Circulating palmitoyl sphingomyelin levels predict the 10-year increased risk of cardiovascular disease death in Chinese adults: findings from the Da Qing Diabetes Study.

BACKGROUND: Higher levels of palmitoyl sphingomyelin (PSM, synonymous with sphingomyelin 16:0) are associated with an increased risk of cardiovascular disease (CVD) in people with diabetes. Whether circulating PSM levels can practically predict the long-term risk of CVD and all-cause death remains unclear. This study aimed to investigate whether circulating PSM is a real predictor of CVD death in Chinese adults with or without diabetes. METHODS: A total of 286 and 219 individuals with and without diabetes, respectively, from the original Da Qing Diabetes Study were enrolled. Blood samples collected in 2009 were used as a baseline to assess circulating PSM levels. The outcomes of CVD and all-cause death were followed up from 2009 to 2020, and 178 participants died, including 87 deaths due to CVD. Cox proportional hazards regression was used to estimate HRs and their 95% CIs for the outcomes. RESULTS: Fractional polynomial regression analysis showed a linear association between baseline circulating PSM concentration (log-2 transformed) and the risk of all-cause and CVD death (p < 0.001), but not non-CVD death (p > 0.05), in all participants after adjustment for confounders. When the participants were stratified by PSM-tertile, the highest tertile, regardless of diabetes, had a higher incidence of CVD death (41.5 vs. 14.7 and 22.2 vs. 2.9 per 1000 person-years in patients with and without diabetes, respectively, all log-rank p < 0.01). Individuals with diabetes in the highest tertile group had a higher risk of CVD death than those in the lowest tertile (HR = 2.73; 95%CI, 1.20-6.22). CONCLUSIONS: Elevated PSM levels are significantly associated with a higher 10-year risk of CVD death, but not non-CVD death, in Chinese adults with diabetes. These findings suggest that PSM is a potentially useful long-term predictor of CVD death in individuals with diabetes.

Asymmetric Synthesis of Axially Chiral N, N-1,2-Pentatomic Heterobiaryl Diamines by an Organocatalytic Arylation Reaction.

The utilization of axially chiral biaryl diamines has been widely acknowledged as highly advantageous structures for the advancement of chiral catalysts and ligands. This highlights their extensive range of applications in asymmetric catalysis and synthesis. Herein, we devised a direct arylation reactions of 5-aminopyrazoles with azonaphthalenes, utilizing chiral phosphoric acid as the catalyst. This method delivers structurally novel atroposelective N, N-1,2-azole heteroaryl diamines with high yields (up to >98%) and good to excellent enantiomeric ratios while exhibiting a wide range of substrate compatibility.

New wheat straw fermentation feed: recombinant Schizosaccharomyces pombe efficient degradation of lignocellulose and increase feed protein.

Wheat straw contains a high amount of lignin, hindering the action of cellulase and hemicellulase enzymes, leading to difficulties in nutrient absorption by animals from straw feed. However, currently, the biological treatment of straw relies primarily on fungal degradation and cannot be directly utilized for the preparation of livestock feed. This study focuses on enzymatic co-fermentation of wheat straw to produce high-protein, low-cellulose biological feed, integrating lignin degradation with feed manufacturing, thereby simplifying the feed production process. After the optimization using Box-Behnken Design for the feed formulation, with a glucose oxidase addition of 2.46%, laccase addition of 3.4%, and malonic acid addition of 0.6%, the wheat straw feed prepared in this experiment exhibited a true protein content of 9.35%. This represented a fourfold increase compared to the non-fermented state, and the lignocellulose degradation rate of wheat straw reached 45.42%. These results not only highlight the substantial enhancement in protein content but also underscore the significant advancement in lignocellulose breakdown. This formulation significantly enhanced the palatability and nutritional value of the straw feed, contributing to the industrial development of straw feed.

Optimising the measurement of intra-bladder pressure in patients with predicted severe acute pancreatitis.

