PHOTOBIOMODULATION THERAPY FOR LARGE SOFT DRUSEN AND DRUSENOID PIGMENT EPITHELIAL DETACHMENT IN AGE-RELATED MACULAR DEGENERATION: A Single-Center Prospective Pilot Study.

PURPOSE: To evaluate visual acuity and morphologic changes after photobiomodulation (PBM) for patients affected with large soft drusen and/or drusenoid pigment epithelial detachment associated with dry age-related macular degeneration. METHOD: Twenty eyes with large soft drusen and/or drusenoid pigment epithelial detachment age-related macular degeneration were included and treated using the LumiThera Valeda Light Delivery System. All patients underwent two treatments per week for 5 weeks. Outcome measures included best-corrected visual acuity, microperimetry-scotopic testing, drusen volume, central drusen thickness, and quality of life score at baseline and month 6 (M6) follow-up. Data of best-corrected visual acuity, drusen volume, and central drusen thickness were also recorded at week 5 (W5). RESULTS: Best-corrected visual acuity significantly improved at M6 with a mean score gain of 5.5 letters ( P = 0.007). Retinal sensitivity decreased by 0.1 dB ( P = 0.17). The mean fixation stability increased by 0.45% ( P = 0.72). Drusen volume decreased by 0.11 mm 3 ( P = 0.03). Central drusen thickness was reduced by a mean of 17.05 µ m ( P = 0.01). Geographic atrophy area increased by 0.06 mm 2 ( P = 0.01) over a 6-month follow-up, and quality of life score increased by 3,07 points on average ( P = 0.05). One patient presented a drusenoid pigment epithelial detachment rupture at M6 after PBM treatment. CONCLUSION: The visual and anatomical improvements in our patients support previous reports on PBM. PBM may provide a valid therapeutic option for large soft drusen and drusenoid pigment epithelial detachment age-related macular degeneration and may potentially slow the natural course of the disease.

SUBRETINAL TRANSIENT HYPOREFLECTIVITY IN AGE-RELATED MACULAR DEGENERATION: A Spectral Domain Optical Coherence Tomography Study.

PURPOSE: To describe and assess the prognostic significance of subretinal transient hyporeflectivity (STHR) on a novel spectral domain optical coherence tomography (SD-OCT) in age-related macular degeneration. METHODS: Consecutive patients with age-related macular degeneration (AMD) presenting STHR, defined as a small, well-defined, round subretinal, hyporeflective lesion, on SD-OCT and without exudative signs were included. Clinical examination and SD-OCT (SPECTRALIS, Heidelberg Engineering, Heidelberg, Germany) were analyzed at inclusion, 1 month before inclusion, and until the onset of exudative signs during the 12-month follow-up. RESULTS: Thirty-five STHR in 21 eyes of 20 patients were included. Among the 21 eyes, 2 eyes had early AMD, 1 eye had nonexudative asymptomatic macular neovascularization, and 18 eyes presented late AMD: 17 eyes neovascular AMD and 1 eye geographic atrophy. During the 2-month follow-up, 97.1% (34/35) of STHR disappeared. During the 12-month follow-up, 57.1% of eyes (12/21) developed exudative signs on 1 eye with early AMD and 11 eyes with neovascular AMD. CONCLUSION: Subretinal transient hyporeflectivity is a novel SD-OCT sign in patients with AMD. The eyes with isolated STHR should be closely monitored on a monthly basis to detect further exudation.

Undetectable Macular Neovascularization on OCT Angiography in Age Related Macular Degeneration: Comparison between Different Devices.

Background and Objectives: The aim of this study was to report the characteristics of macular neovascularization (MNV) with undetectable flow on optical coherence tomography angiography (OCTA) in neovascular age related macular degeneration (nAMD), and compare them with the characteristics of detectable MNV. Materials and Methods: Patients with a diagnosis of nAMD who underwent dye imaging and OCTA in the same day were included and divided into two groups: undetectable and detectable flow on OCTA. Three OCTA devices were used, two with spectral-domain technology (AngioVue, RTVue 100xAvanti, Optovue, Freemont, CA, USA and Heidelberg OCT2 Beta Angiography Module, Heidelberg Engineering, Germany) and one swept-source OCTA (PlexElite 9000; Carl Zeiss Meditec, Inc., Dublin, CA, USA). We studied the demographics, neovascularization characteristics, and OCTA device and acquisition characteristics for both groups. Results: A global comparison between Group 1 and Group 2 was made, followed by an analysis of variables associated with (un)detectability for each OCTA device. A total of 108 eyes were included: 90 in the detectable group (Group 1) and 18 in the undetectable group (Group 2), corresponding to a global sensitivity of OCTA for the detection of MNV of 83.49%. There was a statistically significant difference between the two groups regarding MNV type (p = 0.02) and PED height (p = 0.017). For the three devices, detection sensitivity with automatic segmentation was significantly lower than with manual segmentation. For Heidelberg, PED Height and scan quality explained 68.3% of the undetectability. For AngioVue, PED Height and absence of hemorrhage explained 67.9% of undetectability. Conclusions: In this study, we found a global sensitivity of 83.49% for the three OCTA devices combined, with a range from 55.5% to 96.26% depending on the segmentation and OCTA device. This means that undetectable/undetected MNV can represent up to 45% of the examinations, eventually misdiagnosing choroidal neovascularization for 1 out every 2 patients.

