Phosphorylation of AHR by PLK1 promotes metastasis of LUAD via DIO2-TH signaling.

Metastasis of lung adenocarcinoma (LUAD) is a major cause of death in patients. Aryl hydrocarbon receptor (AHR), an important transcription factor, is involved in the initiation and progression of lung cancer. Polo-like kinase 1 (PLK1), a serine/threonine kinase, acts as an oncogene promoting the malignancy of multiple cancer types. However, the interaction between these two factors and their significance in lung cancer remain to be determined. In this study, we demonstrate that PLK1 phosphorylates AHR at S489 in LUAD, leading to epithelial-mesenchymal transition (EMT) and metastatic events. RNA-seq analyses reveal that type 2 deiodinase (DIO2) is responsible for EMT and enhanced metastatic potential. DIO2 converts tetraiodothyronine (T4) to triiodothyronine (T3), activating thyroid hormone (TH) signaling. In vitro and in vivo experiments demonstrate that treatment with T3 or T4 promotes the metastasis of LUAD, whereas depletion of DIO2 or a deiodinase inhibitor disrupts this property. Taking together, our results identify the AHR phosphorylation by PLK1 and subsequent activation of DIO2-TH signaling as mechanisms leading to LUAD metastasis. These findings can inform possible therapeutic interventions for this event.

Metabolomics and transcriptomics analysis revealed the response mechanism of alfalfa to combined cold and saline-alkali stress.

Cold and saline-alkali stress are frequently encountered by plants, and they often occur simultaneously in saline-alkali soils at mid to high latitudes, constraining forage crop distribution and production. However, the mechanisms by which forage crops respond to the combination of cold and saline-alkali stress remain unknown. Alfalfa (Medicago sativa L.) is one of the most essential forage grasses in the world. In this study, we analyzed the complex response mechanisms of two alfalfa species (Zhaodong [ZD] and Blue Moon [BM]) to combined cold and saline-alkali stress using multi-omics. The results revealed that ZD had a greater ability to tolerate combined stress than BM. The tricarboxylic acid cycles of the two varieties responded positively to the combined stress, with ZD accumulating more sugars, amino acids, and jasmonic acid. The gene expression and flavonoid content of the flavonoid biosynthesis pathway were significantly different between the two varieties. Weighted gene co-expression network analysis and co-expression network analysis based on RNA-Seq data suggested that the MsMYB12 gene may respond to combined stress by regulating the flavonoid biosynthesis pathway. MsMYB12 can directly bind to the promoter of MsFLS13 and promote its expression. Moreover, MsFLS13 overexpression can enhance flavonol accumulation and antioxidant capacity, which can improve combined stress tolerance. These findings provide new insights into improving alfalfa resistance to combined cold and saline-alkali stress, showing that flavonoids are essential for plant resistance to combined stresses, and provide theoretical guidance for future breeding programs.

Clinical characteristics of hepatitis-associated aplastic anemia in children.

To understand the current situation of hepatitis-related aplastic anemia (HAAA) in children, we analyzed the patients with HAAA admitted to our hospital in the past 5 years to understand the disease characteristics and prognosis. The clinical data of patients with HAAA admitted to our hospital from February 2017 to May 2022 were retrospectively analyzed. A total of 81 patients with HAAA, 56 males and 25 females. The median onset age was 5.9 years. The median time from hepatitis to occurrence of hemocytopenia was 30 days, and the median follow-up time was 2.77 years. There were 23 cases (28.5%) of severe aplastic anemia (SAA), 50 cases of very severe aplastic anemia (VSAA), and 8 cases of non-severe aplastic anemia (NSAA). At the beginning of the disease, cytotoxic T lymphocyte (CTL) was higher than normal in 60% of patients, and the median CD4/CD8 ratio was 0.2. As of follow-up, 72 children survived, 4 were lost, and 5 died. Thirty-four cases were treated with immunosuppressive therapy (IST), with a median follow-up time of 0.97 years. The total reaction rate was 73.5% (25/34), the complete reaction rate was 67.6% (23/34), and the nonreaction rate was 26.5% (9/34). Multivariate analysis suggested that co-infection was an independent risk factor affecting the efficacy of IST at 6 months, with an OR value of 16.76, 95% CI (1.23, 227.95), P=0.034. No independent influencing factors were found at the end of follow-up. The proportion of CTL cells in peripheral blood of children with HAAA is relatively increased, and IST is effective in 73.5% of children. Co-infection may prolongs the time to response to IST.

