Collaborative Study of Thresholds for Mutagens: Adaptive Responses in the Micronucleus Test and Gene Induction by Mutagenic Treatments.

Background: We have been conducting a collaborative study on the thresholds of mutagens. In our previous examinations of cell activity and cell proliferation as endpoints, both displayed hormesis. This time, we conducted experiments to determine thresholds using the micronucleus test as an endpoint. Methods: The micronucleus test was conducted using Chinese hamster CHL/IU cells and mouse lymphoid L5178Y cells. Additionally, we conducted preliminary investigations into the gene expression using human TK6 cells. Results: When adhesive CHL/IU cells were treated with mitomycin C (MMC), and the hormetic response was examined, hormesis was not observed clearly. When L5178Y cells were treated with methyl methanesulfonate (EMS), AF-2, MMC, and colchicine, all of them exhibited an adaptive response. Additionally, cross-adaptive responses using AF-2 and MMC or EMS and MMC were conducted, both combinations showed a cross-adaptive response. When the gene expression patterns of six genes were investigated by RT-PCR after treatment with MMC, EMS, and H2O2 using TK6 cells, two genes, GADD45 A and P21, were induced in a dose- and time-dependent manner. Conclusion: Adaptive responses arise from preconditioning. As hormesis is inherently linked to preconditioning, adaptive responses observed in this study strongly suggest that hormesis was induced, hence existence of thresholds.

Hairless mutation: a driving force of humanization from a human-ape common ancestor by enforcing upright walking while holding a baby with both hands.

Three major characteristics distinguish humans from other primates: bipedality, practical nakedness, and the family as a social unit. A hairless mutation introduced into the chimpanzee/human last common ancestor (CLCA) 6 million years ago (Mya) diverged hairless human and hairy chimpanzee lineages. All primates except humans can carry their babies without using their hands. A hairless mother would be forced to stand and walk upright. Her activities would be markedly limited. The male partner would have to collect food and carry it to her by hand to keep her and their baby from starving; irresponsible and selfish males could not have left their offspring. The mother would have sexually accepted her partner at any time as a reward for food. Sexual relations irrespective of estrus cycles might have strengthened the pair bond. Molecular and paleontological dating indicates that CLCA existed 6 Mya, and early hominin fossils show that they were bipeds, indicating that humanization from CLCA occurred rapidly. A single mutation in animals with scalp hair is known to induce hairless phenotype (ectodermal dysplasia). Bipedalism and hairlessness are disadvantageous traits; only those who could survive trials and tribulations in cooperation with family members must have been able to evolve as humans.

Discrimination of genotoxic and non-genotoxic hepatocarcinogens by statistical analysis based on gene expression profiling in the mouse liver as determined by quantitative real-time PCR.

The general aim of the present study is to discriminate between mouse genotoxic and non-genotoxic hepatocarcinogens via selected gene expression patterns in the liver as analyzed by quantitative real-time PCR (qPCR) and statistical analysis. qPCR was conducted on liver samples from groups of 5 male, 9-week-old B6C3F(1) mice, at 4 and 48h following a single intraperitoneal administration of chemicals. We quantified 35 genes selected from our previous DNA microarray studies using 12 different chemicals: 8 genotoxic hepatocarcinogens (2-acetylaminofluorene, 2,4-diaminotoluene, diisopropanolnitrosamine, 4-dimethylaminoazobenzene, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone, N-nitrosomorpholine, quinoline and urethane) and 4 non-genotoxic hepatocarcinogens (1,4-dichlorobenzene, dichlorodiphenyltrichloroethane, di(2-ethylhexyl)phthalate and furan). A considerable number of genes exhibited significant changes in their gene expression ratios (experimental group/control group) analyzed statistically by the Dunnett's test and Welch's t-test. Finally, we distinguished between the genotoxic and non-genotoxic hepatocarcinogens by statistical analysis using principal component analysis (PCA) of the gene expression profiles for 7 genes (Btg2, Ccnf, Ccng1, Lpr1, Mbd1, Phlda3 and Tubb2c) at 4h and for 12 genes (Aen, Bax, Btg2, Ccnf, Ccng1, Cdkn1a, Gdf15, Lrp1, Mbd1, Phlda3, Plk2 and Tubb2c) at 48h. Seven major biological processes were extracted from the gene ontology analysis: apoptosis, the cell cycle, cell proliferation, DNA damage, DNA repair, oncogenes and tumor suppression. The major, biologically relevant gene pathway suggested was the DNA damage response pathway, resulting from signal transduction by a p53-class mediator leading to the induction of apoptosis. Eight genes (Aen, Bax, Btg2, Ccng1, Cdkn1a, Gdf15, Phlda3 and Plk2) that are directly associated with Trp53 contributed to the PCA. The current findings demonstrate a successful discrimination between genotoxic and non-genotoxic hepatocarcinogens, using qPCR and PCA, on 12 genes associated with a Trp53-mediated signaling pathway for DNA damage response at 4 and 48 h after a single administration of chemicals.