Evaluation of Carboxymethylcellulose Sodium plus Glycerin (Optive®) in Ocular Discomfort after Anti-Vascular Endothelial Growth Factor Intravitreal Injection Therapy: A Prospective Study.

OBJECTIVE: The aim of this study was to evaluate the efficacy of a mix of carboxymethylcellulose and glycerin (Optive®) after intravitreal injection therapy (IVT) with anti-vascular endothelial growth factor for reducing ocular discomfort in patients. METHODS: We prospectively included patients who were naïve to any IVT. No artificial tear treatment was prescribed after the first IVT. After the second IVT, all patients instilled 3 drops per day of Optive® for 3 days. Every patient answered a questionnaire concerning the ocular discomfort at 72 h after both IVTs and a questionnaire about tolerance to treatment after the second IVT. RESULTS: We included 45 patients (mean age 72.3 years [range 23-94], 25 females); 14 (34.1%) reported a feeling of grittiness after the first IVT but not after the second (p = 0.01); 12 (29.3%) complained of global discomfort after the first IVT but not after the second (p = 0.14); and 11 (26.8%) reported a watery eye after the first IVT but not after the second (p = 0.21); 37/45 (82%) patients felt ocular discomfort after IVT. CONCLUSION: Most patients felt ocular discomfort after IVT. Instillation of Optive® significantly alleviated the feeling of grittiness for more than half of the patients.

CHOROIDAL NEOVASCULAR AREA AND VESSEL DENSITY COMPARISON BETWEEN TWO SWEPT-SOURCE OPTICAL COHERENCE TOMOGRAPHY ANGIOGRAPHY DEVICES.

PURPOSE: To compare choroidal neovascularization (CNV) area and vessel density (VD) measurements between two different swept-source optical coherence tomography angiography (SS-OCTA) devices. METHODS: En face optical coherence tomography angiography (OCTA) images of patients affected by neovascular age-related macular degeneration were collected prospectively from two devices: Zeiss PLEX Elite 9000 (Carl Zeiss Meditec, Dublin, CA) and Topcon DRI OCT Triton SS-OCTA (Topcon, Tokyo, Japan). Choroidal neovascularization area and VD of images were measured and analyzed with ImageJ software by two readers to evaluate the agreement between two devices, with respect to different image size (3 × 3 and 6 × 6 mm) and different image segmentation (automatic vs. manual), and a Topcon equivalent Zeiss segmentation as control (i.e., the equivalent anatomical slab given by Topcon device on the Zeiss device). RESULTS: A total of 30 eyes (30 patients) were analyzed. There was an excellent agreement between the two readers in CNV area measurements intraclass correlation coefficient >0.9 in all analyses. We found excellent agreement in CNV area measurements (manual and automatic segmentations) when comparing 3 × 3-mm or 6 × 6-mm images both for each single device and between the two devices (overall intraclass correlation coefficient > 0.9). Vessel density measurements between manual to automatic segmentation within the same device and same image size had a high intraclass correlation coefficient value, but there was a poor agreement in VD between different image sizes (3 × 3 mm vs. 6 × 6 mm) in the same device and also comparing the two devices (3 × 3 Topcon vs. 3 × 3 Zeiss; 6 × 6 Topcon vs. 6 × 6 Zeiss). There was a poor agreement between the Topcon equivalent Zeiss segmentation and all other segmentations. CONCLUSION: There was an excellent agreement in CNV area measurements for both swept-source optical coherence tomography angiography devices in automatic and manual segmentations. However, the Topcon equivalent Zeiss segmentation was not comparable with any of the preset segmentations of Topcon and Zeiss devices. There was a poor agreement in CNV VD between different image size and different devices. For these reasons, it seems that, for accurate longitudinal analysis of VD, it is better to use the same device for each individual, even if both devices can be used interchangeably for CNV area measurements using automatic or manual segmentations.