BACKGROUND: Measuring intra-abdominal pressure (IAP) is important for management of patients with severe acute pancreatitis (SAP). Intra-bladder pressure (IBP) is an indirect index that reflects IAP, but measuring techniques vary. We sought to optimise IBP measuring techniques in predicted SAP patients. METHODS: Predicted SAP patients consecutively admitted between June 2018 and January 2020 were scrutinised. Eligible patients had their IBP monitored for the first 72 h at 6-h intervals, and were then sequentially allocated into three research scenarios: (1) in the supine position along with head of bed elevation(HoBE)of 0, 15 and 30° at various points including the iliac crest the midaxillary line, pubic symphysis, and right atrium level, instilled with 25 mL normal saline (NS) at room temperature (RT); (2) NS instillation volume from 0, 10, 25, 40-50 mL at the iliac crest with HoBE15 at RT; and (3) NS instillation (25 mL) at either RT or 37 °C with HoBE15. RESULTS: The dynamic IBP values measured at the pubic symphysis and iliac crest were fairly similar between HoBE0 and HoBE15 (all P > 0.05), but greatly increased at HoBE30 (all P < 0.01). IBP was significantly increased with escalating instillation volumes of NS (all P < 0.01 versus 0 mL NS), while there was no significant difference between 25 mL and 10 mL (P = 0.055). IBP was similar between NS at RT and under 37 °C (P = 0.643). CONCLUSION: In predicted SAP patients, measuring IBP at the iliac crest with HoBE15 after instilling 10 mL of NS seems to be appropriate for monitoring IAP.

Association between stress hyperglycaemia and in-hospital cardiac events after coronary artery bypass grafting in patients without diabetes: A retrospective observational study of 5450 patients.

AIMS: To investigate the impact of stress hyperglycaemia (SH) on in-hospital adverse cardiac events after coronary artery bypass grafting (CABG) in patients without diabetes. MATERIALS AND METHODS: In total, 5450 patients without diabetes who underwent CABG were analysed. SH was defined as any two instances in which the random blood glucose level was >7.8 mmol/L after CABG in the intensive care unit (ICU). The primary outcome was major adverse cardiac events (MACEs), including in-hospital mortality, acute myocardial infarction, stroke and acute renal failure. Secondary outcomes included surgical site infection (SSI) and length of ICU stay. RESULTS: Patients with SH had higher rates of MACEs (5.7% vs. 2.3%, p < .0001) and higher SSI (3.3% vs. 1.4%, p = .0003) and longer ICU stays (2.6 ± 2.0 vs. 1.3 ± 1.3 days, p < .0001) than those without SH. Furthermore, SH was associated with a higher risk of MACEs [odds ratio (OR): 2.32, 95% confidence interval (CI): 1.38-3.90], SSI (OR: 2.21, 95% CI: 1.20-3.95) and longer ICU stay (OR: 12.27, 95% CI: 9.41-16.92) after adjusting for confounders. Subgroup analysis showed that patients with SH >10 mmol/L or SH that occurred in the ICU and lasted more than 48 h had increased risks of postoperative complications (p < .05). CONCLUSIONS: SH was significantly associated with an increased risk of MACEs, SSI and longer ICU stay after CABG in patients without diabetes. In addition, SH >10 mmol/L or that occurred in the ICU and lasted more than 48 h increased the risk of adverse outcomes.

A direct approach toward investigating DNA-ligand interactions via surface-enhanced Raman spectroscopy combined with molecular dynamics simulations.

Small molecules that interfere with DNA replication can trigger genomic instability, which makes these molecules valuable in the search for anticancer drugs. Thus, interactions between DNA and its ligands at the molecular level are of great significance. In the present study, a new method based on surface-enhanced Raman spectroscopy (SERS) combined with molecular dynamics simulations has been proposed for analyzing the interactions between DNA and its ligands. The SERS signals of DNA hairpins (ST: d(CGACCAACGTGTCGCCTGGTCG), AP1: d(CGCACAACGTGTCGCCTGTGCG)), pure argininamide, and their complexes, were obtained, and the characteristic peak sites of the DNA secondary structure and argininamide ligand-binding region were analyzed. Molecular dynamics calculations predicted that argininamide binds to the 8C and 9G bases of AP1 via hydrogen bonding. Our method successfully detected the changes of SERS fingerprint peaks of hydrogen bonds and bases between argininamide and DNA hairpin bases, and their binding sites and action modes were consistent with the predicted results of the molecular dynamics simulations. This SERS technology combined with the molecular dynamics simulation detection platform provides a general analysis tool, with the advantage of effective, rapid, and sensitive detection. This platform can obtain sufficient molecular level conformational information to provide avenues for rapid drug screening and promote progress in several fields, including targeted drug design.

