Homeotic DUX4 Genes Shape Dynamic Inter-Chromosomal Contacts with Nucleoli in Human Cells.

Nucleoli form interchromosomal contacts with genes controlling differentiation and carcinogenesis. DUX4 genes specify transcription factor possessing two homeodomains. Previously, using Circular Chromosome Conformation Capture (4С) approach on population of cells, it was demonstrated that DUX4 gene clusters form frequent contacts with nucleoli. It was found also that these contacts are almost completely abolished after heat shock treatment. 4C approach as all ligation-mediated methods is capable to detect rather close interactions between chromatin loops in nuclei. In order to independently confirm the formation and the frequency of the contacts in single cells we used FISH approach. Here, we show that DUX genes in single cells form stable contacts in all tested HEK293T cells. During heat shock, DUX4 genes reversibly move 1-3 µm away from the nuclei. We conclude that interchromosomal contacts formed by nucleoli are strong, dynamic, and reversible, providing both the initiation and maintenance of a differentiated state.

CBP and RAD21 Proteins Bind at the Termini of Forum Domains in Human Chromosomes.

Forum domains are 50-100-kb stretches of DNA delimited by the hotspots of double-strand breaks (DSBs). These domains possess coordinately expressed genes. However, molecular mechanisms of such regulation are not clear. It is assumed that the proteins specifically binding at the termini of domains can be involved in coordinated regulation of expression. In this study, we used the results of precise mapping of hotspots of DSBs and ChIP-Seq data for ten nuclear proteins in HEK293T cell line for a search of proteins specifically binding at forum-domain termini. We detected that two proteins, CBP and RAD24, which are known to be involved in epigenetic regulation of gene expression and formation of 3D chromosomal structures, bind at the termini. We assume that these proteins may be involved in coordinated expression of genes in forum domains.

Interchromosomal Contacts of rDNA Clusters in Three Human Cell Lines Are Associated with Silencing of Genes Controlling Morphogenesis.

To study the rDNA contacts with genes in three human cell lines of different origin, we used 4C approach. Our data indicate that the same set of about five hundred genes frequently shape contacts with rDNA clusters in HEK293T, K652, and hESM01 cells. Gene ontology search suggests that the genes are involved in development and morphogenesis. Approximately one hundred of these genes are highly associated with silencing by H3K27me3 mark in different normal cells, including bronchial epithelial cells, keratinocytes, myoblasts, monocytes, endothelial cells, kidney epithelial cells, and some others. We conclude that the concerted silencing of specific group of rDNA-contacting genes controlling development occurs during differentiation. We assume that the phase separation mechanisms may be involved in the rDNA-mediated silencing of a set of genes via the contacts with inactive rDNA clusters.

[Drosophila rDNA Genes Shape the Stable Contacts with the Tlk Gene at the Expression Area of Small RNAs and Affect on Looped Domains inside the Gene].

In experiments on mouse and human cells it was demonstrated that rDNA plays an important role in epigenetic regulation of many genes. To identify and study rDNA-contacting genes in Drosophila we used the 4С (circular chromosome conformation capture) approach. We detected very stable contacts of rDNA genes within a 5-kb region inside the Tlk gene residing in X chromosome. This 5-kb region corresponds to small RNAs. After heat shock treatment both the amount of contacts, and the expression level of the gene were increased. Tlk and Rala are genes that share the same short bidirectional promoter but exhibit different expression levels. Around the region of rDNA contacts inside the Tlk gene, looped domains were formed. We conclude that rDNA contact-dependent epigenetic regulation is guided by small RNAs and that the contacts are involved in rearrangements of the looped domains.

[Contact Sites of rDNA Clusters with FANK1 Gene Correspond to Repressed Chromatin].

rDNA genes play an important role in epigenetic regulation and in differentiation of eukaryotic cells. Using the 4C (circular chromosome conformation capture) approach and model HEK293T cells, we analyzed the rDNA-contacting gene FANK1, using anchor located inside rDNA genes. At the 5' end of the FANK1 gene we detected frequent contacts with rDNA clusters. The contact sites coincide with the border where chromatin state changes and nucleosome positioning. The adjacent genes DHX32, BCCIP and UROS are located in the active chromatin and are transcribed, but do not contact with rDNA genes, while FANK1 gene is silenced, and is located in repressed chromatin. Heat shock treatment dramatically changes the pattern of rDNA contacts in the region and induces about 4-fold increase in activation of the FANK1 gene. We conclude that rDNA contacts may be involved in repression of the FANK1 gene.