REAL-COLOR VERSUS PSEUDO-COLOR IMAGING OF FIBROTIC SCARS IN EXUDATIVE AGE-RELATED MACULAR DEGENERATION.

PURPOSE: To compare the morphological characteristics of subretinal fibrosis in late age-related macular degeneration using multicolor (MC) imaging, color fundus photography (CFP), and ultra-widefield CFP (UWFCFP). METHODS: Thirty-two eyes of 31 patients diagnosed with subretinal fibrosis complicating exudative age-related macular degeneration were included. Included eyes were imaged by MC, CFP, and UWFCFP. The overall ability to visualize fibrosis, its margins, and dissimilarity with surrounding atrophy was graded using a score (0: not visible, 1: barely visible, 2: mostly visible, and 3: fully visible) by two readers. Area of fibrosis was calculated. Scaling, lesion colocalization on all three imaging techniques, and area measurements were performed using ImageJ. RESULTS: Ninety-six images of 32 eyes were graded. The average area of fibrosis was 14.59 ± 8.94 mm for MC, 13.84 ± 8.56 mm for CFP, and 13.76 ± 8.79 mm for UWFCFP. Fibrosis was fully visible in 87.5% of cases using MC and 50% using CFP and UWFCFP. Fibrosis' margins were sharply defined in 40.6% of eyes with MC, 15.6% and 9.4% with CFP and UWFCFP, respectively. Multicolor imaging provided superior distinction between fibrosis and atrophy (100% for MC vs. 13.4% for CFP and 33.3% for UWFCFP). The inter- and intra-reader agreement was high for all measurements (P < 0.0001). CONCLUSION: Multicolor technology allows for improved visualization and analysis of subretinal fibrosis when compared with CFP and UWFCFP, especially when surrounding atrophy is present.

VASCULAR REMODELING OF CHOROIDAL NEOVASCULARIZATION AFTER ANTI-VASCULAR ENDOTHELIAL GROWTH FACTOR THERAPY VISUALIZED ON OPTICAL COHERENCE TOMOGRAPHY ANGIOGRAPHY.

PURPOSE: To describe the qualitative and quantitative changes in choroidal neovascularization (CNV) flow pattern after anti-vascular endothelial growth factor therapy, by optical coherence tomography angiography (OCTA). METHODS: Consecutive patients with neovascular age-related macular degeneration underwent multimodal imaging, including OCTA at initial examination and at last visit. High-flow networks in the choriocapillaris segmentation of OCTA were qualitatively and quantitatively analyzed at baseline and at follow-up, to characterize vascular flow changes after anti-vascular endothelial growth factor treatment and to correlate these changes with final exudation signs on spectral domain optical coherence tomography. RESULTS: Seventeen eyes were included. Mean follow-up was of 11.7 ± 3.3 months. Baseline images showed six medusa pattern (35.3%), four seafan pattern (23.5%), and seven indistinct network patterns (41.2%). Mean CNV area at baseline was 1.58 ± 1.72 mm. Final OCTA images revealed a decrease in CNV total area of 21.6%. In 6/17 eyes, the baseline neovascular pattern was unchanged; these cases were associated with exudation at the final spectral domain optical coherence tomography examination (P = 0.034) and a decrease in CNV area of 34.1%. Conversely, in 11/17 eyes (64.7%), the initial pattern had changed to a pruned vascular tree pattern, with variable exudative status on spectral domain optical coherence tomography at the final visit and a decrease in total CNV area of 0.07%. CONCLUSION: The vascular flow remodeling induced by recurrent anti-vascular endothelial growth factor treatment can be assessed by OCTA. Optical coherence tomography angiography may help to accurately evaluate treatment response and to recognize patterns usually associated with recurrent exudative activity.

WRINKLED VASCULARIZED RETINAL PIGMENT EPITHELIUM DETACHMENT PROGNOSIS AFTER INTRAVITREAL ANTI-VASCULAR ENDOTHELIAL GROWTH FACTOR THERAPY.

