RESUMO
A Nd:YVO4/Cr4+:YAG laser with a symmetric concave-convex cavity ensuring strong intracavity beam focusing on the absorber is designed for stable pulsed operation of Lissajous structured modes with transverse patterns as Lissajous figures. Setting the cavity length to fulfill the criterion for efficient passive Q switching (PQS), as well as to meet the accidental degenerate conditions, Lissajous pulsed beams with well-defined structures and good temporal stability are created under two-dimensional off-axis pumping. Although the multi-transverse-mode oscillation inevitably induces asynchronous pulsation and leads the short-term pulse profiles to reveal parasitic effects, the overall long-term behavior of Lissajous pulses can be kept regular with amplitude fluctuations ≤15% and pulse-to-pulse timing jitter ≤5%. With the maximum peak power exceeding 500â W at a pump power of 4.5â W, the PQS Lissajous modes are further transformed into trochoidal pulsed beams to realize high-order and high-peak power structured vortex fields.
RESUMO
An Nd:YAG/Cr4+:YAG passively Q-switched (PQS) laser in a near-hemispherical cavity is exploited to generate high-order structured pulsed fields. Under tightly focused on-axis pumping, radial-order Laguerre-Gaussian (LG) modes with controllable mode orders by the input pump power are realized to exhibit quite stable temporal behavior. The pulse repetition rates of radial-LG modes can reach up to 78 kHz with an average output power of 0.57 W and peak power beyond 300 W under a 5-W pump level. Furthermore, by introducing 1D off-axis pumping into the PQS laser, various structured pulsed fields with transverse morphologies as high-order Ince-Gaussian (IG) modes are further created. With clean and well-defined beam structures, the IG pulsed fields can be nicely reconstructed by the resonant modes of the inhomogeneous Helmholtz equation for spherical cavities. More importantly, these high-order PQS IG modes reveal highly regular pulse trains with the maximum pulse repetition rate beyond 20 kHz and overall peak power higher than 1.5 kW.
RESUMO
Alendronate is effective in preventing second hip fracture in osteoporotic patients. However, no consensus exists on the duration that is effective in preventing a second hip fracture. Our study demonstrated that risk can be reduced when the prescription is ≥ 6 months for the year following the index hip fracture. INTRODUCTION: Alendronate is effective in preventing second hip fracture in osteoporotic patients. However, no consensus exists on the accurate medication possession ratio (MPR) that is effective in preventing a second hip fracture. Our objective was to compare the risk of second hip fracture in patients treated with different MPR of alendronate. METHODS: In this population-based cohort study, data from National Health Insurance Research Database of Taiwan were analyzed. Patients 50 years and older who had an index hip fracture and were not receiving any osteoporotic medications before their fracture during 2000-2010 were included. The cohort consisted of 88,320 patients who were new alendronate users (n = 9278) and non-users (n = 79,042). Those without alendronate were matched 4:1 as the control group. Patients were subdivided into those with no medication, MPR < 25%, MPR 25-50%, MPR 50-75%, and MPR 75-100%. Cox proportional hazard models were used to calculate the adjusted hazard ratios for different MPRs of alendronate. RESULTS: After matching, 38,675 patients were included in this study; 20,363 (52.7%) were women, and 30,940 (80%) patients were without medication of alendronate. During follow-up on December 31, 2012, 2392 patients had a second hip fracture, for an incidence of 1449/100,000 person-years. Patients with alendronate MPR 50-75% had a lower risk of a second hip fracture compared to non-users (hazard ratio 0.66). When the MPR increased to 75-100%, the hazard ratio decreased to 0.61. CONCLUSIONS: In this population-based cohort study, risk of a second hip fracture can be reduced when the alendronate MPR is ≥ 50% for the year following the index hip fracture. As the MPR increases, the risk of a second hip fracture decreases.