Exploring the causal relationship between immune cells and idiopathic pulmonary fibrosis: a bi-directional Mendelian randomization study.

BACKGROUND: The potential pathogenic mechanism of idiopathic pulmonary fibrosis is widely recognized to involve immune dysregulation. However, the current pool of studies has yet to establish a unanimous agreement regarding the correlation between various types of immune cells and IPF. METHODS: By conducting a two-sample Mendelian randomization analysis using publicly available genetic data, the study examined the causal relationship between IPF and 731 immune cells. To ensure the reliability of the results, combined sensitivity analyses and inverse Mendelian analyses were conducted. Moreover, within subgroups, multivariate Mendelian randomization analyses were utilized to investigate the autonomous causal connection between immune cell characteristics and IPF. RESULTS: After adjusting for false discovery rate, it was discovered that 20 immunophenotypes exhibited a significant association with IPF. After subgrouping for multivariate Mendelian randomization analysis, there were six immunophenotypes that remained significantly associated with IPF. These included CD33 + HLA DR + CD14dim (OR = 0.96, 95% CI 0.93-0.99, P = 0.033), HLA DR + NK (OR = 0.92, 95% CI 0.85-0.98, P = 0.017), CD39 + CD8 + T cell %T cell (OR = 0.93, 95% CI 0.88-0.99, P = 0.024), CD3 on activated & secreting Treg (OR = 0.91, 95% CI 0.84-0.98, P = 0.026), PDL-1 on CD14- CD16 + monocyte (OR = 0.89, 95% CI 0.84-0.95, P = 8 × 10-4), and CD45 on CD33 + HLA DR + CD14- (OR = 1.08, 95% CI 1.01-1.15, P = 0.011). CONCLUSION: Our study reveals a noteworthy association between IPF and various immune cells, providing valuable insights for clinical research and aiding the advancement of immunologically-based therapeutic strategies.

A Reinforcement Ensemble Learning Method for Rolling Bearing Fault Diagnosis under Variable Work Conditions.

Ensuring the smooth operation of rolling bearings requires a precise fault diagnosis. Particularly, identifying fault types under varying working conditions holds significant importance in practical engineering. Thus, we propose a reinforcement ensemble method for diagnosing rolling bearing faults under varying working conditions. Firstly, a reinforcement model was designed to select the optimal base learner. Stratified random sampling was used to extract four datasets from raw training data. The reinforcement model was trained by these four datasets, respectively, and we obtained four optimal base learners. Then, a sparse ANN was designed as the ensemble model and the reinforcement learning model that can successfully identify the fault type under variable work conditions was constructed. Extensive experiments were conducted, and the results demonstrate the superiority of the proposed method over other intelligent approaches, with significant practical engineering benefits.

A cost-effectiveness analysis of fluoride varnish application in preventing Root caries in elderly persons: a Markov simulation study.