BACKGROUND/PURPOSE: Neovascular age-related macular degeneration (nAMD) is frequently associated with vascularized pigment epithelial detachment (v-PED). We observed a peculiar characteristic of v-PED characterized by small lacy folds of the retinal pigment epithelium, appearing as a wrinkled PED (w-PED) on spectral domain optical coherence tomography (SD-OCT). Our purpose was to describe the visual prognosis and number of intravitreal injections in w-PED compared with non-w-PED. METHODS: In this retrospective, case-control series, we reviewed retrospectively medical records of 52 eyes of 51 patients who were consecutively included between November 1 and 30, 2015 with a previous minimum 3-year follow-up. Inclusion criteria were: neovascular age-related macular degeneration, affected with w-PED. Baseline characteristics, best-corrected visual acuity (BVCA), number of intravitreal anti-vascular endothelial growth factor injections (anti-VEGF IVT) and maximal recurrence-free interval, that is, without intravitreal anti-vascular endothelial growth factor injection, were analyzed. A w-PED was defined as a v-PED ≥200 µm in height on SD-OCT imaging, presenting with at least 4 small lacy folds on the surface of the retinal pigment epithelium. Patients were compared with a control group, that is, patients harboring PED without wrinkle shape (non-w-PED). All patients had been treated by intravitreal anti-vascular endothelial growth factor injection of either ranibizumab (IVR) or aflibercept (IVA) using a pro re nata (PRN) protocol after three initial monthly treatments, with a minimum of follow-up of 3 years. RESULTS: Two groups of patients were compared, w-PED (29 eyes, from 29 patients), and non-w-PED (23 eyes from 22 patients). In the w-PED group, mean BCVA evolved from 0.28 (±0.18) log MAR (20/40, range 20/25-20/63) at baseline, to 0.29 (±0.21) log MAR (20/40, range 20/25-20/63) at 1 year (P = 0.41), 0.34 (±0.26) log MAR (20/40, range 20/25-20/80) at 2 years (P = 0.49), 0.35 (±0.28) log MAR (20/40, range 20/25-20/80) at 3 years (P = 0.54). In the non-w-PED group, mean BCVA was 0.40 (±0.28) log MAR (20/50, range 20/25-20/100) at baseline and decreased to 0.48 (±0.46) log MAR (20/63, range 20/20-20/160) at 1 year (P = 0.19), 0.48 (±0.35) log MAR (20/63, range 20/25-20/125) at 2 years (P = 0.02), 0.60 (±0.38) log MAR (20/80, range 20/32-20/200) at 3 years (P = 0.002). In the w-PED group, the mean maximal documented recurrence-free interval was 7.87 (±2.94) months at Year 1, 13.5 (±7.52) at Year 2 and 14.78 (±10.70) at Year 3, versus 4.59 (±2.95) months at Year 1, 7.83 (±6.62) at Year 2, 8.57 (±11.18) at Year 3 in the non-w-PED group (P = 0.0004; 0.0101; 0.0168 respectively at Years 1, 2 and 3). DISCUSSION: The evolution of v-PED after intravitreal anti-vascular endothelial growth factor injection is still difficult to predict despite intense clinical research in this topic. In our study, we noticed that w-PED might be a phenotypic prognosis factor for better visual acuity and longer maximal recurrence-free interval.

OPTICAL COHERENCE TOMOGRAPHY ANGIOGRAPHY CHANGES IN EARLY TYPE 3 NEOVASCULARIZATION AFTER ANTI-VASCULAR ENDOTHELIAL GROWTH FACTOR TREATMENT.

PURPOSE: To investigate the morphologic changes on optical coherence tomography angiography (OCTA) of treatment-naive Type 3 neovascularization secondary to exudative age-related macular degeneration after 1 year of anti-vascular endothelial growth factor therapy. METHODS: Consecutive patients diagnosed with treatment-naive early-stage Type 3 neovascularization were enrolled in this retrospective study. All patients underwent color fundus photographs/MultiColor (Heidelberg Engineering) imaging, fluorescein angiography, indocyanine green angiography, structural spectral domain OCT, and OCTA Optovue RTVue XR Avanti (Optovue) at baseline, and repeated OCTA and structural spectral domain OCT at Month 12. Qualitative analysis of the 3 × 3 OCTA examinations at baseline and Month 12 was then compared, to assess changes after anti-vascular endothelial growth factor therapy. RESULTS: A total of 15 treatment-naive eyes of 15 consecutive patients were included in the analysis. At 12-month follow-up after pro-re-data anti-vascular endothelial growth factor therapy (5.75 ± 1.48 injections of ranibizumab, and injections of 6.33 ± 1.21 of aflibercept), OCTA demonstrated persistence of the deep capillary plexus abnormalities in 13/15 eyes. In the outer retina and choriocapillaris, the initial lesion became undetectable in 7/15 cases, accompanied by choriocapillaris atrophy. The abnormal vascular complex persisted in the form of a tuft-shaped lesion in the outer retinal segmentation in 9/15 eyes, which in the choriocapillaris segmentation was associated with sub-retinal pigment epithelium neovascularization in 8 cases. CONCLUSION: Optical coherence tomography angiography showed that the tuft-shaped abnormal outer retinal lesion, frequently associated with a small clew-like flow signal in the choriocapillaris, after 1 year of anti-vascular endothelial growth factor therapy, either becomes undetectable or develops sub-retinal pigment epithelium neovascularization.