Assuntos
Alendronato , Conservadores da Densidade Óssea , Fraturas do Quadril , Osteoporose , Alendronato/uso terapêutico , Conservadores da Densidade Óssea/uso terapêutico , Estudos de Coortes , Feminino , Fraturas do Quadril/epidemiologia , Fraturas do Quadril/etiologia , Fraturas do Quadril/prevenção & controle , Humanos , Estudos Retrospectivos , Taiwan/epidemiologiaRESUMO
BACKGROUND: The transvaginal natural orifice specimen extraction (NOSE) approach for right-side colon surgery has been proven to exhibit favorable short-term outcomes. However, thus far, no study has reported the advantages of transrectal NOSE for right-side colon surgery. The aim of this study was to compare the technical feasibility, safety, and short-term outcomes of minimally invasive right hemicolectomy using the transrectal NOSE method and those of conventional mini-laparotomy specimen extraction. METHODS: A study was conducted on consecutive patients who had minimally invasive right hemicolectomy either for malignancy or benign disease at Chang Gung Memorial Hospital, Linkou, Taiwan, between January 2017 and December 2018. The patients were divided into two groups: conventional surgery with specimen extraction using mini-laparotomy and NOSE surgery. Surgical outcomes, including complications, postoperative short-term recovery, and pain intensity, were analyzed. RESULTS: We enrolled 297 patients (151 males, mean age 64.9 ± 12.8 years) who had minimally invasive right hemicolectomy. Of these 297 patients, 272 patients had conventional surgery with specimen extraction through mini-laparotomy and 25 patients had NOSE surgery (23 transrectal, 2 transvaginal). The diagnosis of colon disease did not differ significantly between the conventional and NOSE groups. Postoperative morbidity and mortality rates were comparable. The postoperative hospital stay was significantly (p = 0.004) shorter in the NOSE group (median 5 days, range 3-17 days) than in the conventional group (median 7 days, range 3-45 days). Postoperative pain was significantly (p = 0.026 on postoperative day 1 and p = 0.002 on postoperative day 2) greater in the conventional group than in the NOSE group. CONCLUSIONS: NOSE was associated with acceptable short-term surgical outcomes that were comparable to those of conventional surgery. NOSE results in less postoperative wound pain and a shorter hospital stay than conventional surgery. Larger studies are needed.
Assuntos
Laparoscopia , Cirurgia Endoscópica por Orifício Natural , Idoso , Colectomia , Humanos , Laparotomia , Tempo de Internação , Masculino , Pessoa de Meia-Idade , Resultado do TratamentoRESUMO
INTRODUCTION: Entry into tertiary education is a critical juncture where adolescents proceed to adulthood. This study aimed to determine the prevalence of depression and anxiety, and factors associated with such symptoms, among university undergraduate students in Hong Kong. METHODS: A cross-sectional questionnaire study was employed. A total of 1200 undergraduate students from eight University Grants Committee-funded universities were invited to complete three sets of questionnaires, including the 9-item patient health questionnaire for screening of depressive symptoms, the 7-item generalised anxiety disorder scale for screening of anxiety symptoms, and a socio-demographic questionnaire. RESULTS: Among the valid responses (n=1119) analysed, 767 (68.5%) respondents indicated mild to severe depressive symptoms, which were associated with mild to severe anxiety symptoms. Several lifestyle and psychosocial variables, including regular exercise, self-confidence, satisfaction with academic performance, and optimism towards the future were inversely related with mild to severe depressive symptoms. A total of 599 (54.4%) respondents indicated mild to severe anxiety symptoms, which were associated with level of academic difficulty. Satisfaction with friendship, sleep quality, and self-confidence were inversely associated with mild to severe anxiety symptoms. CONCLUSION: More than 50% of respondents expressed some degree of depressive and anxiety symptoms (68.5% and 54.4%, respectively). Approximately 9% of respondents exhibited moderately severe to severe depressive symptoms; 5.8% exhibited severe anxiety symptoms. Respondents reporting regular exercise, higher self-confidence, and better satisfaction with both friendship and academic performance had fewer depressive and anxiety symptoms.