BACKGROUND: Root caries are prevalent issues that affect dental health, particularly among elderly individuals with exposed root surfaces. Fluoride therapy has shown effectiveness in preventing root caries, but limited studies have addressed its cost-effectiveness in elderly persons population. This study aimed to evaluate the cost-effectiveness of a fluoride treatment program for preventing root caries in elderly persons within the context of Chinese public healthcare. METHODS: A Markov simulation model was adopted for the cost-effectiveness analysis in a hypothetical scenario from a healthcare system perspective. A 60-year-old subject with 23 teeth was simulated for 20 years. A 5% sodium fluoride varnish treatment was compared with no preventive intervention in terms of effectiveness and cost. Tooth years free of root caries were set as the effect. Transition probabilities were estimated from the data of a community-based cohort and published studies, and costs were based on documents published by the government. The incremental cost-effectiveness ratio (ICER) was calculated to evaluate cost-effectiveness. Univariate and probabilistic sensitivity analyses were performed to evaluate the influence of data uncertainty. RESULTS: Fluoride treatment was more effective (with a difference of 10.20 root caries-free tooth years) but also more costly (with a difference of ¥1636.22). The ICER was ¥160.35 per root caries-free tooth year gained. One-way sensitivity analysis showed that the risk ratio of root caries in the fluoride treatment group influenced the result most. In the probabilistic sensitivity analysis, fluoride treatment was cost-effective in 70.5% of the simulated cases. CONCLUSIONS: Regular 5% sodium fluoride varnish application was cost-effective for preventing root caries in the elderly persons in most scenarios with the consideration of data uncertainty, but to a limited extent. Improved public dental health awareness may reduce the incremental cost and make the intervention more cost-effective. Overall, the study shed light on the economic viability and impact of such preventive interventions, providing a scientific basis for dental care policies and healthcare resource allocation.

[Role of Fibroblast Growth Factor 7 in Craniomaxillofacial Development]. / æˆçº¤ç»´ç»†èƒžç”Ÿé•¿å› å­7åœ¨é¢ é¢Œé¢å‘è‚²ä¸­çš„ä½œç”¨.

Craniomaxillofacial development involves a series of highly ordered temporal-spatial cellular differentiation processes in which a variety of cell signaling factors, such as fibroblast growth factors, play important regulatory roles. As a classic fibroblast growth factor, fibroblast growth factor 7 (FGF7) serves a wide range of regulatory functions. Previous studies have demonstrated that FGF7 regulates the proliferation and migration of epithelial cells, protects them, and promotes their repair. Furthermore, recent findings indicate that epithelial cells are not the only ones subjected to the broad and powerful regulatory capacity of FGF7. It has potential effects on skeletal system development as well. In addition, FGF7 plays an important role in the development of craniomaxillofacial organs, such as the palate, the eyes, and the teeth. Nonetheless, the role of FGF7 in oral craniomaxillofacial development needs to be further elucidated. In this paper, we summarized the published research on the role of FGF7 in oral craniomaxillofacial development to demonstrate the overall understanding of FGF7 and its potential functions in oral craniomaxillofacial development.

Research Progress on Anthocyanin-Mediated Regulation of 'Black' Phenotypes of Plant Organs.

The color pattern is one of the most important characteristics of plants. Black stands out among the vibrant colors due to its rare and distinctive nature. While some plant organs appear black, they are, in fact, dark purple. Anthocyanins are the key compounds responsible for the diverse hues in plant organs. Cyanidin plays an important role in the deposition of black pigments in various plant organs, such as flower, leaf, and fruit. A number of structural genes and transcription factors are involved in the metabolism of anthocyanins in black organs. It has been shown that the high expression of R2R3-MYB transcription factors, such as PeMYB7, PeMYB11, and CsMYB90, regulates black pigmentation in plants. This review provides a comprehensive overview of the anthocyanin pathways that are involved in the regulation of black pigments in plant organs, including flower, leaf, and fruit. It is a great starting point for further investigation into the molecular regulation mechanism of plant color and the development of novel cultivars with black plant organs.

Phosphorus absorption kinetics and exudation strategies of roots developed by three lupin species to tackle P deficiency.

MAIN CONCLUSION: Different lupin species exhibited varied biomass, P allocation, and physiological responses to P-deprivation. White and yellow lupins had higher carboxylate exudation rates, while blue lupin showed the highest phosphatase activity. White lupin (Lupinus albus) can produce specialized root structures, called cluster roots, which are adapted to low-phosphorus (P) soil. Blue lupin (L. angustifolius) and yellow lupin (L. luteus), which are two close relatives of white lupin, do not produce cluster roots. This study characterized plant responses to nutrient limitation by analyzing biomass accumulation and P distribution, absorption kinetics and root exudation in white, blue, and yellow lupins. Plants were grown in hydroponic culture with (64 µM NaH2PO4) or without P for 31 days. Under P limitation, more biomass was allocated to roots to improve P absorption. Furthermore, the relative growth rate of blue lupin showed the strongest inhibition. Under + P conditions, the plant total-P contents of blue lupin and yellow lupin were higher than that of white lupin. To elucidate the responses of lupins via the perspective of absorption kinetics and secretion analysis, blue and yellow lupins were confirmed to have stronger affinity and absorption capacity for orthophosphate after P-deprivation cultivation, whereas white lupin and yellow lupin had greater ability to secrete organic acids. The exudation of blue lupin had higher acid phosphatase activity. This study elucidated that blue lupin was more sensitive to P-scarcity stress and yellow had the greater tolerance of P-deficient condition than either of the other two lupin species. The three lupin species have evolved different adaptation strategies to cope with P deficiency.