Interchromosomal Contacts of rDNA Clusters with DUX Genes in Human Chromosome 4 Are Very Sensitive to Heat Shock Treatment.

In order to study the effects of heat shock treatment on the distribution of rDNA contacts at the region possessing DUX genes inside chromosome 4 we used 4C approach. Our data indicate that the treatment removes the frequent rDNA contacts in this region. The recent data on involvement of superenhancers that are decorated by broad H3K27ac marks in the phase separation mechanisms and the previous data demonstrating that these broad marks are the favorite sites of rDNA contacts taken together with our data on sensitivity of the contacts to the heat shock treatment suggest that the phase separation mechanisms are involved in the reversible rDNA-mediated regulation of gene expression via the contacts.

[Homeotic DUX4 Genes that Control Human Embryonic Development at the Two-Cell Stage Are Surrounded by Regions Contacting with rDNA Gene Clusters].

Many human genes that control human embryonic development and differentiation of human cells form chromosomal contact with rRNA gene clusters, which are involved in the epigenetic regulation of many genes. The sites of rRNA gene contact often fall on extended (up to 50 kb) regions containing a chromatin mark, H3K27ac histone, typical for superenhancers, as well as on pericentromeric and subtelomeric regions of chromosomes. We found that the DUX4 genes located in the subtelomeric region of human chromosome 4 are surrounded by regions that are often in contact with the rRNA genes. The 25 kb region of this chromosome, presented in version hg19 of the sequenced human genome, contains several copies of the DUX4 gene. The sites of rRNA gene contacts located around this region contain methylation sites as well as CTCF binding sites. It is assumed that the rRNA gene contacts are important in silencing these DUX4 gene copies.

Link Between Double-Strand DNA Break Hotspots and Transcription Regulation: Forum Domains - 50-250 kb Chromosome Regions Containing Coordinately Expressed Genes.

The data on forum domains formed by DNA double-strand break (DSB) hotspots are reviewed including forum domain identification by pulsed-field gel electrophoresis, whole genome mapping of these domains using deep sequencing strategies, analysis of gene expression in forum domains, and binding of nuclear proteins to their boundaries. Earlier unpublished data by the authors are presented. The "piano playing" hypothesis is suggested based on coordinated active transcription in some of the forum domains and coordinated silencing in the majority of them. The data on the DSB hotspots in human ribosomal DNA gene clusters and their possible association with chromosomal translocations are presented. These clusters are the most actively transcribed DNA regions in cells, as well as the most fragile sites in human chromosomes. The need to revise the available data on DNase I-hypersensitive sites in various genomes, including endogenous DNA breaks of different nature, is discussed.

[Mutation Frequencies in HIV-1 Genome in Regions Containing Efficient RNAi Targets As Calculated from Ultra-Deep Sequencing Data].

HIV-1 is one of the most variable viruses. The development of gene therapy technology using RNAi for AIDS/HIV-1 treatment is a potential alternative for traditional anti-retroviral therapy. Anti-HIV-1 siRNA should aim to exploit the most conserved viral targets. Using the deep sequencing of potential RNAi targets in 100-nt HIV-1 genome fragments from the clinical HIV-1 subtype A isolates in Russia, we found that the frequencies of all possible transversions and transitions in certain RNAi targets are 3-38 times lower than in adjacent sequences. Therefore, these targets are conserved. We propose the development of these RNAi targets for AIDS/HIV-1 treatment. Deep sequencing also enables the detection of the characteristic mutational bias of RT during the replication of viral RNA.

[Mutation Frequencies in RNAi Targets in HIV-1 Genomes Obtained from Blood Plasma of Patients Receiving Anti-Retroviral Therapy].