Assuntos
Transtornos de Ansiedade/epidemiologia , Transtorno Depressivo/epidemiologia , Estudantes/psicologia , Adolescente , Adulto , Transtornos de Ansiedade/etiologia , Transtornos de Ansiedade/psicologia , Estudos Transversais , Transtorno Depressivo/etiologia , Transtorno Depressivo/psicologia , Feminino , Hong Kong/epidemiologia , Humanos , Masculino , Prevalência , Escalas de Graduação Psiquiátrica , Inquéritos e Questionários , Universidades , Adulto JovemRESUMO
BACKGROUND: The study of autoinflammatory diseases has uncovered mechanisms underlying cytokine dysregulation and inflammation. METHODS: We analyzed the DNA of an index patient with early-onset systemic inflammation, cutaneous vasculopathy, and pulmonary inflammation. We sequenced a candidate gene, TMEM173, encoding the stimulator of interferon genes (STING), in this patient and in five unrelated children with similar clinical phenotypes. Four children were evaluated clinically and immunologically. With the STING ligand cyclic guanosine monophosphate-adenosine monophosphate (cGAMP), we stimulated peripheral-blood mononuclear cells and fibroblasts from patients and controls, as well as commercially obtained endothelial cells, and then assayed transcription of IFNB1, the gene encoding interferon-ß, in the stimulated cells. We analyzed IFNB1 reporter levels in HEK293T cells cotransfected with mutant or nonmutant STING constructs. Mutant STING leads to increased phosphorylation of signal transducer and activator of transcription 1 (STAT1), so we tested the effect of Janus kinase (JAK) inhibitors on STAT1 phosphorylation in lymphocytes from the affected children and controls. RESULTS: We identified three mutations in exon 5 of TMEM173 in the six patients. Elevated transcription of IFNB1 and other gene targets of STING in peripheral-blood mononuclear cells from the patients indicated constitutive activation of the pathway that cannot be further up-regulated with stimulation. On stimulation with cGAMP, fibroblasts from the patients showed increased transcription of IFNB1 but not of the genes encoding interleukin-1 (IL1), interleukin-6 (IL6), or tumor necrosis factor (TNF). HEK293T cells transfected with mutant constructs show elevated IFNB1 reporter levels. STING is expressed in endothelial cells, and exposure of these cells to cGAMP resulted in endothelial activation and apoptosis. Constitutive up-regulation of phosphorylated STAT1 in patients' lymphocytes was reduced by JAK inhibitors. CONCLUSIONS: STING-associated vasculopathy with onset in infancy (SAVI) is an autoinflammatory disease caused by gain-of-function mutations in TMEM173. (Funded by the Intramural Research Program of the National Institute of Arthritis and Musculoskeletal and Skin Diseases; ClinicalTrials.gov number, NCT00059748.).
Assuntos
Inflamação/genética , Proteínas de Membrana/genética , Mutação , Dermatopatias Vasculares/genética , Idade de Início , Citocinas/genética , Citocinas/metabolismo , Feminino , Fibroblastos/metabolismo , Genes Dominantes , Humanos , Lactente , Recém-Nascido , Inflamação/metabolismo , Interferon gama/genética , Interferon gama/metabolismo , Janus Quinases/antagonistas & inibidores , Pneumopatias/genética , Masculino , Linhagem , Fosforilação , Fator de Transcrição STAT1/metabolismo , Análise de Sequência de DNA , Dermatopatias Vasculares/metabolismo , Síndrome , Transcrição Gênica , Regulação para CimaRESUMO
AIMS: To evaluate the antibacterial efficacy of novel antimicrobial peptides (AMPs) against multidrug-resistant (MDR) Salmonella enterica serovar Choleraesuis (Salm. Choleraesuis) and to delineate the AMP-responsive mechanisms of wild-type (WT) and MDR strains. METHODS AND RESULTS: Proteomic approaches were performed based on two-dimensional gel electrophoresis and liquid chromatography-electrospray ionization-quadrupole- time-of-flight tandem mass spectrometry to analyse the protein profiles of these two strains upon exposure to AMP GW-Q6. Quantitative real-time PCR was conducted to determine the mRNA expression level of the target genes. Furthermore, lipopolysaccharide (LPS) competition analysis was used to verify whether LPS may serve as the potential binding target when AMP approach and adhere to the bacterial surface. CONCLUSIONS: The minimal inhibitory concentration assay revealed that our AMPs were even more effective against the MDR strains (4-32 µg ml(-1) ), compared with those for the WT (8-64 µg ml(-1) ). LPS dose-dependently suppressed the GW-Q6 antimicrobial activity. Clusters of orthologous groups analysis showed that the majority of the AMP-responsive proteins were involved in cell envelope biogenesis and outer membrane, translation and chaperones. SIGNIFICANCE AND IMPACT OF THE STUDY: These results indicated that the novel AMP GW-Q6 serves as a potential candidate for antimicrobial drug development against MDR strains. These findings will also be helpful for expanding our knowledge on the molecular mechanisms of AMP-microbe interaction and the pathogenicity of salmonellosis caused by MDR strains of Salm. Choleraesuis.