Deep learning improves prediction of periodontal therapy effectiveness in Chinese patients.

THE OBJECTIVE: This study aims to propose a new model to predict the specific treatment effectiveness at site level by analyzing massive amounts of periodontal clinical data with deep learning methods. THE BACKGROUND DATA DISCUSSING THE PRESENT STATUS OF THE FIELD: In light of the low accuracy of current tools, the proposed models cannot fully meet the needs of clinical effectiveness prediction and cannot be applied to on site level prognosis development and formulation of specific treatment plan. MATERIALS AND METHODS: Periodontal examination data of 9273 Chinese patients were extracted and used to propose a Sequence-to-Sequence model after performing data management and reconstruction. The model was optimized by introducing the Attention mechanism. RESULTS: In the test set, the model obtained an average site-level probing depth (PD) accuracy (defined as the proportion of sites with <1 mm deviation of the predicted result from the true value) of 92.4% and high sensitivity (98.6%) for the pocket closure variable. For sites with baseline PD <5 mm, the model achieved a prediction accuracy of 94.6%, while it decreased to 79.9% at sites with PD ≥5 mm. In contrast, for teeth with initial mean PD ≥5 mm, the prediction accuracy significantly differed between molars and non-molars. CONCLUSION: Our model is the first to predict the site-level effectiveness with high accuracy and sensitivity. Future prediction models should incorporate deep learning for improved clinical prediction.

Cancer-therapy-induced mucosal injury from 2001 to 2021: A bibliometric analysis.

BACKGROUND: Cancer-therapy-induced mucosal injury (CMI) is a common and deleterious complication that affects patients undergoing cancer therapies. This study was aimed at elucidating knowledge bases and predicting research trends of this field, by analyzing the bibliographic data of CMI. METHODS: The bibliographic data of CMI from 2001 to 2021 were extracted from the Web of Science Core Collection database in March 2022. After screening, a total of 8181 articles and reviews were included in the study. CiteSpace and VOSviewer were applied to analyze and visualize cooperation, cooccurrence, cocitation, and coupling networks. RESULTS: A steady increase in publications and a burst of citation since 2019 were seen in the subject. Supportive Care in Cancer, International Journal of Radiation Oncology Biology Physics, Annals of Oncology, Cancer, and Radiotherapy and Oncology were the most influential journals of this field. The University of Adelaide, University of Texas MD Anderson Cancer Center, and Memorial Sloan Kettering Cancer Center were the top three most productive institutions. ST Sonis, RV Lalla, JB Epstein, and DMK Keefe were the authors with impressive publications and citations. The intellectual base was the publication network of improved treatments based on updating knowledge of CMI. The future trends would be the pathogenesis of CMI, mechanism-based interventions, microbiota of oral and gastrointestinal mucosa, and photobiomodulation. CONCLUSION: This study introduced the evolving publication network and predicted the research trends of CMI, which helped researchers to obtain detailed and reliable knowledge of the discipline, and focus on the most urgent unsolved problems in this field.

Houpo paiqi mixture promotes intestinal motility in constipated rats by modulating gut microbiota and activating 5-HT-cAMP-PKA signal pathway.