NEOVASCULARIZATION SECONDARY TO HIGH MYOPIA IMAGED BY OPTICAL COHERENCE TOMOGRAPHY ANGIOGRAPHY.

PURPOSE: To describe the optical coherence tomography angiography (OCTA) characteristics of active myopic choroidal neovascularization (CNV) and to compare its sensitivity versus fluorescein angiography and spectral-domain optical coherence tomography. METHODS: Consecutive highly myopic patients complicated with active myopic CNV were prospectively included. The OCTA features were analyzed and correlated with the findings of conventional imaging (spectral-domain optical coherence tomography and fluorescein angiography). RESULTS: Twenty eyes of 19 patients (mean age: 59.6 ± 12.1 years, mean spherical equivalent: -13.5 ± 3.6 diopters) presenting with both treatment-naive CNV and recurrent CNV were included in the analysis. The OCTA showed a 90% sensitivity for myopic CNV detection in 18 of 20 eyes, revealing a high-flow neovascular network accurately visible using a 30-µm manual segmentation underneath Bruch membrane. Mean selected area of myopic CNV on OCTA images was 0.34 ± 0.45 mm, whereas the mean vessel area was 0.22 ± 0.27 mm. Two neovascular phenotypes prevailed in our series: disorganized vascular loops and organized interlacing patterns. CONCLUSION: The OCTA seems to be a valuable tool in detecting myopic CNV with a high sensitivity. However, its specificity needs to be investigated in further studies.

Short-term results of switchback from aflibercept to ranibizumab in neovascular age-related macular degeneration in clinical practice.

PURPOSE: This work was undertaken to analyze the efficacy of switchback from aflibercept to ranibizumab in patients with neovascular age-related macular degeneration (nAMD) who had previously switched from ranibizumab to aflibercept. METHODS: This retrospective double-center study included 45 patients with nAMD who were previously treated with ranibizumab, then aflibercept, and then ranibizumab again, regardless of the number of intravitreal injections received. The primary outcome was change in best-corrected visual acuity (BCVA) measured on the Early Treatment Diabetic Retinopathy Study ETDRS chart before (T0) and after (T1) the switch, and 3 months after the switchback (T2). Secondary outcomes included changes in central foveal thickness (CFT) measured at T0, T1, and T2, as analyzed on spectral-domain optical coherence tomography (SD-OCT), and the percentage of patients gaining five letters or better. RESULTS: Forty-seven eyes of 45 patients were switched back from aflibercept to ranibizumab. The mean BCVA was 67.4 ± 13.4 at T0, 66.7 ± 14.4 at T1, and 68.2 ± 13.9 at T2. BCVA was significantly improved between T1 and T2 (p = 0.0230), but not between T0 and T1 (p = 0.5153) or between T0 and T2 (p = 0.4248). The mean CFT decreased from 317.8 µm ± 89.6 at T0 to 306.9 µm ±68.0 at T1, and to 291.2 µm ± 76.6 at T2. The decrease in CFT was not statistically significant between either T0 and T1 or T1 and T2, but was significant between T0 and T2, when compared before switch and after switchback (p = 0.0027). However, when considering eyes that received three or more consecutive intravitreal injections of aflibercept before switchback, the statistical significance between T1 and T2 was lost, although a trend towards significance remained (p = 0.06). Thirteen eyes (27.7 %) gained five letters or more (range, 5-15 letters) after switchback. CONCLUSIONS: A short-term benefit of switchback from one anti-VEGF agent to another was observed in patients with nAMD who had shown no benefit from the initial switch.

INTRAVITREAL DEXAMETHASONE IMPLANT IN PATIENTS WITH RANIBIZUMAB PERSISTENT DIABETIC MACULAR EDEMA.

