Nearest-neighbor parameters for the prediction of RNA duplex stability in diverse in vitro and cellular-like crowding conditions.

RNA performs various spatiotemporal functions in living cells. As the solution environments significantly affect the stability of RNA duplexes, a stability prediction of the RNA duplexes in diverse crowded conditions is required to understand and modulate gene expression in heterogeneously crowded intracellular conditions. Herein, we determined the nearest-neighbor (NN) parameters for RNA duplex formation when subjected to crowding conditions with an ionic concentration relevant to that found in cells. Determination of the individual contributions of excluded volume effect and water activity to each of the NN parameters in crowded environments enabled prediction of the thermodynamic parameters and their melting temperatures for plenty of tested RNA duplex formation in vitro and in cell with significant accuracy. The parameters reported herein will help predicting RNA duplex stability in different crowded environments, which will lead to an improved understanding of the stability-function relationship for RNAs in various cellular organelles with different molecular environments.

Diastolic Dysfunction as a Positive Predictor of Recurrent Vascular Events in Patients With Noncardioembolic Stroke.

BACKGROUND: This study aimed to assess the effects of left ventricular diastolic dysfunction (LVDD) on vascular outcomes among patients with stroke of noncardioembolic origins. METHODS: This prospective observational study enrolled 563 patients with noncardioembolic stroke (mean age, 67.9 years; 66.7% men and 33.3% women individuals) registered in the Tokyo Women's Medical University Stroke Registry between 2013 and 2020. Then, patients were divided into the LVDD and non-LVDD groups. The primary outcome was a composite of major adverse cardiovascular events, including nonfatal stroke, nonfatal acute coronary syndrome, and vascular death 1 year after stroke onset. The effect of LVDD on vascular events was assessed using multivariable Cox regression analyses. RESULTS: A total of 130 (23.1%) patients had any grade of LVDD, and patients with LVDD had a higher risk of major adverse cardiovascular event at 1 year than those without LVDD (annual rate, 20.9% versus 10.8%; log-rank P=0.001). The multivariable Cox proportional hazards regression model demonstrated that the presence of LVDD was independently associated with the major adverse cardiovascular event risk (hazard ratio, 1.79 [95% CI, 1.02-3.12]; P=0.019). Furthermore, the LVDD grade was proportional to the risk of major adverse cardiovascular events and recurrent stroke. CONCLUSIONS: LVDD may be associated with further vascular events after a noncardioembolic stroke, suggesting the importance of LVDD evaluations in risk stratification and secondary prevention in patients with noncardioembolic stroke. REGISTRATION: URL: https://upload.umin.ac.jp; Unique identifier: UMIN000031913.

Development of a Pseudocellular System to Quantify Specific Interactions Determining the G-Quadruplex Function in Cells.

Intracellular chemical microenvironments, including ion concentrations and molecular crowding, play pivotal roles in cell behaviors, such as proliferation, differentiation, and cell death via regulation of gene expression. However, there is no method for quantitative analysis of intracellular environments due to their complexity. Here, we have developed a system for highlighting the environment inside of the cell (SHELL). SHELL is a pseudocellular system, wherein small molecules are removed from the cell and a crowded intracellular environment is maintained. SHELL offers two prominent advantages: (1) It allows for precise quantitative biochemical analysis of a specific factor, and (2) it enables the study of any cell, thereby facilitating the study of target molecule effects in various cellular environments. Here, we used SHELL to study G-quadruplex formation, an event that implicated cancer. We show that G-quadruplexes are more stable in SHELL compared with in vitro conditions. Although malignant transformation perturbs cellular K+ concentrations, environments in SHELL act as buffers against G-quadruplex destabilization at lower K+ concentrations. Notably, the buffering effect was most pronounced in SHELL derived from nonaggressive cancer cells. Stable G-quadruplexes form due to the binding of the G-quadruplex with K+ in different cancer cells. Furthermore, the observed pattern of G-quadruplex-induced transcriptional inhibition in SHELL is consistent with that in living cells at different cancer stages. Our results indicate that ion binding to G-quadruplexes regulates gene expression during pathogenesis.

Engineering exosome polymer hybrids by atom transfer radical polymerization.