AIMS: Constipation is a common functional gastrointestinal disorder, which needs more effective treatment approaches. Houpo Paiqi Mixture (HPPQM) is a type of Chinese patent medicine developed from a classical formula that has been widely applied to the treatment of intestinal motility disorder. Here we aim to assess the effectiveness of HPPQM in the treatment of constipation in rat models and its potential mechanism. METHODS AND RESULTS: UPLC-MS/MS was performed to investigate the chemical component of HPPQM. Rats were randomly divided into normal control, constipation model (CM), HPPQM (low, middle and high dose) and mosapride groups. Loperamide 8 mg/kg was given orally to induce CM. The small intestine motility, colonic contraction, rectum propulsion, and histological feature of the colon were significantly improved in HPPQM group, compared with CM group (P < 0.05). Results of 16S rRNA sequencing revealed that HPPQM treatment strikingly restructured intestinal microbiota in constipated rats by increasing the relative abundances of Bacteroides and Akkermansia and decreasing the relative abundances of Prevotella and Lactobacillus. The levels of GPR43, 5-HT, 5-HT4R, cAMP, PKA were decreased while SERT was increased in constipated rats (P < 0.05), which could be restored to normal levels by treatment with HPPQM (P < 0.05). Differences in amplitude between experimental CLSMs (with HPPQM added) and control CLSMs were discovered, starting at the concentration of 40 nL/mL (P < 0.05). It was found that GLPG0974 and GR113808 could significantly reduce this reactivity (P < 0.05). CONCLUSIONS: HPPQM manifested a curative effect in constipated rats by promoting intestinal motility. The underlying mechanisms might be related to modulating gut microbiota and activating 5-HT-cAMP-PKA signal pathway.

The prognostic nutritional index predicts all-cause mortality in critically ill patients with acute myocardial infarction.

BACKGROUND: Malnutrition is common in patients with acute myocardial infarction (AMI) and is associated with a poor prognosis. The prognostic value of the prognostic nutritional index (PNI) in patients with AMI remains controversial. We aimed to explore the relationship between PNI and all-cause mortality in critically ill patients with AMI and evaluate the incremental prognostic value of PNI to commonly used prognostic assessment tools. METHODS: The Medical Information Mart for Intensive Care-IV (MIMIC-IV) database was used to conduct a retrospective cohort analysis on 1180 critically ill patients with AMI. The primary endpoints were defined as 6-month and 1-year all-cause mortality. Cox regression analysis was used to investigate the relationship between admission PNI and all-cause mortality. The effect of adding PNI to sequential organ failure assessment (SOFA) score, or charlson comorbidity index (CCI) on its discriminative ability was assessed using C-statistic, net reclassification improvement (NRI), and integrated discrimination improvement (IDI). RESULTS: Multivariate cox regression analysis demonstrated that the low PNI was regarded as an independent predictor of 1-year all-cause mortality in AMI patients admitted to ICU (adjusted Hazard Ratio: 95% CI = 1.75 (1.22-2.49)). The ROC test showed that admission PNI had a moderate predictive ability to predict all-cause mortality of critically ill patients with AMI. Furthermore, the net reclassification and integrated discrimination of the CCI alone model improved significantly with PNI. [C-statistic increased from 0.669 to 0.752, p < 0.001; NRI = 0.698, p < 0.001; IDI = 0.073, p < 0.001]. When PNI was added to the SOFA score, the C-statistic significantly improved from 0.770 to 0.805 (p < 0.001), and the NRI and IDI were estimated at 0.573 (p < 0.001) and 0.041 (p < 0.001), respectively. CONCLUSION: PNI could be a novel predictor for identifying patients at high risk of 1-year all-cause mortality in critically ill patients with AMI. The addition of PNI to the SOFA score or CCI may be useful for very early risk stratification.

Prognostic impact of in-hospital hemoglobin decline in non-overt bleeding ICU patients with acute myocardial infarction.