Predicting Persistent Acute Respiratory Failure in Acute Pancreatitis: The Accuracy of Two Lung Injury Indices.

BACKGROUND/AIMS: Early and accurate identification of patients with acute pancreatitis (AP) at high risk of persistent acute respiratory failure (PARF) is crucial. We sought to determine the accuracy of simplified Lung Injury Prediction Score (sLIPS) and simplified Early Acute Lung Injury (sEALI) for predicting PARF in ward AP patients. METHODS: Consecutive AP patients in a training cohort from West China Hospital of Sichuan University (n = 912) and a validation cohort from The First Affiliated Hospital of Nanchang University (n = 1033) were analyzed. PARF was defined as oxygen in arterial blood/fraction of inspired oxygen < 300 mmHg that lasts for > 48 h. The sLIPS was composed by shock (predisposing condition), alcohol abuse, obesity, high respiratory rate, low oxygen saturation, high oxygen requirement, hypoalbuminemia, and acidosis (risk modifiers). The sEALI was calculated from oxygen 2 to 6 L/min, oxygen > 6 L/min, and high respiratory rate. Both indices were calculated on admission. RESULTS: PARF developed in 16% (145/912) and 22% (228/1033) (22%) of the training and validation cohorts, respectively. In these patients, sLIPS and sEALI were significantly increased. sLIPS ≥ 2 predicted PARF in the training (AUROC 0.87, 95% CI 0.84-0.89) and validation (AUROC 0.81, 95% CI 0.78-0.83) cohorts. sLIPS was significantly more accurate than sEALI and current clinical scoring systems in both cohorts (all P < 0.05). CONCLUSIONS: Using routinely available clinical data, the sLIPS can accurately predict PARF in ward AP patients and outperforms the sEALI and current existing clinical scoring systems.

A microRNA checkpoint for Ca2+ signaling and overload in acute pancreatitis.

Acute pancreatitis (AP) is a common digestive disease without specific treatment, and its pathogenesis features multiple deleterious amplification loops dependent on translation, triggered by cytosolic Ca2+ ([Ca2+]i) overload; however, the underlying mechanisms in Ca2+ overload of AP remains incompletely understood. Here we show that microRNA-26a (miR-26a) inhibits pancreatic acinar cell (PAC) store-operated Ca2+ entry (SOCE) channel expression, Ca2+ overload, and AP. We find that major SOCE channels are post-transcriptionally induced in PACs during AP, whereas miR-26a expression is reduced in experimental and human AP and correlated with AP severity. Mechanistically, miR-26a simultaneously targets Trpc3 and Trpc6 SOCE channels and attenuates physiological oscillations and pathological elevations of [Ca2+]i in PACs. MiR-26a deficiency increases SOCE channel expression and [Ca2+]i overload, and significantly exacerbates AP. Conversely, global or PAC-specific overexpression of miR-26a in mice ameliorates pancreatic edema, neutrophil infiltration, acinar necrosis, and systemic inflammation, accompanied with remarkable improvements on pathological determinants related with [Ca2+]i overload. Moreover, pancreatic or systemic administration of an miR-26a mimic to mice significantly alleviates experimental AP. These findings reveal a previously unknown mechanism underlying AP pathogenesis, establish a critical role for miR-26a in Ca2+ signaling in the exocrine pancreas, and identify a potential target for the treatment of AP.

The impact and role of identified long noncoding RNAs in nonalcoholic fatty liver disease: A narrative review.

BACKGROUND: Nonalcoholic fatty liver disease (NAFLD) is the most common liver disease worldwide, but its mechanism and pathophysiology remain unclear. Long noncoding RNAs (lncRNAs) may exert a vital influence on regulating various biological functions in NAFLD. METHODS: The databases such as Google Scholar, PubMed, and Medline were searched using the following keywords: nonalcoholic fatty liver disease, nonalcoholic fatty liver disease, NAFLD, nonalcoholic steatohepatitis, nonalcoholic steatohepatitis, NASH, long noncoding RNAs, and lncRNAs. Considering the titles and abstracts, unrelated studies were excluded. The authors evaluated the full texts of the remaining studies. RESULTS: We summarized the current knowledge of lncRNAs and the main signaling pathways of lncRNAs involved in NAFLD explored in recent years. As a heterogeneous group of noncoding RNAs (ncRNAs), lncRNAs play crucial roles in biological processes underlying the pathophysiology of NAFLD. The mechanisms, particularly those associated with the regulation of the expression and activities of lncRNAs, play important roles in NAFLD. CONCLUSION: A better comprehension of the mechanism controlled by lncRNAs in NAFLD is necessary for the identification of novel therapeutic targets for drug development and improved, noninvasive methods for diagnosis.