Gene therapy for AIDS based on RNA interference (RNAi) is currently looked upon as a promising alternative to conventional antiretroviral chemotherapy. The high variability of HIV-1 is the main challenge in developing new approaches to AIDS therapy. To date, about 18 million HIV-1 infected individuals receive antiretroviral therapy worldwide. As of 2017, about 44% of individuals with AIDS received antiretroviral therapy in Russia. Since the RNAs used for efficient RNAi and the corresponding targets in the viral transcript should be perfectly complementary to each other, it is necessary to continuously monitor the nucleotide sequences of clinical HIV-1 isolates obtained from blood and cells of naïve patients and patients receiving antiretroviral therapy. Comprehensive analysis of the mutation frequencies in the viral genome is only possible with deep sequencing approaches. The present paper reports on an analysis of the mutation frequencies in six 100 bp genome regions in clinical HIV-1 isolates obtained from blood plasma of four Russian AIDS patients who have been receiving antiretroviral therapy for several years. These regions contain efficient RNAi targets. The average frequencies of all possible transversions and transitions within the RNAi targets and in their proximity have been estimated. It has been demonstrated that reverse transcriptase inhibition decreases the frequency of a number of reverse mutations. It has been found that mutations in RNAi targets are rarer (5-75 times lower than the mutation frequency for different nucleotide substitutions) than in the adjacent sequences. Our findings speak in favor of these conservative targets for developing new approaches to gene therapy of AIDS.

[Molecular Mechanisms of HIV-1 Genetic Diversity].

High genetic diversity of HIV-1 is the main factor behind the fact that HIV infection is widespread and difficult to treat. Although a limited number (or only one) of virus particles enters the blood upon infection, the particles are replicated in infected cells and rapidly produce new genetic variants that are resistant to the host immune system and antiretroviral drugs. This circumstance hampers the development of anti-HIV-1 vaccines and requires new antiretroviral drugs to be designed. The cause of the high variation of HIV-1 is related to the properties of its reverse transcriptase, which is error prone and often makes mistakes when transcribing virus RNA. Moreover, host APOBEC3-family proteins deaminate cytosines in the resulting minus strand DNA copy, leading to C/G-T/A transitions. The review considers several mechanisms that generate HIV-1 variants, including multiple recombination events between two different RNA copies colocated within one capsid. To understand the mechanisms of high genetic diversity of HIV-1 is essential for designing basically new approaches to treatment of HIV infection and AIDS.

[Mutation frequencies in HIV-1 subtype-A genome in regions containing efficient RNAi targets].

The development of gene-therapy technology using RNAi for AIDS/HIV-1 treatment is a prospective alternative to traditional anti-retroviral therapy. RNAi targets could be selected in HIV-1 transcripts and in CCR5 mRNA. Previously, we experimentally selected a number of efficient siRNAs that target HIV-1 RNAs. The viral genome mutates frequently, and RNAi strength is very sensitive, even for a single mismatches. That is why it is important to study nucleotide sequences of targets in clinical isolates of HIV-1. In the present study, we analyzed mutations in 6 of about 300-bp regions containing RNAi targets from HIV-1 subtype A isolates in Russia. Estimates of the mean frequencies of mutations in the targets were obtained and the frequencies of mutations in the different codon positions were compared. The frequencies of mutations in the vicinity of the targets and directly within the targets were also compared and have been shown to be approximately the same. The frequencies of indels in the chosen regions have been assessed. Their frequencies have proved to be two to three orders of magnitude less compared to that for mutations.

Isolation of eukaryotic DNA fragments containing structural genes and the adjacent sequences.

In Drosophila melanogaster structural genes are located close to moderately reiterated sequences. One of the clones obtained contains the DNA related to intercalary heterochromatin of D. melanogaster. These are individual differences in the distribution of genetic material in polytenic chromosomes of different stocks of D. melanogaster. The techniques that allow isolation of DNA fragments containing structural genes at the beginning, in the middle, or the end of the coding strand have been elaborated.

Mapping of genomic double-strand breaks by ligation of biotinylated oligonucleotides to forum domains: Analysis of the data obtained for human rDNA units.

DNA double-strand breaks (DSBs) are associated with different physiological and pathological processes in different organisms. To understand the role of DSBs in multiple cellular mechanisms, a robust method for genome-wide mapping of chromosomal breaks at one-nucleotide resolution is required. Many years ago, we detected large DNA fragments migrating from DNA-agarose plugs in pulsed-field gels, which we named 'forum domains' [1,2]. Recently, we developed a method for genome-wide mapping of DSBs that produces these 50-150 kb DNA domains using microarrays or 454 sequencing (Tchurikov et al., 2011; 2013). Now we have used Illumina sequencing to map DSBs in repetitive rDNA units in human HEK293T cells. Here we describe in detail the experimental design and bioinformatics analysis of the data deposited in the Gene Expression Omnibus with accession number GSE49302 and associated with the study published in the Journal of Molecular Cell Biology (Tchurikov et al., 2014).