BACKGROUND: The prognostic value of in-hospital hemoglobin drop in non-overt bleeding patients with acute myocardial infarction (AMI) admitted to the intensive care unit (ICU) remains insufficiently investigated. METHODS: A retrospective analysis was performed based on the Medical Information Mart for Intensive Care (MIMIC)-IV database. 2,334 ICU-admitted non-overt bleeders diagnosed with AMI were included. In-hospital hemoglobin values (baseline value on admission and nadir value during hospitalization) were available. Hemoglobin drop was defined as a positive difference between admission and in-hospital nadir hemoglobin. The primary endpoint was 180-day all-cause mortality. The time-dependent Cox proportional hazard models were structured to analyze the connection between hemoglobin drop and mortality. RESULTS: 2,063 patients (88.39%) experienced hemoglobin drop during hospitalization. We categorized patients based on the degree of hemoglobin drop: no hemoglobin drop (n = 271), minimal hemoglobin drop (< 3 g/dl; n = 1661), minor hemoglobin drop (≥ 3 g/dl & < 5 g/dl, n = 284) and major hemoglobin drop (≥ 5 g/dl; n = 118). Minor (adjusted hazard ratio [HR] = 12.68; 95% confidence interval [CI]: 5.13-31.33; P < 0.001) and major (adjusted HR = 13.87; 95% CI: 4.50-42.76; P < 0.001) hemoglobin drops were independently associated with increased 180-day mortality. After adjusting the baseline hemoglobin level, a robust nonlinear relationship was observed in the association between hemoglobin drop and 180-day mortality, with 1.34 g/dl as the lowest value (HR = 1.04; 95% CI: 1.00-1.08). CONCLUSION: In non-overt bleeding ICU-admitted patients with AMI, in-hospital hemoglobin drop is independently associated with higher 180-day all-cause mortality.

Association of urinary arsenic metabolism with type 2 diabetes and glucose homeostasis: Cross-sectional and longitudinal associations.

BACKGROUND: Previous researches have assessed the relationships of urinary arsenic metabolism with type 2 diabetes (T2D) and glucose-insulin homeostasis, but the results were controversial, and potential mechanisms remain largely unclear. OBJECTIVES: This study aimed to investigate the cross-sectional and longitudinal associations of urinary arsenic metabolism with T2D prevalence and glucose changes in relatively higher arsenic exposure, and further to evaluate the underlying roles of oxidative damage in these relationships. METHODS: We included 796 participants at baseline, among them 509 participants were followed up after 2 years. Logistic regression model and leave-one-out approach were applied to evaluate the associations of arsenic metabolism with T2D prevalence. Linear mixed model was conducted to estimate the relationship of arsenic metabolism with glycemic changes over two years. The associations between arsenic metabolism and indicators of oxidative stress were assessed with a linear regression model. We further performed mediation analysis to investigate the role of oxidative stress in the associations of arsenic metabolism with 2-year change of glucose levels. RESULTS: Higher urinary MMA% increased T2D prevalence and baseline glucose levels. MMA% was positively associated with 2-year change of glucose levels. Moreover, we observed significant dose-response relationship between MMA% and 8-hydroxy-2-deoxyguanosine (8-OHdG). However, the mediating role of 8-OHdG in the association of MMA% and 2-year change of glucose levels was not observed in this population. CONCLUSIONS: In this population exposure to relatively higher arsenic levels, higher MMA% contributed to increased T2D prevalence and glucose homeostasis disorder. Arsenic metabolism also affected oxidative stress levels, especially 8-OHdG. Further studies are required to investigate the potential mechanisms.

Does information disclosure among public hospitals stimulate medical cost change efforts? A pilot study in Shanghai.

BACKGROUND: In 2013, the Shanghai Hospital Development Center issued a policy to advocate public hospitals to report their information about costs on diseases. The objective was to evaluate the impact of interhospital disclosure of costs on diseases on medical costs and compare costs per case following information disclosure between hospitals of different rankings. METHODS: The study uses the hospital-level performance report issued by Shanghai Hospital Development Center in the fourth quarter of 2013, which covers quarterly aggregated hospital-level discharge data from 14 tertiary public hospitals participating in thyroid malignant tumors and colorectal malignant tumors information disclosure from the first quarter of 2012 to the third quarter of 2020. An interrupted time series model with segmented regression analysis is employed to examine changes in quarterly trends with respect to costs per case and length of stay before and after information disclosure. We identified high- and low-cost hospitals by ranking them on a costs per case basis per disease group. RESULTS: This research identified significant differences in cost changes for thyroid malignant tumors and colorectal malignant tumors between hospitals after disclosing information. A hospital's discharge costs per case for thyroid malignant tumors increased significantly among top-cost hospitals (1629.251 RMB, P = 0.019), while decreased for thyroid and colorectal malignant tumors among low-cost hospitals (-1504.189 RMB, P = 0.003; -6511.650 RMB, P = 0.024, respectively). CONCLUSION: Our findings indicate that information disclosure of costs on diseases results in changes in discharge costs per case. And low-cost hospitals continued to maintain their leading edge, whereas the high-cost hospitals changed their position in the industry by reducing discharge costs per case after information disclosure.

