RESUMO
Insulin resistance and ß-cell dysfunction are two main molecular bases yet to be further elucidated for type 2 diabetes (T2D). Accumulating evidence indicates that stimulator of interferon genes (STING) plays an important role in regulating insulin sensitivity. However, its function in ß-cells remains unknown. Herein, using global STING knockout (STING-/-) and ß-cell-specific STING knockout (STING-ßKO) mouse models, we revealed a distinct role of STING in the regulation of glucose homeostasis through peripheral tissues and ß-cells. Specially, although STING-/- beneficially alleviated insulin resistance and glucose intolerance induced by high-fat diet, it surprisingly impaired islet glucose-stimulated insulin secretion (GSIS). Importantly, STING is decreased in islets of db/db mice and patients with T2D, suggesting a possible role of STING in ß-cell dysfunction. Indeed, STING-ßKO caused glucose intolerance due to impaired GSIS, indicating that STING is required for normal ß-cell function. Islet transcriptome analysis showed that STING deficiency decreased expression of ß-cell function-related genes, including Glut2, Kcnj11, and Abcc8, contributing to impaired GSIS. Mechanistically, the assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) and cleavage under targets and tagmentation (CUT&Tag) analyses suggested that Pax6 was the transcription factor that might be associated with defective GSIS in STING-ßKO mice. Indeed, Pax6 messenger RNA and protein levels were down-regulated and its nuclear localization was lost in STING-ßKO ß-cells. Together, these data revealed a function of STING in the regulation of insulin secretion and established pathophysiological significance of fine-tuned STING within ß-cells and insulin target tissues for maintaining glucose homeostasis.
Assuntos
Diabetes Mellitus Tipo 2/metabolismo , Intolerância à Glucose/induzido quimicamente , Glucose/metabolismo , Insulina/metabolismo , Proteínas de Membrana/metabolismo , Animais , Diabetes Mellitus Experimental , Dieta Hiperlipídica/efeitos adversos , Regulação para Baixo , Regulação da Expressão Gênica , Homeostase , Humanos , Insulina/sangue , Resistência à Insulina , Células Secretoras de Insulina , Proteínas de Membrana/genética , Camundongos , Camundongos KnockoutRESUMO
Recessive mutations in IER3IP1 (immediate early response 3 interacting protein 1) cause a syndrome of microcephaly, epilepsy, and permanent neonatal diabetes (MEDS). IER3IP1 encodes an endoplasmic reticulum (ER) membrane protein, which is crucial for brain development; however, the role of IER3IP1 in ß cells remains unknown. We have generated two mouse models with either constitutive or inducible IER3IP1 deletion in ß cells, named IER3IP1-ßKO and IER3IP1-ißKO, respectively. We found that IER3IP1-ßKO causes severe early-onset, insulin-deficient diabetes. Functional studies revealed a markedly dilated ß-cell ER along with increased proinsulin misfolding and elevated expression of the ER chaperones, including PDI, ERO1, BiP, and P58IPK. Islet transcriptome analysis confirmed by qRT-PCR revealed decreased expression of genes associated with ß-cell maturation, cell cycle, and antiapoptotic genes, accompanied by increased expression of antiproliferation genes. Indeed, multiple independent approaches further demonstrated that IER3IP1-ßKO impaired ß-cell maturation and proliferation, along with increased condensation of ß-cell nuclear chromatin. Inducible ß-cell IER3IP1 deletion in adult (8-wk-old) mice induced a similar diabetic phenotype, suggesting that IER3IP1 is also critical for function and survival even after ß-cell early development. Importantly, IER3IP1 was decreased in ß cells of patients with type 2 diabetes (T2D), suggesting an association of IER3IP1 deficiency with ß-cell dysfunction in the more-common form of diabetes. These data not only uncover a critical role of IER3IP1 in ß cells but also provide insight into molecular basis of diabetes caused by IER3IP1 mutations.