Collaborative Study of Thresholds for Mutagens: Hormetic Responses in Cell Proliferation Tests Using Human and Murine Lymphoid Cells.

BACKGROUND: We previously showed that hormetic responses can be established in cell activity tests using human and murine adherent cells. This time, we examined whether hormetic responses can be established in cell proliferation tests using suspended human and murine lymphoid cells. METHODS: Human lymphoblastoid cells (TK6) and mouse lymphoma cells (L5178Y) were cultured in multi-well culture plates and treated with mitomycin C, ethyl methansulfonate, hygromycin B, aclarubicin or colchicine at various dose levels and the number of cells was measured at varied times using a flow cytometer. RESULTS: When the ratio of the number of cells treated with a test chemical to those in the negative control was plotted, the dose-response relationship typically showed a reverse U-shaped curve, indicating the occurrence of hormesis and existence of thresholds in cell toxicity. The hormetic responses depended largely on the test chemical, dose level and exposure time. When examining responses over the course of time, a J-shaped or fallen S-shaped curve was also observed. CONCLUSIONS: The dose-response relationship showed a reverse U-shaped curve, a hallmark of hormesis, at least some time points for all chemicals tested here, indicating that chemical hormesis can be established in in vitro cell proliferation tests.

Effect of asymmetric terminal structures of short RNA duplexes on the RNA interference activity and strand selection.

Short interfering RNAs (siRNAs) are valuable reagents for sequence-specific inhibition of gene expression via the RNA interference (RNAi) pathway. Although it has been proposed that the relative thermodynamic stability at the 5'-ends of siRNAs plays a crucial role in siRNA strand selection, we demonstrate here that a character of the 2-nt 3'-overhang of siRNAs is the predominant determinant of which strand participates in the RNAi pathway. We show that siRNAs with a unilateral 2-nt 3'-overhang on the antisense strand are more effective than siRNAs with 3'-overhangs at both ends, due to preferential loading of the antisense strand into the RNA-induced silencing complex (RISC). Regardless of the relative thermodynamic stabilities at the ends of siRNAs, overhang-containing strands are predominantly selected as the guide strand; whereas, relative stability markedly influences opposite strand selection. Moreover, we show that sense strand modifications, such as deletions or DNA substitutions, of siRNAs with unilateral overhang on the antisense strand have no negative effect on the antisense strand selection, but may improve RNAi potency. Our findings provide useful guidelines for the design of potent siRNAs and contribute to understanding the crucial factors in determining strand selection in mammalian cells.

Black rain in Hiroshima: a critique to the Life Span Study of A-bomb survivors, basis of the linear no-threshold model.

Ionizing radiation is regulated by the linear no-threshold model (LNT), which asserts that the lowest doses of ionizing radiation are hazardous in proportion to the dose and dose rate. LNT is based on the data of the Life Span Study (LSS) of A-bomb survivors in Hiroshima and Nagasaki. Radiation doses of the survivors were estimated by using initial radiation (5% of blast energy) and residual radiation (10%) was neglected. The major component of residual radiation was fallout, most of which must be brought down to the ground by black rain. The rain was highly radioactive. There are three major black rain maps reporting that black rain covered wide areas of Hiroshima-City. The three lead to an important conclusion that not only A-bomb survivors but also not-in-the-city control subjects (NIC) were irradiated with residual radiation to a greater or lesser degree. This means that exposure doses in LSS were largely underestimated and that use of NIC as the negative control is faulty. Thus, LNT based on LSS is invalid. In addition, LSS ignores radiation hormesis ─ ionizing radiation is not always hazardous, but beneficial depending on doses and dose rates. Indeed, when LSS data of longevity were examined, a clear J-shaped dose-response, a hallmark of radiation hormesis, is apparent. Also, cancer mortality ratios are in the increasing order: NIC (exposed to residual radiation), A-bomb survivors (exposed to both initial and residual radiations), and the Japanese in general (no exposure). Thus, low dose radiation (LDR) is hormetic. Obstinate application of invalid LNT to regulation-unnecessary LDR has been causing tremendous human, social, and economic losses in Fukushima. Also, LNT prevents clinical application of radiation hormesis to age-associated diseases such as Alzheimer's disease and cancers.