Assuntos
Antibacterianos/farmacologia , Peptídeos Catiônicos Antimicrobianos/farmacologia , Salmonella enterica/fisiologia , Animais , Proteínas de Bactérias/análise , Farmacorresistência Bacteriana Múltipla , Eletroforese em Gel Bidimensional , Testes de Sensibilidade Microbiana , Proteômica , Reação em Cadeia da Polimerase em Tempo Real , Infecções por Salmonella/microbiologia , Salmonella enterica/classificação , Salmonella enterica/efeitos dos fármacos , SorogrupoRESUMO
BACKGROUND: An uneven neurocognitive profile is a hallmark of autism spectrum disorder (ASD). Studies focusing on the visual memory performance in ASD have shown controversial results. We investigated visual memory and sustained attention in youths with ASD and typically developing (TD) youths. METHOD: We recruited 143 pairs of youths with ASD (males 93.7%; mean age 13.1, s.d. 3.5 years) and age- and sex-matched TD youths. The ASD group consisted of 67 youths with autistic disorder (autism) and 76 with Asperger's disorder (AS) based on the DSM-IV criteria. They were assessed using the Cambridge Neuropsychological Test Automated Battery involving the visual memory [spatial recognition memory (SRM), delayed matching to sample (DMS), paired associates learning (PAL)] and sustained attention (rapid visual information processing; RVP). RESULTS: Youths with ASD performed significantly worse than TD youths on most of the tasks; the significance disappeared in the superior intelligence quotient (IQ) subgroup. The response latency on the tasks did not differ between the ASD and TD groups. Age had significant main effects on SRM, DMS, RVP and part of PAL tasks and had an interaction with diagnosis in DMS and RVP performance. There was no significant difference between autism and AS on visual tasks. CONCLUSIONS: Our findings implied that youths with ASD had a wide range of visual memory and sustained attention impairment that was moderated by age and IQ, which supports temporal and frontal lobe dysfunction in ASD. The lack of difference between autism and AS implies that visual memory and sustained attention cannot distinguish these two ASD subtypes, which supports DSM-5 ASD criteria.
Assuntos
Síndrome de Asperger/fisiopatologia , Atenção , Transtorno do Espectro Autista/fisiopatologia , Memória , Percepção Visual , Adolescente , Adulto , Transtorno do Espectro Autista/classificação , Estudos de Casos e Controles , Criança , Manual Diagnóstico e Estatístico de Transtornos Mentais , Feminino , Humanos , Masculino , Testes Neuropsicológicos , Adulto JovemRESUMO
The physiology of human skin pigmentation is varied and complex, with an extensive melanogenic paracrine network involving mesenchymal and epithelial cells, contributing to the regulation of melanocyte survival and proliferation and melanogenesis. Mutations in several genes, involving predominantly the KIT ligand/c-Kit and Ras/mitogen-activated protein kinase signalling pathways, have been implicated in a spectrum of diseases in which there is hyperpigmentation, hypopigmentation or both. Here, we report on a 12-year-old girl from Taiwan with a 6-year history of diffuse progressive skin hyperpigmentation resulting from a different aetiology: an inborn metabolic disorder of vitamin B12 (cobalamin), designated cblJ. Using whole-exome sequencing we identified a homozygous mutation in ABCD4 (c.423C>G; p.Asn141Lys), which encodes an ATP-binding cassette transporter with a role in the intracellular processing of cobalamin. The patient had biochemical and haematological evidence of cobalamin deficiency but no other clinical abnormalities apart from a slight lightening of her previously black hair. Of note, she had no neurological symptoms or signs. Treatment with oral cobalamin (3 mg daily) led to metabolic correction and some reduction in the skin hyperpigmentation at the 3-month follow-up. This case demonstrates that defects or deficiencies of cobalamin should be remembered in the differential diagnosis of diffuse hyperpigmentary skin disorders.