Exosomes are emerging as ideal drug delivery vehicles due to their biological origin and ability to transfer cargo between cells. However, rapid clearance of exogenous exosomes from the circulation as well as aggregation of exosomes and shedding of surface proteins during storage limit their clinical translation. Here, we demonstrate highly controlled and reversible functionalization of exosome surfaces with well-defined polymers that modulate the exosome's physiochemical and pharmacokinetic properties. Using cholesterol-modified DNA tethers and complementary DNA block copolymers, exosome surfaces were engineered with different biocompatible polymers. Additionally, polymers were directly grafted from the exosome surface using biocompatible photo-mediated atom transfer radical polymerization (ATRP). These exosome polymer hybrids (EPHs) exhibited enhanced stability under various storage conditions and in the presence of proteolytic enzymes. Tuning of the polymer length and surface loading allowed precise control over exosome surface interactions, cellular uptake, and preserved bioactivity. EPHs show fourfold higher blood circulation time without altering tissue distribution profiles. Our results highlight the potential of precise nanoengineering of exosomes toward developing advanced drug and therapeutic delivery systems using modern ATRP methods.

In-Cell Stability Prediction of RNA/DNA Hybrid Duplexes for Designing Oligonucleotides Aimed at Therapeutics.

In cells, the formation of RNA/DNA hybrid duplexes regulates gene expression and modification. The environment inside cellular organelles is heterogeneously crowded with high concentrations of biomolecules that affect the structure and stability of RNA/DNA hybrid duplexes. However, the detailed environmental effects remain unclear. Therefore, the mechanistic details of the effect of such molecular crowding were investigated at the molecular level by using thermodynamic and nuclear magnetic resonance analyses, revealing structure-dependent destabilization of the duplexes under crowded conditions. The transition from B- to A-like hybrid duplexes due to a change in conformation of the DNA strand guided by purine-pyrimidine asymmetry significantly increased the hydration number, which resulted in greater destabilization by the addition of cosolutes. By quantifying the individual contributions of environmental factors and the bulk structure of the duplex, we developed a set of parameters that predict the stability of hybrid duplexes with conformational dissimilarities under diverse crowding conditions. A comparison of the effects of environmental conditions in living cells and in vitro crowded solutions on hybrid duplex formation using the Förster resonance energy transfer technique established the applicability of our parameters to living cells. Moreover, our derived parameters can be used to estimate the efficiency of transcriptional inhibition, genome editing, and silencing techniques in cells. This supports the usefulness of our parameters for the visualization of cellular mechanisms of gene expression and the development of nucleic acid-based therapeutics targeting different cells.

Five Novel Silver-Based Coordination Polymers as Photoluminescent Sensing Platforms for the Detection of Nitrobenzene.

Nitrobenzene (NB) is a highly toxic chemical and a cause for concern to human health and the environment. Hence, it is worth designing new efficient and robust sensing platforms for NB. In this study, we present three newly synthesized luminescent silver cluster-based coordination polymers, {[Ag10 (StBu)6 (CF3 COO)4 (hpbt)] (DMAc)2 (CH3 CN)2 }n (hpbt=N,N,N',N'N",N"-hexa(pyridine-4-yl)benzene-1,3,5-triamine), [Ag12 (StBu)6 (CF3 COO)6 (bpva)3 ]n (bpva=9,10-Bis(2-(pyridin-4-yl)vinyl)anthracene), and {[Ag12 (StBu)6 (CF3 COO)6 (bpb)(DMAc)2 (H2 O)2 ] (DMAc)2 }n (bpb=1,4-Bis(4-pyridyl)benzene) composed of Ag10 , Ag12 and Ag12 cluster cores, respectively, connected by multidentate pyridine linkers. In addition, two new luminescent polymorphic silver(I)-based coordination polymers, [Ag(CF3 COO)(dpa)]n (dpa=9,10-di(4-pyridyl)anthracene) referred to as Agdpa (H) and Agdpa (R), where H and R denote hexagon- and rod-like crystal shapes, respectively, have been prepared. The coordination polymers exhibit highly sensitive luminescence quenching effects to NB, attributed to the π-π stacking interactions between the polymers and NB as well as the electron-withdrawing character of NB.

Long-Term Outcome in Patients With Acute Ischemic Stroke and Heart Failure.

