) introgressed from Gossypium aridum into upland cotton (G. hirsutum).

In this association mapping study, a tri-species hybrid, [Gossypium arboreum x (G. hirsutum x G. aridum)(2)], was crossed with MD51ne (G. hirsutum) and progeny from the cross were used to identify and map SSR markers associated with reniform nematode (Rotylenchulus reniformis) resistance. Seventy-six progeny (the 50 most resistant and 26 most susceptible) plants were genotyped with 104 markers. Twenty-five markers were associated with a resistance locus that we designated Ren(ari) and two markers, BNL3279_132 and BNL2662_090, mapped within 1 cM of Ren(ari). Because the SSR fragments associated with resistance were found in G. aridum and the bridging line G 371, G. aridum is the likely source of this resistance. The resistance is simply inherited, possibly controlled by a single dominant gene. The markers identified in this project are a valuable resource to breeders and geneticists in the quest to produce cotton cultivars with a high level of resistance to reniform nematode.

Microsatellites reveal genetic diversity in Rotylenchulus reniformis populations.

Rotylenchulus reniformis is the predominant parasitic nematode of cotton in the Mid South area of the United States. Although variable levels of infection and morphological differences have been reported for this nematode, genetic variability has been more elusive. We developed microsatellite-enriched libraries for R. reniformis, produced 1152 clones, assembled 694 contigs, detected 783 simple sequence repeats (SSR) and designed 192 SSR-markers. The markers were tested on six R. reniformis cultures from four states, Texas, Louisiana, Mississippi and Georgia, in the USA. Based on performance we selected 156 SSR markers for R. reniformis from which 88 were polymorphic across the six reniform nematode populations, showing as the most frequent motif the dinucleotide AG. The polymorphic information content of the markers ranged from 0.00 to 0.82, and the percentage of multiallelic loci of the isolates was between 40.9 and 45.1%. An interesting finding in this study was the genetic variability detected among the three Mississippi isolates, for which 22 SSR markers were polymorphic. We also tested the level of infection of these isolates on six cotton genotypes, where significant differences were found between the Texas and Georgia isolates. Coincidentally, 62 polymorphic markers were able to distinguish these two populations. Further studies will be necessary to establish possible connections, if any, between markers and level of pathogenicity of the nematode. The SSR markers developed here will be useful in the assessment of the genetic diversity of this nematode, could assist in management practices for control of reniform nematode, be used in breeding programs for crop resistance, and help in detecting the origin and spread of this nematode in the United States.

Chemical defense responses of upland cotton, Gossypium hirsutum L. to physical wounding.

Upland cotton (Gossypium hirsutum L.) produces terpenoid aldehydes (TAs) that protect the plant from microbial and insect infestations. Foliar TAs include plus (+)- and minus (-)-gossypol, hemigossypolone, and heliocides. To examine foliar TAs' response to physical wounding, the four TA derivatives of a fully glanded G. hirsutum variety JACO GL were quantified by ultra-high performance liquid chromatography. The results show that foliar heliocides increased by 1.7-fold in younger leaves after wounding. While the hemigossypolone level was not affected by the physical wounding, the level of heliocides was significantly increased up to 1.8-fold in the younger leaves. Upland cotton accumulates concentrated carbohydrates, amino acids, and fatty acids in foliar extrafloral nectar (EFN) to serve as a nutrient resource, which attracts both beneficial insects and damaging pests. To better understand the nectar physiology, particularly to determine the temporal dynamics of EFN metabolites in response to the wounding, a gas chromatograph-mass spectrometer (GC-MS) was used to perform metabolic profiling analyses of a G. hirsutum variety Deltapine 383 that has fully developed extrafloral nectaries. A total of 301 compounds were monitored, specifically 75 primary metabolites, two secondary metabolites and 224 unidentified compounds. The physical wounding treatment changed the EFN composition and lowered overall production. The accumulation of 30 metabolites was altered in response to the wounding treatment and threonic acid levels increased consistently. GC-MS combined with Kovat's analysis enabled identification of EFN secondary metabolites including furfuryl alcohol and 5-hyrdomethoxyfurfural, which both have antioxidant and antimicrobial properties that may protect the nectar against microbial pathogens. This study provides new insights into the wounding response of cotton plants in terms of cotton metabolites found in leaf glands and extrafloral nectar as well as highlighting some protective functions of secondary metabolites produced in foliar glands and extrafloral nectaries.

Non-cultivated Cotton Species (Gossypium spp.) Act as a Reservoir for Cotton Leaf Curl Begomoviruses and Associated Satellites.

A collection of cultivated and non-cultivated species of cotton (Gossypium spp.) has been maintained for the last four decades in Multan, Pakistan. This geographical location has been observed as a hotspot for the evolution of begomoviruses and satellites associated with cotton leaf curl disease (CLCuD). Recent studies showed that begomoviruses responsible for the CLCuD epidemic in the 1990s, and that almost disappeared from the CLCuD complex in 2000s, have been observed again in CLCuD-infected cotton fields. To identify host species that acted as probable reservoirs for these viruses, we characterized begomoviruses and satellites in non-cultivated cotton species G. raimondii, G. thurberi and G. mustelinum and identified several species of CLCuD associated begomoviruses and satellites. Further, phylogenetic analysis indicated that the identified begomoviruses and beta/alphasatellites are closely related to the ones associated with the most recent CLCuD complex. qPCR indicated that the comparative level of virus significantly decreased in the presence of alphasatellites. Our results indicated that non-cultivated cotton species have been continuously challenged by diverse begomoviruses and associated satellites and act as reservoirs for CLCuD associated begomoviruses. These results provide novel insights into understanding the spread of begomoviruses and associated satellites in New World cotton species introduced into the Old World.