Assuntos
Transportadores de Cassetes de Ligação de ATP/genética , Hiperpigmentação/genética , Erros Inatos do Metabolismo/genética , Mutação/genética , Polimorfismo de Nucleotídeo Único/genética , Deficiência de Vitamina B 12/genética , Criança , Feminino , Homozigoto , Humanos , Hiperpigmentação/tratamento farmacológico , Erros Inatos do Metabolismo/tratamento farmacológico , Vitamina B 12/uso terapêutico , Deficiência de Vitamina B 12/tratamento farmacológico , Complexo Vitamínico B/uso terapêuticoRESUMO
Little is known about the virulence and clinical impact on humans from infection with Anaeroglobus geminates, an anaerobic gram-negative coccus belonging to the family Veillonellaceae. We report the first case of an Anaeroglobus geminates invasive infection in humans characterized by pneumonia complicated with empyema. The pathogen was initially identified as Veillonella spp. by an automatic identification system (Becton-Dickinson and Company, Franklin Lakes, NJ, USA) and definitively identified following 16S ribosomal RNA gene sequence analysis. The patient was cured by surgical decortication and antimicrobial therapy. In this case, the combination of effective antibiotics, surgical intervention, and adequate drainage successfully cured the patient.
Assuntos
Empiema , Infecções por Bactérias Gram-Negativas , Pneumonia Bacteriana , Veillonellaceae , Idoso , DNA Bacteriano/análise , DNA Bacteriano/genética , Feminino , Humanos , Radiografia Torácica , Veillonellaceae/classificação , Veillonellaceae/genéticaRESUMO
AIMS: To investigate whether Photobacterium damselae subsp. piscicida (Phdp) can sense and directly respond to the presence of cationic antimicrobial peptides (AMPs). METHODS AND RESULTS: We performed proteomic methodologies to investigate the responsive proteins of Phdp on exposure to AMP Q6. Proteins significantly altered were analysed by two-dimensional gel electrophoresis (2-DE) and LC-ESI-Q-TOF MS/MS, thus resulting in five outer membrane proteins (OMPs), seven inner membrane proteins (IMPs) and 17 cytoplasmic proteins (CPs) identified. Quantitative real-time PCR was also applied to monitor the mRNA expression level of these target proteins. CONCLUSIONS: COG analysis revealed that upon exposure to AMP Q6, the majority of the upregulated proteins were involved in signal transduction mechanism, carbohydrate transport and metabolism, post-translational modification, protein turnover and chaperones, while the downregulated proteins were mainly related to energy production and conversion. Among them, phage-shock-protein A (PspA)-related stress response system was considered to play a crucial role. SIGNIFICANCE AND IMPACT OF THE STUDY: To the best of our knowledge, this is the first report elucidating Phdp AMP-response mechanism using proteomics approach. AMP-responsive proteins identified in this study could serve as attractive targets for developing more effective antimicrobial agents against Phdp and other marine bacterial pathogens.
Assuntos
Antibacterianos/farmacologia , Peptídeos Catiônicos Antimicrobianos/farmacologia , Proteínas de Bactérias/metabolismo , Proteínas de Choque Térmico/metabolismo , Photobacterium/efeitos dos fármacos , Proteínas de Membrana/metabolismo , Photobacterium/metabolismo , Photobacterium/ultraestrutura , Proteômica , Estresse FisiológicoRESUMO
UNLABELLED: Several differences may have existed between patients treated with peritoneal dialysis and hemodialysis because of the difference in dialysis modality. This nationwide population-based cohort study demonstrated that patients on hemodialysis had an increased risk of hip fracture compared to patients on peritoneal dialysis; the hazard ratio was 1.52. INTRODUCTION: Numerous debates on which dialysis modality is "superior" have taken place in recent decades. However, no large-scale study has ever mentioned about the relationship between dialysis modality and risk of hip fracture. METHODS: We identified 64,124 incident end-stage renal disease patients from the National Health Insurance Research Database in Taiwan between 1998 and 2008, including 59,457 (92.72%) hemodialysis (HD) and 4,667 (7.28%) peritoneal dialysis (PD) patients. After 8:1 propensity score matching, 31,554 patients, of whom 28,048 were HD and 3,506 were PD patients, were included in the study. We conducted the Cox proportional hazards model to examine the effects of dialysis modality and other variables on hip fracture risk. RESULTS: A total of 2,587 hip fractures were identified in 64,124 dialysis patients. The incidence rate of hip fracture was 13.60 per 1000 patient-years in the HD group and 6.25 in the PD group. Dialysis modality, sex, age, presence of cardiovascular disease, diabetes, medication with antiepileptic drugs, diuretics, steroids, and vitamin D had statistically significant associations with hip fracture. Patients on HD had an increased risk of hip fracture compared to patients on PD; the hazard ratio (HR) was 1.52 (95% CI: 1.09-2.12, P = 0.02). CONCLUSIONS: In this population-based cohort study, HD had a greater hip fracture risk compared to PD; the HR was 1.52. We should focus more on reducing the risk of hip fractures in hemodialysis patients.