Correction to: Low-dose radiation from A-bombs elongated lifespan and reduced cancer mortality relative to un-irradiated individuals.

[This corrects the article DOI: 10.1186/s41021-018-0114-3.].

Low-dose radiation from A-bombs elongated lifespan and reduced cancer mortality relative to un-irradiated individuals.

The US National Academy of Sciences (NAS) presented the linear no-threshold hypothesis (LNT) in 1956, which indicates that the lowest doses of ionizing radiation are hazardous in proportion to the dose. This spurious hypothesis was not based on solid data. NAS put forward the BEIR VII report in 2006 as evidence supporting LNT. The study described in the report used data of the Life Span Study (LSS) of A-bomb survivors. Estimation of exposure doses was based on initial radiation (5%) and neglected residual radiation (10%), leading to underestimation of the doses. Residual radiation mainly consisted of fallout that poured down onto the ground along with black rain. The black-rain-affected areas were wide. Not only A-bomb survivors but also not-in-the-city control subjects (NIC) must have been exposed to residual radiation to a greater or lesser degree. Use of NIC as negative controls constitutes a major failure in analyses of LSS. Another failure of LSS is its neglect of radiation adaptive responses which include low-dose stimulation of DNA damage repair, removal of aberrant cells via stimulated apoptosis, and elimination of cancer cells via stimulated anticancer immunity. LSS never incorporates consideration of this possibility. When LSS data of longevity are examined, a clear J-shaped dose-response, a hallmark of radiation hormesis, is apparent. Both A-bomb survivors and NIC showed longer than average lifespans. Average solid cancer death ratios of both A-bomb survivors and NIC were lower than the average for Japanese people, which is consistent with the occurrence of radiation adaptive responses (the bases for radiation hormesis), essentially invalidating the LNT model. Nevertheless, LNT has served as the basis of radiation regulation policy. If it were not for LNT, tremendous human, social, and economic losses would not have occurred in the aftermath of the Fukushima Daiichi nuclear plant accident. For many reasons, LNT must be revised or abolished, with changes based not on policy but on science.

Collaborative study of thresholds for mutagens: proposal of a typical protocol for detection of hormetic responses in cytotoxicity tests.

BACKGROUND: According to the linear no-threshold model (LNT), even the smallest amount of radiation is hazardous. Although the LNT is not based on solid data, this hypothesis has been applied to mutagens and carcinogens. As a result, it has been postulated that there are no thresholds for these chemicals. To demonstrate negativity by experiments is practically impossible, because negative data may leave behind the possibility that additional data might make the resolution power high enough to change negativity to positivity. Furthermore, additional data collection may be endless and we may be trapped in agnosticism. When hormesis is established, in which biological responses are higher at low-doses and lower at high-doses than the control, thresholds could be established between the low- and high-doses. Before examination of thresholds in chemical mutagenesis, hormetic responses in cytotoxicity were tested using cultured mammalian cells. METHOD: Human cells (HeLa S3 and TK6) or Chinese hamster cells (CHL/IU) were cultured in 96-well plates and treated with mitomycin C (MMC) or ethyl methanesulfonate (EMS) at various dose levels and optical density was measured after addition of a reagent to detect cellular activity. In hormetic responses, data might fluctuate to and fro; therefore, experimental conditions were examined from various aspects to eliminate confounding factors including cell numbers, detection time, the edge effect of 96-well plates, and measurement time after addition of the reagent for detection. RESULTS: The dose response relationship was never linear. Cellular activities after treatment with MMC or EMS were generally higher at lower doses levels and lower at higher doses than the control, showing hormesis and allowing the establishment of thresholds. Dose response curves sometimes showed two or three peaks, probably reflecting different cellular responses. CONCLUSION: Hormetic responses in cytotoxicity tests were observed and thresholds could be established. Based on the results of this investigation, we put forward a tentative protocol to detect chemical hormesis in cytotoxicity tests, i.e., inoculate 2000 cells per well, add various doses of a test chemical 48 h after inoculation, add a detection dye 10 h after treatment, and measure optical density 2 h after addition of the reagent for detection.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

BACKGROUND: Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. RESULTS: Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. CONCLUSION: Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Corticotropin-releasing hormone or dexamethasone regulates rat proopiomelanocortin transcription through Tpit/Pitx-responsive element in its promoter.