PURPOSE: To study the efficacy of intravitreal injection (IVI) of dexamethasone implant as second-line treatment in patients with resistant chronic diabetic macular edema nonresponsive to 6 monthly consecutive IVI of ranibizumab. METHODS: A retrospective study was conducted over 9 months. Best-corrected visual acuity and central macular thickness were noted. Patients with best-corrected visual acuity ≤20/40 using Snellen chart, central macular thickness ≥300 µm, and poor response to 6 monthly consecutive IVI of ranibizumab were included. Patients received IVI of dexamethasone implant and were examined at 1, 3, 6, and 9 months. RESULTS: Thirteen eyes of 12 patients were included (6 men and 6 women; mean age, 64 ± 7.8 years). Best-corrected visual acuity increased by a mean of 5.58 letters at Month 1 (P = 0.017), 4.61 at Month 3 (P = 0.05), 4.61 at Month 6 (P = 0.042), and 5.77 at Month 9 (P = 0.017). Central macular thickness decreased from 594 µm to 402 µm at Month 1 (P = 0.0002), 428 µm at Month 3 (P = 0.002), 459 µm at Month 6 (P = 0.02), and 489 µm at Month 9 (P = 0.03). Mean number of dexamethasone IVI was 1.07. Two patients (15.3%) developed elevated intraocular pressure, and 1 patient was operated for cataract at 6 months (9% of phakic patients). CONCLUSION: Intravitreal injection of dexamethasone implant seems as an effective second-line treatment in diabetic macular edema persistent after 6 monthly consecutive intravitreal ranibizumab injections in real life.

OPTICAL COHERENCE TOMOGRAPHY ANGIOGRAPHY IN EARLY TYPE 3 NEOVASCULARIZATION.

PURPOSE: To report the imaging features of Type 3 neovascularization secondary to exudative age-related macular degeneration on optical coherence tomography angiography (OCTA). METHODS: All consecutive treatment-naive patients diagnosed with early-stage Type 3 neovascularization underwent imaging by color retinal photographs or multicolor imaging, fluorescein angiography, indocyanine green angiography, spectral domain optical coherence tomography, and OCTA. The OCTA features were analyzed and correlated with the findings of conventional angiography and spectral domain optical coherence tomography. RESULTS: A total of 18 treatment-naive eyes of 18 consecutive patients (13 females and 5 males; mean age 81.3 ± 6.0) were included in the analysis. Optical coherence tomography angiography showed lesions characterized by a retinal-retinal anastomosis that emerged from the deep capillary plexus, forming in all 18 eyes a clear tuft-shaped high-flow network in the outer retinal segmentation, finally abutting in the subretinal pigment epithelium space. In 15 of 18 eyes, in the choriocapillaris segmentation, there appeared a small clew-like lesion, which in 2 cases seemed connected with the choroid through a small caliber vessel. CONCLUSION: Optical coherence tomography angiography of treatment-naive Type 3 neovascularization showed almost constantly a high-flow, tuft-shaped abnormal outer retinal proliferation, frequently associated to a small clew-like lesion in the choriocapillaris layer.

OPTICAL COHERENCE TOMOGRAPHY ANGIOGRAPHY FEATURES OF SUBRETINAL FIBROSIS IN AGE-RELATED MACULAR DEGENERATION.

PURPOSE: To report the imaging features of subretinal fibrosis secondary to exudative age-related macular degeneration (AMD) on optical coherence tomography angiography. METHODS: All consecutive patients diagnosed with subretinal fibrosis complicating exudative AMD were imaged by color retinal photographs or multicolor imaging, fluorescein angiography, spectral domain optical coherence tomography, and optical coherence tomography angiography. Eyes with active exudative features observed during the last 6 months were compared with those without any sign of exudation >6 months. RESULTS: Forty-nine eyes of 47 consecutive patients were included. A blood flow inside the fibrotic scar could be detected in 46 of 49 cases (93.8%). Three patterns of vascular networks could be distinguished, that were described as pruned vascular tree (26 of 49 eyes; 53.1%), tangled network (14 of 49; 28.6%), and/or vascular loop (25 of 49; 51.0%). Furthermore, 2 types of hyporeflective structures, large flow void, and/or dark halo were observed in 63% and in 65% of eyes, respectively. The observed patterns did not differ between eyes with active or inactive lesions. CONCLUSION: Optical coherence tomography angiography of subretinal fibrosis showed almost constantly a perfused, abnormal vascular network and collateral architectural changes in the outer retina and the choriocapillaris layer. These features were associated with both active and inactive fibrotic choroidal neovessels.