Assuntos
Fraturas do Quadril/etiologia , Falência Renal Crônica/terapia , Fraturas por Osteoporose/etiologia , Diálise Renal/efeitos adversos , Distribuição por Idade , Idoso , Idoso de 80 Anos ou mais , Estudos de Coortes , Feminino , Fraturas do Quadril/epidemiologia , Humanos , Incidência , Falência Renal Crônica/complicações , Falência Renal Crônica/epidemiologia , Masculino , Pessoa de Meia-Idade , Fraturas por Osteoporose/epidemiologia , Diálise Peritoneal/efeitos adversos , Diálise Renal/métodos , Distribuição por Sexo , Taiwan/epidemiologiaRESUMO
When 66 cucurbit samples with yellowing symptoms from fields in Mali, the Philippines, Thailand and Uzbekistan were screened by RT-PCR using universal polerovirus primers, 21 were identified as harboring polerovirus RNA. When these 21 samples were screened with specific primers for the known cucurbit-infecting poleroviruses, suakwa aphid-borne yellows virus and a recombinant strain of cucurbit aphid-borne yellows virus were detected for the first time in the Philippines and Thailand. However, seven polerovirus-positive samples did not react with any of the known species-specific primers. Sequencing of 1.4-kb universal polerovirus RT-PCR products revealed the presence of two poleroviruses that had not been described previously. These viruses, from Mali and Thailand, were provisionally named pepo aphid-borne yellows virus and luffa aphid-borne yellows virus, respectively.
Assuntos
Cucurbita/virologia , Variação Genética , Luteoviridae/classificação , Luteoviridae/isolamento & purificação , RNA Viral/genética , Ásia , Análise por Conglomerados , Genótipo , Luteoviridae/genética , Dados de Sequência Molecular , Filogenia , Doenças das Plantas/virologia , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Análise de Sequência de DNARESUMO
Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)-two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)-and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.
RESUMO
The 3-30-300 rule offers benchmarks for cities to promote equitable nature access. It dictates that individuals should see three trees from their dwelling, have 30 % tree canopy in their neighborhood, and live within 300 m of a high-quality green space. Implementing this demands thorough measurement, monitoring, and evaluation methods, yet little guidance is currently available to pursue these actions. To overcome this gap, we employed an expert-based consensus approach to review the available ways to measure 3-30-300 as well as each measure's strengths and weaknesses. We described seven relevant data and processes: vegetation indices, street level analyses, tree inventories, questionnaires, window view analyses, land cover maps, and green space maps. Based on the reviewed strengths and weaknesses of each measure, we presented a suitability matrix to link recommended measures with each component of the rule. These recommendations included surveys and window-view analyses for the '3 component', high-resolution land cover maps for the '30 component', and green space maps with network analyses for the '300 component'. These methods, responsive to local situations and resources, not only implement the 3-30-300 rule but foster broader dialogue on local desires and requirements. Consequently, these techniques can guide strategic investments in urban greening for health, equity, biodiversity, and climate adaptation.