Tpit/Pitx-responsive element (Tpit/PitxRE), which binds transcription factors Tpit and Pitx1, confers cell-type specific expression of proopiomelanocortin (POMC) gene in pituitary corticotrops where the gene expression is mainly regulated by corticotropin-releasing hormone (CRH) and glucocorticoids (Gcs). CRH stimulates POMC gene expression, which is mediated by the accumulation of intracellular cAMP and requires binding of Nur factors to Nur-responsive element (NurRE). Gcs antagonize NurRE-dependent POMC gene expression through direct interaction between glucocorticoid receptors and Nur factors. We examined whether Tpit/PitxRE and NurRE are involved in CRH/cAMP-induced activation and Gc-induced repression of POMC gene expression by reporter assay in AtT-20 corticotropic cells. Deletion and mutation of Tpit/PitxRE markedly reduced basal activity of the promoter, and those of NurRE decreased the levels of the CRH/cAMP-induced activation. Nifedipine, KN-62, and W-7, specific inhibitors of the L-type calcium channel, calmodulin-dependent protein kinase II, and calmodulin respectively, attenuated CRH/cAMP-induced activation of promoters with three copies of either Tpit/PitxRE or NurRE, indicating that both Tpit/PitxRE and NurRE mediate CRH-induced activation of POMC gene expression in a calcium-dependent manner. Deletion and mutation of Tpit/PitxRE abolished dexamethasone (DEX)-induced repression of POMC gene expression, while those of NurRE did not, indicating that Tpit/PitxRE predominantly mediates Gc-induced repression of POMC transcription. However, DEX treatment attenuated activities of promoters with three copies of either Tpit/PitxRE or NurRE, suggesting that Gcs act at NurRE as well as Tpit/PitxRE to repress POMC gene expression. We conclude that Tpit/PitxRE is an important element by which CRH and Gcs regulate the POMC gene expression.

The 10th anniversary of the publication of genes and environment: memoir of establishing the Japanese environmental mutagen society and a proposal for a new collaborative study on mutagenic hormesis.

The Japanese Environmental Mutagen Society (JEMS) was established in 1972 by 147 members, 11 of whom are still on the active list as of May 1, 2016. As one of them, I introduce some historic topics here. These include 1) establishment of JEMS, 2) the issue of 2-(2-furyl)-3-(3-nitro-2-furyl)acrylamide (AF-2), 3) the Mammalian Mutagenicity Study Group (MMS) and its achievements, and 4) the Collaborative Study Group of the Micronucleus Test (CSGMT) and its achievements. In addition to these historic matters, some of which are still ongoing, a new collaborative study is proposed on adaptive response or hormesis by mutagens. There is a close relationship between mutagens and carcinogens, the dose-response relationship of which has been thought to follow the linear no-threshold model (LNT). LNT was fabricated on the basis of Drosophila sperm experiments using high dose radiation delivered in a short period. The fallacious 60 years-old LNT is applied to cancer induction by radiation without solid data and then to cancer induction by carcinogens also without solid data. Therefore, even the smallest amount of carcinogens is postulated to be carcinogenic without thresholds now. Radiation hormesis is observed in a large variety of living organisms; radiation is beneficial at low doses, but hazardous at high doses. There is a threshold at the boundary between benefit and hazard. Hormesis denies LNT. Not a few papers report existence of chemical hormesis. If mutagens and carcinogens show hormesis, the linear dose-response relationship in mutagenesis and carcinogenesis is denied and thresholds can be introduced.

Rediscovery of an old article reporting that the area around the epicenter in Hiroshima was heavily contaminated with residual radiation, indicating that exposure doses of A-bomb survivors were largely underestimated.