Genome-wide mapping of hot spots of DNA double-strand breaks in human cells as a tool for epigenetic studies and cancer genomics.

Hot spots of DNA double-strand breaks (DSBs) are associated with coordinated expression of genes in chromosomal domains (Tchurikov et al., 2011 [1]; 2013). These 50-150-kb DNA domains (denoted "forum domains") can be visualized by separation of undigested chromosomal DNA in pulsed-field agarose gels (Tchurikov et al., 1988; 1992) and used for genome-wide mapping of the DSBs that produce them. Recently, we described nine hot spots of DSBs in human rDNA genes and observed that, in rDNA units, the hot spots coincide with CTCF binding sites and H3K4me3 marks (Tchurikov et al., 2014), suggesting a role for DSBs in active transcription. Here we have used Illumina sequencing to map DSBs in chromosomes of human HEK293T cells, and describe in detail the experimental design and bioinformatics analysis of the data deposited in the Gene Expression Omnibus with accession number GSE53811 and associated with the study published in DNA Research (Kravatsky et al., 2015). Our data indicate that H3K4me3 marks often coincide with hot spots of DSBs in HEK293T cells and that the mapping of these hot spots is important for cancer genomic studies.

IncI1 plasmid R64 encodes the ArsR protein that alleviates type I restriction.

The host-controlled EcoK restriction of unmodified phage lambda was five-fold alleviated in the wild-type Escherichia coli strain K12 carrying the R64 plasmid of the incompatibility group I1. The relevant gene was mapped between the origin of vegetative replication (rep, oriV) and the tet(r) gene about 60 kbp downstream from the origin of transfer, oriT. We cloned this gene inside the 613 bp long EcoRI-PstI fragment and sequenced it. Only one 351 bp long open reading frame (ORF) starting at 124 bp from the beginning of the insert was found in the sequence. Computer search in the current databases revealed that the putative protein is identical to the ArsR protein specified by the IncFI plasmid R773. ArsR is a repressor of the arsenical resistance (ars) operon, arsRDABC. There are no arsABC genes in the R64 plasmid since plasmid R64- (or pSR8)-mediated resistance of E. coli K12 cells to the arsenicals arsenate and arsenite was not detected. The gene arsR and the antirestriction genes ard (ardA and ardB) are non-homologous. However, comparison of the deduced amino acid sequence of ArsR with the ArdA and ArdB sequences revealed only one small region of similarity, a 9 amino acid motif found in different antirestriction proteins that is hypothesized to be an interaction site for antirestriction proteins with restriction endonucleases.

Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence.

The low-cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5'-d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)-3' 5'-d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)-3' that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14 degrees C while the remainder melt at 42 degrees C. The GC pairs remain stable up to approximately 40 degrees C and melt at 54 degrees C. The higher stability of GC pairs suggests the formation of cis Watson-Crick pairs in parallel DNA.

Southern molecular hybridization experiments with parallel complementary DNA probes.

We have detected the specific binding in Southern blot hybridization experiments of both complementary antiparallel and parallel 40 bp synthetic DNA probes, corresponding to a cloned Drosophila DNA fragment. The highly cooperative annealing and melting were observed in solution with these probes, which are complementary in the same direction and possess 17 GC pairs. The binding of ethidium bromide is indicative of formation of a perfect parallel DNA duplex. The specific binding was also detected in both genomic and in plaque hybridization experiments.

Parallel DNA: generation of a duplex between two Drosophila sequences in vitro.

We have observed the existence of a parallel complementary region between two Drosophila DNA sequences, fragments of the suffix [(1986) EMBO J, 5, 2341-2347] and a 5'-non-coding sequence of the alcohol dehydrogenase gene [(1983) Cell 33, 125-133]. The region includes approximately 40 bp, 76% of which are complementary in the same polarity. Synthetic complementary 16 bp oligonucleotides corresponding to this region which were bound by the 5'-ends through a 1.6-hexanediol bridge form a duplex which displays both melting and annealing as judged by UV absorbance. Anti parallel complementary 16 bp long oligonucleotides bound by the 5'-3' ends through the same bridge and a single-strand sequence were used as controls. The Hoechst 33,258 drug binds to this parallel duplex of DNA; however, the properties of such a complex testify against the B-form of the duplex.