A shared decision-making model in pediatric palliative care: a qualitative study of healthcare providers.

BACKGROUND: Pediatric shared decision-making (SDM) is a fundamental part of family-centered care. Pediatric palliative care (PPC) is one of the more difficult fields for healthcare providers when choosing to utilize SDM. However, to our knowledge, there are still few structured approaches of SDM in PPC. We aimed to build a model of SDM in PPC that achieves better care and outcomes for children and their family members. METHODS: This study is a descriptive phenomenology study. Participants included physicians, nurses, and social workers in the PPC team. Participants were individually interviewed face-to-face or via an online meeting software. Data were collected in semi-structured interviews and analyzed using a thematic framework analysis. RESULTS: In total, 27 healthcare providers were interviewed. The model of SDM in PPC identified three themes, including the participants, the principle and the process of SDM. Decision participants involved the children, parents, the PPC team and others. The decision principle had three sub-themes including type, standard and precondition. The decision process describes the fundamental process of SDM and provides suggestions for mobilizing patients and parents to engage in decision-making and seeking conflict resolution. CONCLUSIONS: This is the first study to develop a SDM model in PPC. This model can provide guidance to PPC teams on SDM practices. In addition, the model contributes to the existing body of knowledge by providing a conceptual model for SDM in the context of PPC.

First Report of radish tubers rot caused by Enterobacter asburiae in China.

Radish (Raphanus sativus L.) is a widely consumed vegetable in China. However, radish is susceptible to diseases, which limits its yield and development in Harbin, China. In September 2021, rotten white radish tubers were observed in the field. The incidence of this disease reached 70% in October 2021, which led to huge economic losses (i.e., 30%-40%). Water-soaked lesions appeared on the radish tubers and appeared brown-yellow, which looked similar to ginger tuber rot caused by Enterobacter asburiae (Zhang et al. 2020). The interior was rotten with no considerable smell. Over time, the lesions gradually spread into all tubers of radish. Small square pieces of radish (0.5 cm × 0.5 cm) were excised from the junction of diseased and healthy tuber, disinfected with 75% alcohol, and washed three times with distilled water then ground to prepare tissue suspensions for plating. Under 28 ℃ for 16h, single colonies were isolated from the beef extract culture medium. Single colonies appeared oval, white, and smooth, with bright and slightly raised surfaces, and with moist neat edges. Gram-negative bacterial strain CCGL 988 was obtained, with an average size of 1-2 µm × 0.5-1 µm, and 3-4 flagella. Physiological and biological test results showed that strain CCGL 988 produced acid utilizing sucrose, glucose, maltobiose, D-Sorbitol, and mannitol; negative for Voges-Proskauer, methyl red, malanate, ornithine decarboxylase, arginine decarboxylase, and lysine decarboxylase. According to the results, strain CCGL 988 was identified as Enterobacter asburiae (Hoffmann et al. 2005). The 16S rDNA region of the strain was amplified using PCR with 27F/1492R primers (López et al. 2019), and partial gyrB, atpD, rpoB genes were amplified according to Zhang et al. (2020), infB gene was amplified with primers (F:TCAATGCGTGCTCGTGGTGCTC; R: TCGATACAGTGCCACTTCACG). The 16S rDNA, gyrB, atpD, rpoB and infB sequences were deposited in GenBank under accession numbers: ON999069, OP006448, OP006449, OP006450, and OP542231, respectively. These five sequences shared 99.80%, 100%, 100%, 100% and 100% of identity with E. asburiae (GenBank Accession: NO. CP011863). Maximum-likelihood phylogenetic tree clustered CCGL 988 with E. asburiae (MEGA7, bootstrap n = 1,000). Strain CCGL 988 was able to produce pectate lyases, polygalacturonases, cellulases, proteases, and extracellular polysaccharide using the methods described by Hugouviex-Cotte-Pattat et al. (2014), and Condemine et al. (1999). Koch's postulates were conducted by inoculating 20 µl of the bacterial suspension (108 CFU/ml) on the needle wound on the surface of six healthy radish tubers; six radish tubers incubated with sterile water were negative controls. Radish tubers were incubated at 28 ℃ with 80% humidity. The inoculated radish was slightly rotten after 7 days. Water-soaked lesions with light yellow were initially observed; after 12 days, the lesions expanded gradually and appeared deep yellow. No symptoms were found in the control radish. This experiment was carried out three times, each time with three replications. The bacterium was reisolated from infected radish tuber and was confirmed to be E. asburiae by the same molecular and morphological characterization as described above. This study is the first report of E. asburiae causing radish tuber rot in China. It serves as a basis for future studies to develop management strategies for the disease to prevent radish yield loss.