The A-bomb blast released a huge amount of energy: thermal radiation (35%), blast energy (50%), and nuclear radiation (15%). Of the 15%, 5% was initial radiation released within 30 s and 10% was residual radiation, the majority of which was fallout. Exposure doses of hibakusha (A-bomb survivors) were estimated solely on the basis of the initial radiation. The effects of the residual radiation on hibakusha have been considered controversial; some groups assert that the residual radiation was negligible, but others refute that assertion. I recently discovered a six-decade-old article written in Japanese by a medical doctor, Gensaku Obo, from Hiroshima City. This article clearly indicates that the area around the epicenter in Hiroshima was heavily contaminated with residual radiation. It reports that non-hibakusha who entered Hiroshima soon after the blast suffered from severe acute radiation sickness, including burns, external injuries, fever, diarrhea, skin bleeding, sore throat and loss of hair-as if they were real hibakusha. This means that (i) some of those who entered Hiroshima in the early days after the blast could be regarded as indirect hibakusha; (ii) 'in-the-city-control' people in the Life Span Study (LSS) must have been irradiated more or less from residual radiation and could not function properly as the negative control; (iii) exposure doses of hibakusha were largely underestimated; and (iv) cancer risk in the LSS was largely overestimated. Obo's article is very important to understand the health effects of A-bombs so that the essence of it is translated from Japanese to English with the permission of the publisher.

Chicken LRH-1 gene is transcribed from multiple promoters in steroidogenic organs.

Liver receptor homolog-1 (LRH-1) is a homolog of FTZ-F1, a transcription factor of the fruit fly, and belongs to the orphan nuclear receptor family. LRH-1 is expressed in organs derived from the endoderm, including intestine, liver and exocrine pancreas and plays a predominant role in development, bile-acid homeostasis, and reverse cholesterol transport. Recent research has revealed that mammalian LRH-1 is also expressed in the steroidogenic organs and has suggested that LRH-1 shares a role in steroidogenesis with steroidogenic factor-1 (SF-1), which is a paralog of LRH-1. In this study, we determined transcription initiation sites of chicken LRH-1 and showed that LRH-1 is expressed as several splicing variants in chicken steroidogenic organs. From three steroidogenic organs, the adrenal glands, ovaries, and testes, several cDNA fragments including different lengths and sequences were amplified by 5'-RACE and these were mainly classified into five types. Using these sequences, chicken genomic database was searched and four types of first exons were identified in chromosome 8. However, the database sequence of these regions included several gaps. So we cloned gap regions by PCR cloning from chicken genomic DNA and found the other type of first exons in the gaps. Moreover, RT-PCR showed the expression of LRH-1 in chicken steroidogenic organs as many splicing variants. We concluded that the chicken LRH-1 gene is transcribed from at least five different transcription initiation sites and alternative splicing produces several types of mRNA in steroidogenic organs.

A message to Fukushima: nothing to fear but fear itself.

INTRODUCTION: The linear no-threshold model (LNT) has been the basis for radiation protection policies worldwide for 60 years. LNT was fabricated without correct data. The lifespan study of Atomic bomb survivors (LSS) has provided fundamental data to support the NLT. In LSS, exposure doses were underestimated and cancer risk was overestimated; LSS data do not support LNT anymore. In light of these findings, radiation levels and cancer risk in Fukushima are reexamined. RESULTS: Soon after the Fukushima accident, the International Commission on Radiological Protection issued an emergency recommendation that national authorities set reference highest levels in the band of 20-100 mSv and, when the radiation source is under control, reference levels are in the band of 1-20 mSv/y. The Japanese government set the limit dose as low as 1 mSv for the public and stirred up radiophobia, which continues to cause tremendous human, social, and economic losses. Estimated doses in three areas of Fukushima were 0.6-2.3 mSv/y in Tamura City, 1.1-5.5 mSv/y in Kawauchi Village, and 3.8-17 mSv/y in Iitate Village. Since even after acute irradiation, no significant differences are found below 200 mSv for leukemia and below 100 mSv for solid cancers. These data indicate that cancer risk is negligible in Fukushima. Moreover, beneficial effects (lessened cancer incidence) were observed at 400-600 mSv in LSS. Living organisms, which have established efficient defense mechanisms against radiation through 3.8 billion years of evolutionary history, can tolerate 1000 mSv/y if radiation dose rates are low. In fact, people have lived for generations without adverse health effects in high background radiation areas such as Kelara (35 mSv/y), India, and Ramsar (260 mSv/y), Iran. Low dose radiation itself is harmless, but fear of radiation is vitally harmful. CONCLUSIONS: When people return to the evacuation zones in Fukushima now and in the future, they will be exposed to such low radiation doses as to cause no physical effects. The most threatening public health issue is the adverse effect on mental health caused by undue fear of radiation.