Assuntos
Diabetes Mellitus Tipo 2 , Células Secretoras de Insulina , Animais , Camundongos , Diabetes Mellitus Tipo 2/genética , Diabetes Mellitus Tipo 2/metabolismo , Células Secretoras de Insulina/metabolismo , Retículo Endoplasmático/genética , Retículo Endoplasmático/metabolismo , Homeostase/genética , Glucose/metabolismoRESUMO
BACKGROUND: Young patients with breast ductal carcinoma in situ (DCIS) often face a poorer prognosis. The genomic intricacies in young-onset DCIS, however, remain underexplored. METHODS: To address this gap, we undertook a comprehensive study encompassing exome, transcriptome, and vmethylome analyses. Our investigation included 20 DCIS samples (including 15 young-onset DCIS) and paired samples of normal breast tissue and blood. RESULTS: Through RNA sequencing, we identified two distinct DCIS subgroups: "immune hot" and "immune cold". The "immune hot" subgroup was characterized by increased infiltration of lymphocytes and macrophages, elevated expression of PDCD1 and CTLA4, and reduced GATA3 expression. This group also exhibited active immunerelated transcriptional regulators. Mutational analysis revealed alterations in TP53 (38%), GATA3 (25%), and TTN (19%), with two cases showing mutations in APC, ERBB2, and SMARCC1. Common genomic alterations, irrespective of immune status, included gains in copy numbers at 1q, 8q, 17q, and 20q, and losses at 11q, 17p, and 22q. Signature analysis highlighted the predominance of signatures 2 and 1, with "immune cold" samples showing a significant presence of signature 8. Our methylome study on 13 DCIS samples identified 328 hyperdifferentially methylated regions (DMRs) and 521 hypo-DMRs, with "immune cold" cases generally showing lower levels of methylation. CONCLUSION: In summary, the molecular characteristics of young-onset DCIS share similarities with invasive breast cancer (IBC), potentially indicating a poor prognosis. Understanding these characteristics, especially the immune microenvironment of DCIS, could be pivotal in identifying new therapeutic targets and preventive strategies for breast cancer.
Assuntos
Neoplasias da Mama , Carcinoma Intraductal não Infiltrante , Humanos , Feminino , Neoplasias da Mama/genética , Neoplasias da Mama/patologia , Carcinoma Intraductal não Infiltrante/genética , Carcinoma Intraductal não Infiltrante/patologia , Adulto , Mutação , Transcriptoma , Regulação Neoplásica da Expressão Gênica , Biomarcadores Tumorais/genética , Perfilação da Expressão Gênica , Pessoa de Meia-Idade , Metilação de DNA , Adulto Jovem , Genômica/métodos , Prognóstico , Exoma/genética , MultiômicaRESUMO
Refractory or relapsing metastatic triple-negative breast cancer (mTNBC) has a poor prognosis. Sacituzumab govitecan (SG) is a novel antibody-drug conjugate, targeting human trophoblast cell-surface antigen 2 (Trop-2). This is the first report of SG's efficacy and safety in Chinese patients with mTNBC. EVER-132-001 (NCT04454437) was a multicenter, single-arm, Phase IIb study in Chinese patients with mTNBC who failed ≥2 prior chemotherapy regimens. Eligible patients received 10 mg/kg SG on Days 1 and 8 of each 21-day treatment cycle, until disease progression/unacceptable toxicity. The primary endpoint was objective response rate (ORR) assessed by the Independent Review Committee. Secondary endpoints included: duration of response (DOR), clinical benefit rate (CBR), progression-free survival (PFS), overall survival (OS) and safety. Eighty female Chinese patients (median age 47.6 years; range 24-69.9 years) received ≥1 SG dose with a median of 8 treatment cycles by the cutoff date (August 6, 2021). Median number of prior systemic cancer treatments was 4.0 (range 2.0-8.0). ORR and CBR were reported 38.8% (95% confidence interval [CI]: 28.06-50.30) and 43.8% (95% CI, 32.68-55.30) of patients, respectively. The median PFS was 5.55 months (95% CI, 4.14-N/A). SG-related Grade ≥3 treatment-emergent adverse events (TEAEs) were reported in 71.3%, the most common were neutrophil count decreased (62.5%), white blood cell count decreased (48.8%) and anemia (21.3%); 6.3% discontinued SG because of TEAEs. SG demonstrated substantial clinical activity in heavily pretreated Chinese patients with mTNBC. The observed safety profile was generally manageable.