BACKGROUND: This study aimed to identify the association between long term functional outcomes and acute ischemic stroke (AIS) in patients with heart failure (HF) in Japan and whether 1-year event risks can be related to these patients.Methods and Results: This was a prospective observational study, and 651 patients registered in the Tokyo Women's Medical University Stroke Registry were classified into the HF and non-HF groups. Functional outcome at 1 year after stroke onset was defined as either good (modified Rankin Scale [mRS] score of 0-2) or poor (mRS score of 3-6). The primary outcome was a composite of major adverse cardiovascular events (MACE), including non-fatal stroke, non-fatal acute coronary syndrome, and vascular death. Patients with HF had a higher poor functional outcome rate at 1 year than those without HF (54.7% vs. 28.2%, P<0.001). Multivariate logistic regression analysis also demonstrated the prevalence of HF was an independent predictor of an mRS score of ≥3 at 1 year after stroke onset (odds ratio, 1.05; 95% confidence interval, 1.00-1.10; P=0.036). Furthermore, patients with HF tended to have a higher risk of MACE and all-cause mortality than those without HF. CONCLUSIONS: AIS patients with HF were associated with poor functional outcome at the 1-year follow up. Further multicenter studies involving a larger number of patients are warranted to verify these results.

Nearest-neighbor parameters for predicting DNA duplex stability in diverse molecular crowding conditions.

The intracellular environment is crowded and heterogeneous. Although the thermodynamic stability of nucleic acid duplexes is predictable in dilute solutions, methods of predicting such stability under specific intracellular conditions are not yet available. We recently showed that the nearest-neighbor model for self-complementary DNA is valid under molecular crowding condition of 40% polyethylene glycol with an average molecular weight of 200 (PEG 200) in 100 mM NaCl. Here, we determined nearest-neighbor parameters for DNA duplex formation under the same crowding condition to predict the thermodynamics of DNA duplexes in the intracellular environment. Preferential hydration of the nucleotides was found to be the key factor for nearest-neighbor parameters in the crowding condition. The determined parameters were shown to predict the thermodynamic parameters (∆H°, ∆S°, and ∆G°37) and melting temperatures (Tm) of the DNA duplexes in the crowding condition with significant accuracy. Moreover, we proposed a general method for predicting the stability of short DNA duplexes in different cosolutes based on the relationship between duplex stability and the water activity of the cosolute solution. The method described herein would be valuable for investigating biological processes that occur under specific intracellular crowded conditions and for the application of DNA-based biotechnologies in crowded environments.

Atherogenic Dyslipidemia and Residual Vascular Risk After Stroke or Transient Ischemic Attack.

BACKGROUND AND PURPOSE: Notwithstanding the current guideline-based management, patients with stroke retain a substantial risk of further vascular events. We aimed to assess the contribution of atherogenic dyslipidemia (AD) to this residual risk. METHODS: This was a prospective observational study, in which 792 patients (mean age, 70.1 years; male, 60.2%) with acute ischemic stroke (n=710) or transient ischemic attack (n=82) within 1 week of onset were consecutively enrolled and followed for 1 year. AD was defined as having both elevated levels of triglycerides ≥150 mg/dL and low HDL-C (high-density lipoprotein cholesterol) <40 mg/dL in men or <50 mg/dL in women, under fasting conditions. The primary outcome was a composite of major adverse cardiovascular events, including nonfatal stroke, nonfatal acute coronary syndrome, and vascular death. RESULTS: The prevalence of AD was 12.2%. Patients with AD more often had intracranial artery stenosis than those without (42.3% versus 24.1%; P=0.004), whereas no differences were observed in the prevalence of extracranial artery stenosis (17.7% versus 12.9%; P=0.62) or aortic plaques (33.3% versus 27.0%; P=0.87). At 1 year, patients with AD were at a greater risk of major adverse cardiovascular events (annual rate, 24.5% versus 10.6%; hazard ratio [95% CI], 2.33 [1.44-3.80]) and ischemic stroke (annual rate, 16.8% versus 8.6%; hazard ratio [95% CI], 1.84 [1.04-3.26]) than those without AD. When patients were stratified according to baseline LDL-C (low-density lipoprotein cholesterol) level, AD was predictive of major adverse cardiovascular events among those with LDL-C ≥100 mg/dL (n=509; annual rate, 20.5% versus 9.6%; P=0.036) as well as those with LDL-C <100 mg/dL (n=283; annual rate, 38.6% versus 12.4%; P<0.001). CONCLUSIONS: AD is associated with intracranial artery atherosclerosis and a high residual vascular risk after a stroke or transient ischemic attack. AD should be a promising modifiable target for secondary stroke prevention. Registration: URL: https://upload.umin.ac.jp; Unique identifier: UMIN000031913.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Volumetric Strategy for Quantitatively Elucidating a Local Hydration Network around a G-Quadruplex.