[Tremendous Human, Social, and Economic Losses Caused by Obstinate Application of the Failed Linear No-threshold Model].

The linear no-threshold model (LNT) was recommended in 1956, with abandonment of the traditional threshold dose-response for genetic risk assessment. Adoption of LNT by the International Commission on Radiological Protection (ICRP) became the standard for radiation regulation worldwide. The ICRP recommends a dose limit of 1 mSv/year for the public, which is too low and which terrorizes innocent people. Indeed, LNT arose mainly from the lifespan survivor study (LSS) of atomic bomb survivors. The LSS, which asserts linear dose-response and no threshold, is challenged mainly on three points. 1) Radiation doses were underestimated by half because of disregard for major residual radiation, resulting in cancer risk overestimation. 2) The dose and dose-rate effectiveness factor (DDREF) of 2 is used, but the actual DDREF is estimated as 16, resulting in cancer risk overestimation by several times. 3) Adaptive response (hormesis) is observed in leukemia and solid cancer cases, consistently contradicting the linearity of LNT. Drastic reduction of cancer risk moves the dose-response curve close to the control line, allowing the setting of a threshold. Living organisms have been evolving for 3.8 billion years under radiation exposure, naturally acquiring various defense mechanisms such as DNA repair mechanisms, apoptosis, and immune response. The failure of LNT lies in the neglect of carcinogenesis and these biological mechanisms. Obstinate application of LNT continues to cause tremendous human, social, and economic losses. The 60-year-old LNT must be rejected to establish a new scientific knowledge-based system.

Peas-Mea1-Ppp2r5d overlapping gene complex: a transposon mediated-gene formation in mammals.

Human and mouse MEA1/Mea1 is flanked by two overlapping genes, a novel PEAS/Peas in a head-to-head orientation and PPP2R5D/Ppp2r5d in a tail-to-tail orientation making a Peas-Mea1-Ppp2r5d overlapping gene complex (PMP-complex). Genomic zoo blot analyses and database searching revealed that Mea1 exists only in mammals, while Peas and Ppp2r5d are conserved in eukaryotes. Mea1 and Peas are transcribed from a testis-expressed bidirectional promoter. Mea1-Ppp2r5d overlapping segment (MPOS) contains polyadenylation signals for both genes and shows marked conservation throughout mammals. Furthermore, the MPOS occupies 3'-region of transcripts of both genes is expected to form a clover-like intramolecular structure. Mouse genomic library Screening and database searches identified two MPOS-derived sequences in Odf2 gene and RP23-86H7 cosmid clone, respectively, in which MPOS might be a core segment for the retropositions. Thus, a key role of MPOS, a short transposable element containing polyadenylation signals on both strands, in the formation of the Mea1 during mammalian evolution is suggested.

A novel testis-specific RAG2-like protein, Peas: its expression in pachytene spermatocyte cytoplasm and meiotic chromatin.

We report a novel gene Peas that constitutes an overlapping gene complex in mammalian genome. We have cloned human and mouse Peas cDNAs (hPEAS/mPeas) and analyzed their tissue and stage-specific expressions. Peas protein contains six repeated kelch motifs, structurally similar to RAG2, a V(D)J recombination activator, and is evolutionarily conserved among mammals, birds, insects, and nematodes. Northern, RNA in situ hybridization and immunohistochemical analyses showed that mPeas is specifically transcribed in testis, particularly in pachytene spermatocytes in which it is localized to the cytoplasm and meiotic chromatin. It is suggested that Peas may be involved in meiotic recombination process.

Co-localization of Trax and Mea2 in Golgi complex of pachytene spermatocytes in the mouse.

A golgin family protein, Mea2, is expressed at enhanced level in pachytene spermatocytes and is indispensable for mouse spermatogenesis. Because Trax was shown to interact with Mea2 in yeast two-hybrid, we investigated the localization of Trax in pachytene spermatocytes with immunofluorescent staining. Trax was found to accumulate in the Golgi complex of mid-late pachytene spermatocytes and intermingled with granular Mea2 signal in the central region. In a subline of the Mea2 mutant mouse, a truncated form of Mea2 devoid of the N-terminal region, DeltaMea2, was expressed. It localized to the rim of Golgi complex and thus occupied a region separate from that of Trax.