Assuntos
Imunoconjugados , Neoplasias de Mama Triplo Negativas , Humanos , Feminino , Pessoa de Meia-Idade , Neoplasias de Mama Triplo Negativas/patologia , População do Leste Asiático , Recidiva Local de Neoplasia/tratamento farmacológico , CamptotecinaRESUMO
Type 1 diabetes (T1D), which is a chronic autoimmune disease, results from the destruction of insulin-producing ß cells targeted by autoreactive T cells. The recent discovery that mesenchymal stem cell-derived extracellular vesicles (MSC-EVs) function as therapeutic tools for autoimmune conditions has attracted substantial attention. However, the in vivo distribution and therapeutic effects of MSC-EVs potentiated by pro-inflammatory cytokines in the context of T1D have yet to be established. Here, it is reported that hexyl 5-aminolevulinate hydrochloride (HAL)-loaded engineered cytokine-primed MSC-EVs (H@TI-EVs) with high expression of immune checkpoint molecule programmed death-legend 1 (PD-L1) exert excellent inflammatory targeting and immunosuppressive effects for T1D imaging and therapy. The accumulated H@TI-EVs in injured pancreas not only enabled the fluorescence imaging and tracking of TI-EVs through the intermediate product protoporphyrin (PpIX) generated by HAL, but also promoted the proliferative and anti-apoptotic effects of islet ß cells. Further analysis revealed that H@TI-EVs exhibited an impressive ability to reduce CD4+ T cell density and activation through the PD-L1/PD-1 axis, and induced M1-to-M2 macrophage transition to reshape the immune microenvironment, exhibiting high therapeutic efficiency in mice with T1D. This work identifies a novel strategy for the imaging and treatment of T1D with great potential for clinical application.
Assuntos
Diabetes Mellitus Tipo 1 , Vesículas Extracelulares , Animais , Camundongos , Citocinas/metabolismo , Diabetes Mellitus Tipo 1/terapia , Antígeno B7-H1/metabolismo , Vesículas Extracelulares/metabolismo , Linfócitos T/metabolismo , Ácido HialurônicoRESUMO
BACKGROUND: We aimed to identify the relationship between the genomic characteristics and clinical outcomes of oligo-metastatic breast cancer. METHODS: Oligo-metastatic breast cancer diagnosed by pathology from January 2001 and August 2019 were reviewed and we matched the poly-metastatic patients based on the clinicopathological features of patients included. Clinicopathological values and data of genomic alterations were collected. Oligo-recurrence (oligo-R) was defined as a situation where disease progression occurred in less than 5 anatomical sites and other anatomic areas still suppressed by the ongoing therapy. RESULTS: A total of 26 breast cancer patients were enrolled in our study, including 14 patients with strict oligo-metastatic disease (oligo-R > 6 months) and 12 with simultaneous poly-metastatic disease. PIK3CA, TP53 and ERBB2 were the most common shared alterations identified in patients included. Based on the median time of oligo-R, we divided the patients with oligo-metastasis into longer oligo-R group (oligo-R > 31.04 months) and shorter oligo-R group (oligo-R ≤ 31.04 months). The analysis of PIK3CA mutation sites showed that H1047R mutation was closely associated with oligo-metastasis, rather than poly-metastasis. H1047R mutation also predicted a better prognosis (oligo-R > 31.04 months) in oligo-metastatic breast cancer. In addition, HER2 positive was more likely to be related to a good outcome in patients with oligo-metastasis. CONCLUSIONS: Through the genetic analysis of samples from oligo-metastasis, we found the prognostic values of PIK3CA H1047R and HER2 in oligo- and poly-metastasis. We improved the stratification of prognosis and provided new insights for biological behaviors of oligo-metastatic breast cancer.