Preparing the pure lignin peroxidase and exploring the effects of chemicals on the activity.

Heterogous expression of lignin peroxidase (LiP) from Phanerochaete chrysosporium was performed in by E. coli prokaryotic expression system, and pure LiP was prepared by washing, refolding, and purification. The enzyme activity was measured by the resveratrol oxidation method. The effects of different chemicals on LiP activity were explored by adding different kinds of metal ions, acids/phenols, and surfactants. The optimal pH and temperature are 4.2 and 40 °C. The single-factor screening experiment showed that adding 1 mM Mn2+, 0.1 mM DL-lactic acid, and 2% PEG-4000 had the best promotion effect on the enzyme activity of recombinant LiP, which was 160.61%, 188.46%, and 247.83%, respectively. Further, the synergistic addition of Mn2+ and PEG-4000 achieved the best enzyme activity promotion effect of 277.51%. In addition, the addition of DL-lactic acid alone could promote LiP activity. However, the co-addition of lactic acid with Mn2+ and PEG-4000 contributed only 247.87%, which indicated that the addition of DL-lactic acid had an inhibitory effect when applied synergistically. For the first time, it was found that PEG-4000 increased LiP enzyme activity obviously and had a synergistic effect with Mn2+, serving as a reference for LiP in studies and applications pertaining to lignin breakdown.

Growth differentiation factor 15 is an early predictor for persistent organ failure and mortality in acute pancreatitis.

OBJECTIVES: Early prediction of persistent organ failure (POF) is crucial for patients with acute pancreatitis (AP). Growth differentiation factor 15 (GDF15), also known as macrophage inhibitory cytokine 1 (MIC-1), is associated with inflammatory responses. We investigated changes in plasma GDF15 and assessed its predictive value in AP. METHODS: The study included 290 consecutive patients with AP admitted within 36 h after symptoms onset. Clinical data obtained during hospitalization were collected. Plasma GDF15 levels were determined using enzyme-linked immunosorbent assays. The predictive value of GDF15 for POF was analyzed. RESULTS: There were 105 mild, 111 moderately severe, and 74 severe AP patients. Plasma GDF15 peak level were measured on admission, and significantly declined on the 3rd and 7th day. Admission GDF15 predicted POF and mortality with areas under the curve (AUC) of 0.847 (95% confidence interval [CI] 0.798-0.895) and 0.934 (95% CI 0.887-0.980), respectively. Admission GDF15, Bedside Index of Severity in Acute Pancreatitis, and hematocrit were independent factors for POF by univariate and multivariate logistic regression, and the nomogram built on these variables showed good performance (optimism-corrected c-statistic = 0.921). The combined predictive model increased the POF accuracy with an AUC 0.925 (95% CI 0.894-0.956), a net reclassification improvement of 0.3024 (95% CI: 0.1482-0.4565, P < 0.001), and an integrated discrimination index of 0.11 (95% CI 0.0497-0.1703; P < 0.001). CONCLUSIONS: Plasma GDF15 measured within 48 h of symptom onset could help predict POF and mortality in AP patients.

Optimising fluid requirements after initial resuscitation: A pilot study evaluating mini-fluid challenge and passive leg raising test in patients with predicted severe acute pancreatitis.