TYPE 2 NEOVASCULARIZATION SECONDARY TO AGE-RELATED MACULAR DEGENERATION IMAGED BY OPTICAL COHERENCE TOMOGRAPHY ANGIOGRAPHY.

PURPOSE: Optical coherence tomography angiography is a novel and noninvasive technique for imaging retinal microvasculature by detecting changes in reflectivity that is related to blood flow. The purpose of this study was to describe Type 2 neovascularization characteristics in age-related macular degeneration using optical coherence tomography angiography. METHODS: Fourteen eyes of 14 consecutive patients with Type 2 neovascularization were prospectively included. All patients underwent a complete ophthalmological examination, including color and infrared fundus photography, fluorescein and indocyanine green angiography, spectral domain optical coherence tomography angiography, and optical coherence tomography angiography. RESULTS: In all cases, Type 2 lesions could be detected by optical coherence tomography angiography, presenting as a hyperflow lesion in the outer retina, with a glomerulus (4/14) or medusa shape (10/14), surrounded by a dark halo. The superficial layer and the deep retina showed no abnormal flow. Surprisingly, the Type 2 lesions could also be observed in the presumed choriocapillaris layer. These glomerulus- or medusa-shaped lesions were connected, in 10/14 eyes, to a thicker main branch, which seemed to continue deep into the choroidal layers. CONCLUSION: Optical coherence tomography angiography may be a new imaging method for the diagnosis of Type 2 neovascularization in clinical routine. However, the specificity of the features needs to be investigated in further studies.

Modeling approach to characterize intraocular doripenem pharmacokinetics after intravenous administration to rabbits, with tentative extrapolation to humans.

The aim of this study was to determine the penetration of doripenem administered intravenously into the rabbit aqueous and vitreous humors. Nineteen New Zealand White rabbits received a 20-mg dose of doripenem intravenously over 60 min. Specimens of aqueous humor, vitreous humor, and blood were obtained 30 min (n = 5), 1 h (n = 5), 2 h (n = 5), and 3 h (n = 4) after the beginning of the infusion and analyzed by high-performance liquid chromatography (HPLC). A pharmacokinetic (PK) model was developed to fit the experimental data. Doripenem concentrations in aqueous humor were lower than those in plasma ultrafiltrates at all sampling times, with an average aqueous humor-to-plasma ultrafiltrate area under the concentration-time curve ratio estimated as 8.3%. A pharmacokinetic model with peripheral elimination described the data adequately and was tentatively used to predict concentration-versus-time profiles and pharmacokinetic-pharmacodynamic (PK-PD) target attainment in patients under various dosing regimens. In conclusion, systematically administered doripenem does not seem to be a promising approach for the treatment of intraocular infections, especially since it could not be detected in the vitreous humor. However, this study has provided an opportunity to develop a new PK modeling approach to characterize the intraocular distribution of doripenem administered intravenously to rabbits, with tentative extrapolation to humans.

New strategy for rapid diagnosis and characterization of keratomycosis.

PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. DESIGN: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. PARTICIPANTS AND CONTROLS: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. METHODS: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. MAIN OUTCOME MEASURES: Detection of fungi in corneal samples by HRM. RESULTS: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. CONCLUSIONS: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.

Multimodal imaging of unusual macular macroaneurysm rupture after navigated retinal laser in a patient with adult onset Coats disease.

Purpose: To report the uncommon rupture of a macular macroaneurysm (MAR) during navigated retinal laser (Navilas®) focal treatment in a patient with adult onset Coats disease. Observation: A 30-year-old man consulted for progressive decrease of vision in his right eye from one week. Fundoscopy examination showed macular hard exudates, aneurysms, vascular telangiectasias in the temporal inferior quadrant consistent with an adult onset Coats disease (CD). Spectral domain optical coherence tomography (SD-OCT) and fluorescein angiography (FA) revealed macular edema, vessels abnormalities associate to non-perfused areas. Ultra-widefield optical coherence tomography angiography (UWF-OCTA) clearly showed the blood flow abnormalities in both superficial and deep capillary plexus. Focal laser photocoagulation of abnormal vessels by navigated retinal laser and intravitreal injections (IVT) of aflibercept, successfully resolved macular edema. During supplemental navigated focal laser treatment, a macular macroaneurysm rupture occurred, causing intravitreal hemorrhage with a self-limiting resolution in three months. Indeed, visual acuity progressively improved during follow-up and absence of macular edema was observed at 18 months. Conclusion: Adult onset CD is a rare condition. Our patient presented an unusual intravitreal hemorrhagic complication due to a MAR rupture after focal navigated laser treatment. Despite this complication, early laser photocoagulation and IVT injections of anti-VEGF, successfully resolved macular edema. UWF-OCTA follow-up clearly showed abnormal vessels in both superficial capillary plexus (SCP) and deep capillary plexus (DCP) and successfully guided additional navigated focal laser treatment.