Hydration around nucleic acids, such as DNA and RNA, is an important factor not only for the stability of nucleic acids but also for their interaction with binding molecules. Thus, it is necessary to quantitatively elucidate the hydration properties of nucleic acids around a certain structure. In this study, volumetric changes in G-quadruplex (G4) RNA formation were investigated by systematically changing the number of G-quartet stacks under high pressure. The volumetric contribution at the level of each G4 structural unit revealed that the core G4 helix was significantly more dehydrated than the other parts, including the edges of G-quartets and loops. These findings will help in predicting the binding of G4 ligands on the surface of G4, depending on the chemical structure of the ligand and solution environment. Therefore, the preset volumetric parameter provides information that can predict molecular interactions in G4 formations during molecular crowding in cells.

Watson-Crick versus Hoogsteen Base Pairs: Chemical Strategy to Encode and Express Genetic Information in Life.

Nucleic acids typically form a double helix structure through Watson-Crick base-pairing. In contrast, non-Watson-Crick base pairs can form other three-dimensional structures. Although it is well-known that Watson-Crick base pairs may be more unstable than non-Watson-Crick base pairs under some conditions, the importance of non-Watson-Crick base pairs has not been widely examined. Hoogsteen base pairs, the non-Watson-Crick base pairs, contain important hydrogen-bond patterns that form the helices of nucleic acids, such as in Watson-Crick base pairs, and can form non-double helix structures such as triplexes and quadruplexes. In recent years, non-double helix structures have been discovered in cells and were reported to considerably influence gene expression. The complex behavior of these nucleic acids in cells is gradually being revealed, but the underlying mechanisms remain almost unknown.Quantitatively analyzing the structural stability of nucleic acids is important for understanding their behavior. A nucleic acid is an anionic biopolymer composed of a sugar, base, and phosphoric acid. The physicochemical factors that determine the stability of nucleic acid structures include those derived from the interactions of nucleic acid structures and those derived from the environments surrounding nucleic acids. The Gibbs free energy change (ΔG) of structure formation is the most commonly used physicochemical parameter for analyzing quantitative stability. Quantitatively understanding the intracellular behavior of nucleic acids involves describing the formation of nucleic acid structures and related reactions as ΔG. Based on this concept, we quantitatively analyzed the stability of double helix and non-double helix structures and found that decreased water activity, an important factor in crowded cellular conditions, significantly destabilize the formation of Watson-Crick base pairs but stabilizes Hoogsteen base pairs.Here, we describe a physicochemical approach to understand the regulation of gene expressions based on the stability of nucleic acid structures. We developed new methods for predicting the stability of double and non-double helices in various molecular environments by mimicking intracellular environments. Furthermore, the physicochemical approach used for analyzing gene expression regulated by non-double helix structures is useful for not only determining how gene expression is controlled by cellular environments but also for developing new technologies to chemically regulate gene expression by targeting non-double helix structures. We discuss the roles of Watson-Crick and Hoogsteen base pairs in cells based on our results and why both types of base pairing are required for life. Finally, a new concept in nucleic acid science beyond that of Watson and Crick base pairing is introduced.

Triglyceride-glucose index as a prognostic marker after ischemic stroke or transient ischemic attack: a prospective observational study.