BACKGROUND: The goals and approaches to fluid therapy vary through different stages of resuscitation. This pilot study was designed to test the safety and feasibility of a fluid therapy protocol for the second or optimisation stage of resuscitation in patients with predicted severe acute pancreatitis (SAP). METHODS: Spontaneously breathing patients with predicted SAP were admitted after initial resuscitation and studied over a 24-h period in a tertiary hospital ward. Objective clinical assessment (OCA; heart rate, mean arterial pressure, urine output, and haematocrit) was done at 0, 4, 8, 12, 18-20, and 24 h. All patients had mini-fluid challenge (MFC; 250 ml intravenous normal saline within 10 min) at 0 h and repeated at 4 and 8 h if OCA score ≥2. Patients who were fluid responsive (>10% change in stroke volume after MFC) received 5-10 ml/kg/h, otherwise 1-3 ml/kg/h until the next time point. Passive leg raising test (PLRT) was done at each time point and compared with OCA for assessing volume status and predicting fluid responsiveness. RESULTS: This fluid therapy protocol based on OCA, MFC, and PLRT and designed for the second stage of resuscitation was safe and feasible in spontaneously breathing predicted SAP patients. The PLRT was superior to OCA (at 0 and 8 h) for predicting fluid responsiveness and guiding fluid therapy. CONCLUSIONS: This pilot study found that a protocol for intravenous fluid therapy specifically for the second stage of resuscitation in patients with predicted SAP was safe, feasible, and warrants further investigation.

Effects of Dexmedetomidine and Oxycodone on Neurocognitive and Inflammatory Response After Tourniquet-Induced Ischemia-Reperfusion Injury.

To evaluate the effects of dexmedetomidine (Dex) and oxycodone (Oxy) on neurocognitive and inflammatory response after tourniquet-induced ischemia-reperfusion (I/R) injury. C57/BL6 mice were used to construct the mouse model of tourniquet-induced I/R injury. Mice (n = 48) were randomly divided into sham, I/R, Dex or Oxy group. Morris water maze test was performed to assess the spatial learning and memory function. The expression of NF-κB, TLR4, NR2B, M1 (CD68 and TNF-α) and M2 (CD206 and IL-10) polarization markers in mice hippocampus were detected by western blot or immunofluorescent staining. Spontaneous excitatory post-synaptic currents (sEPSCs) were recorded by electrophysiology. Dex treatment alleviated I/R-induced declines in learning and memory (p < 0.05), while Oxy had no significant effect on it. Compared with I/R group, Dex and Oxy treatment down-regulated the expression of NF-κB, TLR4, TNF-α and CD68 (all p < 0.05), while no significantly different was found in CD206 and IL-10. In addition, Dex treatment down-regulated the expression of NR2B and reduced the frequency and amplitude of sEPSCs in I/R model mice (all p < 0.05), while Oxy had no significant effect on them. Tourniquet-induced I/R could impair the neurocognitive function of mice. Dex treatment could alleviate I/R-induced neurocognitive disorder by inhibiting abnormal synaptic transmission in hippocampal neurons. Both Dex and Oxy could alleviate the inflammatory response likely by inhibiting the polarization of microglia toward M1 phenotype via TLR4/NF-κB pathway. Future studies are needed to further examine the effects of Dex on neurocognitive disorder after tourniquet-induced I/R injury and investigate the exact mechanism.

Epinephelus coioides Hsp27 negatively regulates innate immune response and apoptosis induced by Singapore grouper iridovirus (SGIV) infection.

Heat shock proteins (Hsps) are important for maintaining protein homeostasis and cell survival. In this study, Hsp27 of Epinephelus coioides, an economically important marine fish in China and Southeast Asian countries, was characterized. E. coioides Hsp27 contains the consered ACD_HspB1_like domain and three p38 MAPK phosphorylation sites, located at Thr-13, Thr-60 and Ser-167. E. coioides Hsp27 was distributed in both the cytoplasm and nucleus, its mRNA was detected in all 14 tissues examined, and its expression was up-regulated after challenge with Singapore grouper iridovirus (SGIV), an important E. coioides pathogen. Over-expression of E. coioides Hsp27 significantly upregulated the expressions of the key SGIV genes (VP19, LITAF, MCP, and ICP18), downgraded the expressions of the E. coioides immune factors (IRF3, IRF7, ISG15, and TRAF6) and proinflammatory factors (TNF-α, IL-8), downgraded the activation of nuclear factor kappa-B (NF-κB) and activator protein-1 (AP-1), and substantially inhibited the cell apoptosis induced by SGIV infection. These data illustrated that E. coioides Hsp27 might be involved in SGIV infection by negatively regulating the innate immune response.

The binding mechanism of NHWD-870 to bromodomain-containing protein 4 based on molecular dynamics simulations and free energy calculation.