Assuntos
Características de Residência , Árvores , Humanos , Cidades , BiodiversidadeRESUMO
A disease of okra (Abelmoschus esculentus) causing yellowing veins and mosaic on leaves and fruit has emerged in Thailand. Incidences of 50 to 100% diseased plants were observed in fields in Kanchanaburi and Nakhon Pathom provinces in 2009 and 2010, respectively. Leaf samples were collected from three and four diseased plants in Kanchanaburi and Nakhon Pathom, respectively. All seven samples tested positive for begomovirus by PCR using universal primer pair PAL1v1978B/PAR1c715H (3). One sample from Kanchanaburi also tested positive by ELISA using Okra mosaic virus (Genus Tymovirus) antiserum (DSMZ, Braunschweig, Germany). When the nucleotide sequences of the 1.5 kb begomovirus PCR products were compared they were found to share 99.1 to 99.5% identity with each other, and 97.5 to 97.7% identity to Bhendi yellow vein mosaic virus Okra isolate from India (GenBank Accession No. GU112057; BYVMV-[IN: Kai:OY: 06]). The complete DNA-A sequence for a Kanchanaburi isolate (JX678967) was obtained using abutting primers WTHOK6FL-V/-C (WTHOK6FL-V: 5'-GCGAAGCTTAGATAACGCTCCTT-3'; WTHOK6FL-C: 5'-TCCAAGCTTTGAGTCTGCAACGT-3'), while that of a Nakhon Pathom isolate (JX678966) was obtained with primers WTHOK6FLV/WTHOK2FL-C (WTHOK2FL-C: 5'-TCCAAGCTTTGAGTCTGCATCGT-3'). The DNA-A sequences of both isolates are 2,740 nucleotides in length and share 99.6% identity. Each has the geminivirus conserved sequence (TAATATTAC), two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). Based on BLASTn searching GenBank and sequence analysis using MegAlign (DNASTAR), both DNA-A sequences have greatest nucleotide identity (96.2 to 96.4%) with BYVMV-[IN: Kai:OY: 06] from India. Also, BYVMV-associated betasatellite DNA (1.4 kb) was detected in all begomovirus-positive samples, except one sample from Nakhon Pathom (1). However, no virus DNA-B was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (2). Okra infected with BYVMV has been reported in South Asia in Bangladesh, India, and Pakistan. To the best of our knowledge, this is the first report of BYVMV associated with Okra Yellow Vein Mosaic Disease in Southeast Asia. Since fruits with symptoms are regarded as low quality and have little market value, even low incidence of the disease is likely to cause significant reductions in marketable yield. Strategies for managing BYVMV in okra in South and Southeast Asia should be sought, including the breeding and selecting of resistant varieties. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) W. S. Tsai et al. Plant Pathol. 60:787, 2011.
RESUMO
Myotonic dystrophy (DM) is an autosomal dominant disorder characterized by skeletal muscle wasting, myotonia, cardiac arrhythmia, hyperinsulinaemia, mental retardation and ocular cataracts. The genetic defect in DM is a CTG repeat expansion located in the 3' untranslated region of DMPK and 5' of a homeodomain-encoding gene, SIX5 (formerly DMAHP; refs 2-5). There are three mechanisms by which CTG expansion can result in DM. First, repeat expansion may alter the processing or transport of the mutant DMPK mRNA and consequently reduce DMPK levels. Second, CTG expansion may establish a region of heterochromatin 3' of the repeat sequence and decrease SIX5 transcription. Third, toxic effects of the repeat expansion may be intrinsic to the repeated elements at the level of DNA or RNA (refs 10,11). Previous studies have demonstrated that a dose-dependent loss of Dm15 (the mouse DMPK homologue) in mice produces a partial DM phenotype characterized by decreased development of skeletal muscle force and cardiac conduction disorders. To test the role of Six5 loss in DM, we have analysed a strain of mice in which Six5 was deleted. Our results demonstrate that the rate and severity of cataract formation is inversely related to Six5 dosage and is temporally progressive. Six5+/- and Six5-/- mice show increased steady-state levels of the Na+/K+-ATPase alpha-1 subunit and decreased Dm15 mRNA levels. Thus, altered ion homeostasis within the lens may contribute to cataract formation. As ocular cataracts are a characteristic feature of DM, these results demonstrate that decreased SIX5 transcription is important in the aetiology of DM. Our data support the hypothesis that DM is a contiguous gene syndrome associated with the partial loss of both DMPK and SIX5.