BACKGROUND: Triglyceride-glucose (TyG) index has been proposed as a simple and credible surrogate for insulin resistance and an independent predictor of cardiovascular outcomes. Due to lack of data on TyG index in stroke, we aimed to evaluate the predictive value of the index for recurrent vascular event risk among stroke patients. METHODS: This was a prospective observational study, in which 866 patients (mean age, 70.1 years; male, 60.9%) with ischemic stroke (n = 781) or transient ischemic attack (n = 85) within 1 week of onset were consecutively enrolled and followed up for 1 year. The TyG index was calculated as ln (fasting triglycerides [mg/dL] × fasting glucose [mg/dL]/2). Patients were divided into 3 groups according to the tertile of TyG index levels: tertile 1, < 8.48; tertile 2, 8.48-9.01; and tertile 3, > 9.01. The primary outcome was a composite of major adverse cardiovascular events (MACE), including nonfatal stroke, nonfatal acute coronary syndrome, and vascular death. RESULTS: The median TyG index was 8.74 (interquartile range, 8.34-9.16). Higher levels of TyG index were significantly associated with increased prevalence of ipsilateral extracranial carotid (P = 0.032) and intracranial (P = 0.003) atherosclerotic stenosis. There were significant differences in the MACE risk between the three groups (annual rate, 8.6%, 11.6%, and 17.3% in the tertile 1, tertile 2, tertile 3 groups, respectively; log-rank P = 0.005). After multivariable adjustments, the TyG index remains to be a significant predictor of MACE, with an adjusted hazard ratio for tertile 3 versus tertile 1 groups (95% confidence interval) of 2.01 (1.16-3.47). Similar results were also found for the risk of recurrent stroke. CONCLUSIONS: TyG index is associated with cervicocerebral atherosclerosis and the MACE risk after a stroke, suggesting the potential value of TyG index to optimize the risk stratification of stroke patients. Trial registration URL:  https://upload.umin.ac.jp . Unique identifier: UMIN000031913.

Thrombin binding aptamer G-quadruplex stabilized by pyrene-modified nucleotides.

Guanine-rich regions of the human genome can adopt non-canonical secondary structures. Their role in regulating gene expression has turned them into promising targets for therapeutic intervention. Ligands based on polyaromatic moieties are especially suitable for targeting G-quadruplexes utilizing their size complementarity to interact with the large exposed surface area of four guanine bases. A predictable way of (de)stabilizing specific G-quadruplex structures through efficient base stacking of polyaromatic functional groups could become a valuable tool in our therapeutic arsenal. We have investigated the effect of pyrene-modified uridine nucleotides incorporated at several positions of the thrombin binding aptamer (TBA) as a model system. Characterization using spectroscopic and biophysical methods provided important insights into modes of interaction between pyrene groups and the G-quadruplex core as well as (de)stabilization by enthalpic and entropic contributions. NMR data demonstrated that incorporation of pyrene group into G-rich oligonucleotide such as TBA may result in significant changes in 3D structure such as formation of novel dimeric topology. Site specific structural changes induced by stacking of the pyrene moiety on nearby nucleobases corelate with distinct thrombin binding affinities and increased resistance against nuclease degradation.

Improved nearest-neighbor parameters for the stability of RNA/DNA hybrids under a physiological condition.

The stability of Watson-Crick paired RNA/DNA hybrids is important for designing optimal oligonucleotides for ASO (Antisense Oligonucleotide) and CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas9 techniques. Previous nearest-neighbour (NN) parameters for predicting hybrid stability in a 1 M NaCl solution, however, may not be applicable for predicting stability at salt concentrations closer to physiological condition (e.g. ∼100 mM Na+ or K+ in the presence or absence of Mg2+). Herein, we report measured thermodynamic parameters of 38 RNA/DNA hybrids at 100 mM NaCl and derive new NN parameters to predict duplex stability. Predicted ΔG°37 and Tm values based on the established NN parameters agreed well with the measured values with 2.9% and 1.1°C deviations, respectively. The new results can also be used to make precise predictions for duplexes formed in 100 mM KCl or 100 mM NaCl in the presence of 1 mM Mg2+, which can mimic an intracellular and extracellular salt condition, respectively. Comparisons of the predicted thermodynamic parameters with published data using ASO and CRISPR-Cas9 may allow designing shorter oligonucleotides for these techniques that will diminish the probability of non-specific binding and also improve the efficiency of target gene regulation.

Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding.

Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topology-dependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.

Validation of the nearest-neighbor model for Watson-Crick self-complementary DNA duplexes in molecular crowding condition.

Recent advancement in nucleic acid techniques inside cells demands the knowledge of the stability of nucleic acid structures in molecular crowding. The nearest-neighbor model has been successfully used to predict thermodynamic parameters for the formation of nucleic acid duplexes, with significant accuracy in a dilute solution. However, knowledge about the applicability of the model in molecular crowding is still limited. To determine and predict the stabilities of DNA duplexes in a cell-like crowded environment, we systematically investigated the validity of the nearest-neighbor model for Watson-Crick self-complementary DNA duplexes in molecular crowding. The thermodynamic parameters for the duplex formation were measured in the presence of 40 wt% poly(ethylene glycol)200 for different self-complementary DNA oligonucleotides consisting of identical nearest-neighbors in a physiological buffer containing 0.1 M NaCl. The thermodynamic parameters as well as the melting temperatures (Tm) obtained from the UV melting studies revealed similar values for the oligonucleotides having identical nearest-neighbors, suggesting the validity of the nearest-neighbor model in the crowding condition. Linear relationships between the measured ΔG°37 and Tm in crowding condition and those predicted in dilute solutions allowed us to predict ΔG°37, Tm and nearest-neighbor parameters in molecular crowding using existing parameters in the dilute condition, which provides useful information about the thermostability of the self-complementary DNA duplexes in molecular crowding.