Bromodomain and extra-terminal (BET) proteins (BRD2, BRD3, BRD4, and BRDT) are epigenetic readers with tandem bromodomains. Small-molecule inhibitors of BET proteins are a promising treatment strategy against cancer. For example, NHWD-870 can inhibit BRD4 (BD1 + BD2). Presently, structural data on NHWD-870 bound BRD4 remain lacking. Herein, we investigate the interactions between NHWD-870 and BRD4 (BD1 and BD2) via molecular docking, molecular dynamics simulation, and binding free energy calculations. NHWD-870 showed a similar binding affinity for BD1 and BD2 of BRD4. Binding free energy calculations for the R/S conformations of NHWD-870 suggest that the chiral centre of NHWD-870 may confer similar roles upon the R and S conformations for binding with BRD4, facilitating the identification of novel BRD4 inhibitors.

Predicting persistent organ failure on admission in patients with acute pancreatitis: development and validation of a mobile nomogram.

BACKGROUND: Early prediction of persistent organ failure (POF) is important for triage and timely treatment of patients with acute pancreatitis (AP). METHODS: All AP patients were consecutively admitted within 48 h of symptom onset. A nomogram was developed to predict POF on admission using data from a retrospective training cohort, validated by two prospective cohorts. The clinical utility of the nomogram was defined by concordance index (C-index), decision curve analysis (DCA), and clinical impact curve (CIC), while the performance by post-test probability. RESULTS: There were 816, 398, and 880 patients in the training, internal and external validation cohorts, respectively. Six independent predictors determined by logistic regression analysis were age, respiratory rate, albumin, lactate dehydrogenase, oxygen support, and pleural effusion and were included in the nomogram (web-based calculator: https://shina.shinyapps.io/DynNomapp/). This nomogram had reasonable predictive ability (C-indexes 0.88/0.91/0.81 for each cohort) and promising clinical utility (DCA and CIC). The nomogram had a positive likelihood ratio and post-test probability of developing POF in the training, internal and external validation cohorts of 4.26/31.7%, 7.89/39.1%, and 2.75/41%, respectively, superior or equal to other prognostic scores. CONCLUSIONS: This nomogram can predict POF of AP patients and should be considered for clinical practice and trial allocation.

Improvement of protein production by engineering a novel antiapoptotic baculovirus vector to suppress the expression of Sf-caspase-1 and Tn-caspase-1.

The baculovirus expression vector system (BEVS) is an attractive manufacturing platform for recombinant protein production in insect cells. However, baculovirus infection commonly induces host apoptosis in 3-4 days which would subsequently terminate the protein expression. Previous studies have proved that protein production by BEVS can be elevated in apoptosis-suppressed insect cells. We also developed a baculovirus vector in our previous report to inhibit the apoptosis and improve protein production in Sf9 cells. In this study, we designed five short hairpin RNA (shRNA) expression cassettes targeting a conserved region in Spodoptera frugiperda caspase-1 (Sf-caspase-1) and Trichoplusia ni caspase-1 (Tn-caspase-1), and found that introduction of C to T mutations within the stem region of the expression cassette was beneficial for the heterologous protein expression. One of the improved shRNA expression cassettes was knocked into a bacmid with the deletion of several nonessential genes. The novel baculovirus vector demonstrated the ability to suppress cell apoptosis in both Sf9 and High Five cells, and exhibited superior recombinant protein productivity of intracellularly expressed GFP and firefly luciferase and secreted glycoprotein OD-Fc. The antiapoptotic baculovirus vector developed in this study could serve as a useful tool for the protein production in scientific research and pharmaceutical industries.

Chlorogenic acid inhibits proliferation in human hepatoma cells by suppressing noncanonical NF-κB signaling pathway and triggering mitochondrial apoptosis.

Chlorogenic acid (CGA), a phenylpropanoid derived from Eucommia ulmoides Oliver, has been shown to exhibit potent cytotoxic and anti-proliferative activities against several human cancers. However, the effects of CGA on hepatocellular carcinoma (HCC) and the underlying mechanisms have not been intensively studied. In this study, the CGA treatment effects on the viability of human hepatoma cells were investigated by MTT assay. Our data showed that CGA could dose-dependently inhibit the activity of human hepatoma cells Hep-G2 and Huh-7, but did not affect the activity and growth of normal human hepatocyte QSG-7701. The genes and pathways influenced by CGA treatment were explored by RNA sequencing and bioinformatics analysis, which identified 323 differentially expressed genes (DEGs) involved in multiple pharmacological signaling pathways such as MAPK, NF-κB, apoptosis and TGF-ß signaling pathways. Further analyses by real-time quantitative PCR, Western blot and flow cytometry revealed that CGA effectually suppressed the noncanonical NF-κB signaling pathway, meanwhile it activated the mitochondrial apoptosis of HCC by upregulation of the BH3-only protein Bcl-2 binding component 3 (BBC3). Our findings demonstrated the potential of CGA in suppressing human hepatoma cells and provided a new insight into the anti-cancer mechanism of CGA.