Atypical case of perifoveal exudative vascular anomalous complex associated with pachychoroid pigment epitheliopathy.

Purpose: To report an unusual association of a perifoveal exudative vascular anomalous complex (PEVAC) and a bilateral pachychoroid pigment epitheliopathy (PPE), which responded positively to anti-vascular endothelial growth factor (VEGF) intravitreal injections (IVI). Observations: A 44 year-old man with no significant medical or ocular history, complained of unilateral blurred vision in his right eye (RE) over several months. On examination, best corrected visual acuity (BCVA) was 75 letters in the RE and 85 in the left eye (LE). Fundus examination in the RE showed a large perifoveal aneurysmal lesion with a macular thickening, small hemorrhages and linear hard exudates accumulation, associated with multifocal retinal pigment epithelium (RPE) changes in the posterior pole of both eyes. Optical coherence tomography of the RE showed the PEVAC as a large round retinal capillary aneurysm with surrounding intraretinal fluid, associated with serous and drusenoid RPE elevations in both eyes, consistent with PPE. Subfoveal choroidal thickness was more than 500 µm in both eyes, with several dilated choroidal veins. Fluorescein angiography showed, in the RE, the hyperfluorescent aneurysmal lesion with late leakage, associated with scattered hyperfluorescent areas in the posterior pole of both eyes. Indocyanine green angiography showed, in the RE, the same hyperfluorescent lesion but without leakage, associated with areas of choroidal hyperpermeability in both eyes. After 2 anti-VEGF IVI in the RE, good functional and anatomical improvement was observed. After 10 months of follow-up, there was no evidence of new exudation. BCVA remained stable and RPE abnormalities remained unchanged. Conclusion and importance: We describe an atypical case of PEVAC associated with PPE, which responded positively to anti-VEGF therapy. To our knowledge, this is the first report of a patient presenting PEVAC and diseases of the pachychoroid spectrum. Further studies, assessing the choroid in PEVAC, are required to investigate the hypothetical relationship between these 2 entities and the efficiency of anti-VEGF therapy.

Navigated micropulse laser for central serous chorioretinopathy: Efficacy, safety, and predictive factors of treatment response.

PURPOSE: There is no widely accepted treatment for persistent/chronic central serous chorioretinopathy. The present study aimed to evaluate the efficacy, safety, and factors associated to treatment response to navigated micropulse laser in chorioretinopathy. METHODS: Retrospective observational case series including consecutive patients presenting with symptomatic persistent and chronic chorioretinopathy. All patients were treated with 5% navigated micropulse laser with the Navilas system (Navilas®, OD-OS GmBH, Teltwo, Germany), by overlying fluorescein angiography, indocyanine green angiography and/or spectral domain-optical coherence tomography images of visible leaking points and/or choroidal hyperpermeability/subretinal fluid to plan the laser treatment. RESULTS: Thirty-nine eyes of 36 consecutive patients (29 men and 7 women, with a mean age of 51.87 years) were included. Logarithm of the minimum angle of resolution (LogMar) best-corrected visual acuity increased from 0.39 ± 0.24 at baseline to 0.24 ± 0.22 at 3 months (p < 0.0001) and to 0.20 ± 0.07 at 6 months (p < 0.0001). Subretinal fluid decreased from 166.82 ± 111.11 micron at baseline to 52.33 ± 78.97 micron (p < 0.0001) at 3 months and 34.12 ± 67.56 micron at 6 months (p < 0.0001). The presence of a hot spot on fluorescein angiography and a focal choroidal hyperpermeability on indocyanine green angiography, but not the duration of symptoms correlated significantly with the resolution of subretinal fluid at month 3 (p = 0.023 and p = 0.001). CONCLUSION: Navigated micropulse laser laser treatment was found to be effective and safe for the treatment of chorioretinopathy, with significant improvement in visual and anatomical outcomes, unaccompanied by any adverse event at 3 and 6 months follow-up. Factors associated to subretinal fluid resolution may allow a better selection of likely responders to navigated micropulse laser treatment.