Clinicians' practices and attitudes regarding advance care planning in mainland China: A multicenter cross-sectional survey.

OBJECTIVES: This study aims to explore clinicians' practices and attitudes regarding advance care planning (ACP) in mainland China. METHODS: This study was a multicenter cross-sectional survey. Clinicians from tertiary hospitals in Beijing, Guangxi, and Inner Mongolia were invited to participate in the study. A questionnaire was formulated based on related literature to obtain information including demographic characteristics, and practices and attitudes toward ACP. RESULTS: The total number of participants included 285 clinicians. The data response rate was 84.57%. Most of the clinicians had an inadequate understanding of ACP. Only a few clinicians had experience in participating or witnessing an ACP or related end-of-life discussions. Among 285 clinicians, 69.82% of clinicians were willing to introduce ACP to patients. Two hundred and thirty-eight (83.51%) clinicians wanted more education on ACP. Almost all clinicians believed that patients had the right to know about their diagnosis, prognosis, and available care options. Most clinicians (82.11%) regarded that ACP was partially feasible in mainland China. If clinicians had a serious illness, almost everyone was willing to find out their true health status and decide for themselves, and 81.40% wanted to institute an ACP for themselves. The biggest barriers to the use of ACP in mainland China were cultural factors. Statistical analysis revealed that some or good understanding level (P = 0.0052) and practical experience (P = 0.0127) of ACP were associated with the positive willingness. SIGNIFICANCE OF RESULTS: ACP is still in its infancy in mainland China. Clinicians had inadequate understanding and minimal exposure to ACP. Most clinicians recognized the value and significance of ACP and had a positive attitude toward ACP. Clinicians need to be provided with education and training to promote their ACP practices. Culturally appropriate ACP processes and documents need to be developed based on Chinese culture and Chinese needs.

Improving Data Surveillance Resilience Beyond COVID-19: Experiences of Primary heAlth Care quAlity Cohort In ChinA (ACACIA) Using Unannounced Standardized Patients.

We analyzed COVID-19 influences on the design, implementation, and validity of assessing the quality of primary health care using unannounced standardized patients (USPs) in China. Because of the pandemic, we crowdsourced our funding, removed tuberculosis from the USP case roster, adjusted common cold and asthma cases, used hybrid online-offline training for USPs, shared USPs across provinces, and strengthened ethical considerations. With those changes, we were able to conduct fieldwork despite frequent COVID-19 interruptions. Furthermore, the USP assessment tool maintained high validity in the quality checklist (criteria), USP role fidelity, checklist completion, and physician detection of USPs. Our experiences suggest that the pandemic created not only barriers but also opportunities to innovate ways to build a resilient data collection system. To build data system reliance, we recommend harnessing the power of technology for a hybrid model of remote and in-person work, learning from the sharing economy to pool strengths and optimize resources, and dedicating individual and group leadership to problem-solving and results. (Am J Public Health. 2022;112(6):913-922. https://doi.org/10.2105/AJPH.2022.306779).