Gut microbiota from coronary artery disease patients contributes to vascular dysfunction in mice by regulating bile acid metabolism and immune activation.

BACKGROUND: The gut microbiota was shown to play a crucial role in the development of vascular dysfunction, and the bacterial composition differed between healthy controls and coronary artery disease patients. The goal of this study was to investigate how the gut microbiota affects host metabolic homeostasis at the organism scale. METHODS: We colonized germ-free C57BL/6 J mice with faeces from healthy control donors (Con) and coronary artery disease (CAD) patients and fed both groups a high fat diet for 12 weeks. We monitored cholesterol and vascular function in the transplanted mice. We analysed bile acids profiles and gut microbiota composition. Transcriptome sequencing and flow cytometry were performed to evaluate inflammatory and immune response. RESULTS: CAD mice showed increased reactive oxygen species generation and intensive arterial stiffness. Microbiota profiles in recipient mice clustered according to the microbiota structure of the human donors. Clostridium symbiosum and Eggerthella colonization from CAD patients modulated the secondary bile acids pool, leading to an increase in lithocholic acid and keto-derivatives. Subsequently, bile acids imbalance in the CAD mice inhibited hepatic bile acids synthesis and resulted in elevated circulatory cholesterol. Moreover, the faecal microbiota from the CAD patients caused a significant induction of abnormal immune responses at both the transcriptome level and through the enhanced secretion of cytokines. In addition, microbes belonging to CAD promoted intestinal inflammation by contributing to lamina propria Th17/Treg imbalance and worsened gut barrier permeability. CONCLUSIONS: In summary, our findings elucidated that the gut microbiota impacts cholesterol homeostasis by modulating bile acids. In addition, the CAD-associated bacterial community was shown to function as an important regulator of systemic inflammation and to influence arterial stiffness.

Early Rapid Fluid Therapy Is Associated with Increased Rate of Noninvasive Positive-Pressure Ventilation in Hemoconcentrated Patients with Severe Acute Pancreatitis.

BACKGROUND/AIMS: Hematocrit is a widely used biomarker to guide early fluid therapy for patients with acute pancreatitis (AP), but there is controversy over whether early rapid fluid therapy (ERFT) should be used in hemoconcentrated patients. This study investigated the association of hematocrit and ERFT with clinical outcomes of patients with AP. METHODS: Data from prospectively maintained AP database and retrospectively collected fluid management details were stratified according to actual severity defined by revised Atlanta classification. Hemoconcentration and "early" were defined as hematocrit > 44% and the first 6 h of general ward admission, respectively, and "rapid" fluid rate was defined as ≥ 3 ml/kg/h. Patients were allocated into 4 groups for comparisons: group A, hematocrit ≤ 44% and fluid rate < 3 ml/kg/h; group B, hematocrit ≤ 44% and fluid rate ≥ 3 ml/kg/h; group C, hematocrit > 44% and fluid rate < 3 ml/kg/h; and group D, hematocrit > 44% and fluid rate ≥ 3 ml/kg/h. Primary outcome was rate of noninvasive positive-pressure ventilation (NPPV). RESULTS: A total of 912 consecutive AP patients were analyzed. ERFT has no impact on clinical outcomes of hemoconcentrated, non-severe or all non-hemoconcentrated AP patients. In hemoconcentrated patients with severe AP (SAP), ERFT was accompanied with increased risk of NPPV (odds ratio 5.96, 95% CI 1.57-22.6). Multivariate regression analyses confirmed ERFT and hemoconcentration were significantly and independently associated with persistent organ failure and mortality in patients with SAP. CONCLUSIONS: ERFT is associated with increased rate of NPPV in hemoconcentrated patients with SAP.