Stability prediction of canonical and non-canonical structures of nucleic acids in various molecular environments and cells.

Nucleic acids (DNA and RNA) dynamically fold and unfold to exert their functions in cells. These folding and unfolding behaviours are also the basis for various technical applications. To understand the biological mechanism of nucleic acid function, and design active materials using nucleic acids, biophysical approaches based on thermodynamics are very useful. Methods for predicting the stability of canonical duplexes of nucleic acids have been extensively investigated for more than half a century and are now widely used. However, such predictions are not always accurate under various solution conditions, particularly cellular conditions, as the concentrations of cations and cosolutes under intracellular conditions, named as molecular crowding, differ from those under standard experimental conditions. Moreover, the crowding condition in cells is spatiotemporally variable. Furthermore, non-canonical structures such as triplex and tetraplex exist in cells and play important roles in gene expression. Therefore, a prediction method reflecting the cellular conditions must be established to determine the stability of various nuclei acid structures. This article reviews the biophysicochemical background of predicting nucleic acid stability and recent advances in the prediction of this stability under cellular conditions.

Effect of Molecular Crowding on the Stability of RNA G-Quadruplexes with Various Numbers of Quartets and Lengths of Loops.

G-Quadruplexes are noncanonical structures formed by guanine-rich regions of not only DNA but also RNA. RNA G-quadruplexes are widely present in the transcriptome as mRNAs and noncoding RNAs and take part in various essential functions in cells. Furthermore, stable RNA G-quadruplexes control the extent of biological functions, such as mRNA translation and antigen presentation. To understand and regulate the functions controlled by RNA G-quadruplexes in cellular environments, which are molecularly crowded, we would be required to investigate the stability of G-quadruplexes in molecular crowding. Here, we systematically investigated the thermodynamic stability of RNA G-quadruplexes with different numbers of G-quartets and lengths of loops. The molecular crowding conditions of polyethylene glycol with an average molecular weight of 200 (PEG200) were found to stabilize RNA G-quadruplexes with three and four G-quartets, while G-quadruplexes with two G-quartets did not exhibit any stabilization upon addition of PEG200. On the other hand, no difference in stabilization by PEG200 was observed among the G-quadruplexes with different loop lengths. Thermodynamic analysis of the RNA G-quadruplexes revealed more appropriate motifs for identifying G-quadruplex-forming sequences. The informatics analysis with new motifs demonstrated that the distributions of G-quadruplexes in human noncoding RNAs differed depending on the number of G-quartets. Therefore, RNA G-quadruplexes with different numbers of G-quartets may play different roles in response to environmental changes in cells.

Model building analysis - a novel method for statistical evaluation of Pt L3-edge EXAFS data to unravel the structure of Pt-alloy nanoparticles for the oxygen reduction reaction on highly oriented pyrolytic graphite.

Extended X-ray absorption fine structure (EXAFS) is a powerful tool to determine the local structure in Pt nanoparticles (NP) on carbon supports, active catalysts for fuel cells. Highly oriented pyrolytic graphite (HOPG) covered with Pt NP gives samples with flat surfaces that allow application of surface science techniques. However, the low concentration of Pt makes it difficult to obtain good quality EXAFS data. We have performed in situ highly sensitive BCLA-empowered Back Illuminated EXAFS (BCLA + BI-EXAFS) measurements on Pt alloy nanoparticles. We obtained high quality Pt L3-edge data. We have devised a novel analytical method (model building analysis) to determine the structure of multi-component nanoparticles from just a single absorption edge. The generation of large numbers of structural models and their comparison with EXAFS fits allows us to determine the structures of Pt-containing nanoparticles, catalysts for the oxygen reduction reaction. Our results show that PtCo, PtCoN and AuPtCoN form a Pt-shell during electrochemical dealloying and that the ORR activity is directly proportional to the Pt-Pt bond length.