Assuntos
Catarata/etiologia , Catarata/genética , Proteínas de Homeodomínio/genética , Proteínas de Homeodomínio/metabolismo , Perda de Heterozigosidade/genética , Animais , Mapeamento Cromossômico , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Mapeamento por RestriçãoRESUMO
To investigate the clinical outcome of cytomegalovirus (CMV) infection in febrile hospitalized patients with autoimmune diseases, mostly systemic lupus erythematosus (SLE). Fifty-four febrile patients were analyzed retrospectively. Half were diagnosed as CMV infection, by positive CMV pp65 antigenemia assay. Clinical and laboratory data between two groups were compared. Correlation between laboratory data and SELENA-SLEDAI scores/mortality were analyzed in the CMV infection group. Receiver operating characteristic analysis was performed to determine the cutoff points of different parameters for predicting mortality or morbidity. The CMV infection group received a higher corticosteroid dosage (mean 26.3 mg/day) and a higher percentage of azathioprine use before admission than the non-CMV infection group. In the former, the deceased subgroup had a significantly higher number of infected leukocytes for CMV (shortened as CMV counts, P = 0.013), more cases of bacterial infection (P = 0.090), and a higher SLE disease activity index score (P = 0.072) than the alive subgroup. The CMV infection group had lower lymphocyte count and more positive bacterial infection than the non-CMV infection group did (P = 0.013 and P = 0.027, respectively). A level of 25 CMV particles/5 × 10(5) polymorphonuclear neutrophils (PMN) was the best cutoff point for predicting CMV-associated mortality, with a sensitivity of 75.0% and specificity of 72.2%. Moderate dose (30 mg/day) of prednisolone or azathioprine use predisposes patients with autoimmune diseases to CMV infection with concurrent bacterial infection. In particular, peak CMV counts at 25/5 × 10(5) PMN or low lymphocyte counts predict mortality or morbidity, respectively.
Assuntos
Povo Asiático/etnologia , Doenças Autoimunes/etnologia , Doenças Autoimunes/epidemiologia , Infecções por Citomegalovirus/epidemiologia , Infecções por Citomegalovirus/mortalidade , Lúpus Eritematoso Sistêmico/etnologia , Lúpus Eritematoso Sistêmico/epidemiologia , Corticosteroides/uso terapêutico , Adulto , Doenças Autoimunes/tratamento farmacológico , Causalidade , Comorbidade , Infecções por Citomegalovirus/etnologia , Feminino , Humanos , Imunossupressores/uso terapêutico , Lúpus Eritematoso Sistêmico/tratamento farmacológico , Contagem de Linfócitos , Masculino , Pessoa de Meia-Idade , Morbidade , Estudos Retrospectivos , Índice de Gravidade de Doença , Taxa de Sobrevida , Taiwan/epidemiologiaRESUMO
WHAT IS KNOWN AND OBJECTIVE: An ideal Health Care Service is a service system that focuses on patients. Patients in Taiwan have the freedom to fill their prescriptions at any pharmacies contracted with National Health Insurance. Each of these pharmacies uses its own computer system. So far, there are at least ten different systems on the market in Taiwan. To transmit the prescription information from the hospital to the pharmacy accurately and efficiently presents a great issue. METHODS: This study consisted of two-dimensional applications using a QR-code to capture Patient's identification and prescription information from the hospitals as well as using a webcam to read the QR-code and transfer all data to the pharmacy computer system. Two hospitals and 85 community pharmacies participated in the study. RESULTS AND DISCUSSION: During the trial, all participant pharmacies appraised highly of the accurate transmission of the prescription information. The contents in QR-code prescriptions from Taipei area were picked up efficiently and accurately in pharmacies at Taichung area (middle Taiwan) without software system limit and area limitation. The QR-code device received a patent (No. M376844, March 2010) from Intellectual Property Office Ministry of Economic Affair, China. WHAT IS NEW AND CONCLUSION: Our trial has proven that QR-code prescription can provide community pharmacists an efficient, accurate and inexpensive device to digitalize the prescription contents. Consequently, pharmacists can offer better quality of pharmacy service to patients.