Assuntos
Neoplasias da Mama , Humanos , Feminino , Neoplasias da Mama/genética , Recidiva Local de Neoplasia/genética , Progressão da Doença , Classe I de Fosfatidilinositol 3-Quinases/genética , GenômicaRESUMO
Activation of the antibody-dependent cellular cytotoxicity is one of the key mechanisms of anti-human epidermal growth factor receptor 2 (HER2) monoclonal antibody treatment. Margetuximab is a fragment C (Fc)-modified chimeric anti-HER2 immunoglobulin G1 monoclonal antibody that shares epitope specificity with trastuzumab. In this case, we reported that margetuximab plus chemotherapy was effective as later-line therapy in a postmenopausal Chinese woman with metastatic diseases, who was diagnosed with estrogen receptor -, progesterone receptor (PR)-, HER2+ invasive ductal carcinoma. This patient used paclitaxel-albumin plus trastuzumab and pertuzumab as the first-line therapy with progression-free survival (PFS) of 14 months, and pyrotinib in combined with vinorelbine as the second-line therapy with a PFS of 17 months. Then she received margetuximab plus capecitabine as the third-line treatment, the metastatic lesions in the liver were obviously shrunk, indicating clinical partial response and the PFS was 7 months. This case revealed that margetuximab plus chemotherapy may be an appropriate option for the patients who progressed after treating with anti-HER2 monoclonal antibodies and pyrotinib.
Assuntos
Antineoplásicos , Neoplasias da Mama , Feminino , Humanos , Anticorpos Monoclonais/uso terapêutico , Antineoplásicos/uso terapêutico , Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Neoplasias da Mama/patologia , População do Leste Asiático , Receptor ErbB-2 , TrastuzumabRESUMO
Reactive fillers consisting of reduced sulfur and iron species (SFe-ReFs) have received increasing attention in tertiary wastewater treatment for nitrate and phosphate coremoval. However, the existing SFe-ReFs suffer from either low performance (e.g., pyrrhotite and pyrite) or unsatisfactory use in terms of combustible risk and residual nonreactive impurities (e.g., sulfur mixing with natural iron ores). Here, we developed a new type of sulfur-siderite composite ReF (SSCReF) with a structure of natural siderite powders eventually embedded into sulfur. SSCReFs exhibited many excellent properties, including higher mechanical strengths and hardness and especially much poorer ignitability compared to pure sulfur. By using SSCReF to construct packed-bed reactors, the highest denitrification and dephosphorization rates reached 829.70 gN/m3/d (25 wt % siderite) and 36.70 gP/m3/d (75 wt % siderite), respectively. Dephosphorization was demonstrated to be dependent on sulfur-driven denitrification, in which the acid produced from the later process promoted Fe(II) dissolution, which then directly combined with phosphate to form vivianite or further converted into phosphate adsorbents (ferrihydrite, a green rust-like compound). Water flush was an effective way to finally wash out these surface deposited Fe-P compounds, as well as those nonreactive impurities (Si and Al-bearing compounds) detached from SSCReF. Such a highly efficient and safe SSCReF holds considerable application potential in secondary effluent polishing.
Assuntos
Desnitrificação , Nitratos , Reatores Biológicos , Enxofre , Ferro , Fosfatos , Nitrogênio , Processos AutotróficosRESUMO
Biosynthesis of D-allulose has been achieved using ketose 3-epimerases (KEases), but its application is limited by poor catalytic performance. In this study, we redesigned a genetically encoded biosensor based on a D-allulose-responsive transcriptional regulator for real-time monitoring of D-allulose. An ultrahigh-throughput droplet-based microfluidic screening platform was further constructed by coupling with this D-allulose-detecting biosensor for the directed evolution of the KEases. Structural analysis of Sinorhizobium fredii D-allulose 3-epimerase (SfDAE) revealed that a highly flexible helix/loop region exposes or occludes the catalytic center as an essential lid conformation regulating substrate recognition. We reprogrammed SfDAE using structure-guided rational design and directed evolution, in which a mutant M3-2 was identified with 17-fold enhanced catalytic efficiency. Our research offers a paradigm for the design and optimization of a biosensor-based microdroplet screening platform.
Assuntos
Frutose , Racemases e Epimerases , Frutose/químicaRESUMO
PURPOSE: Findings from randomized clinical trials have shown that survival in patients with sentinel lymph node (SLN)-negative breast cancer is noninferior with SLN biopsy (SLNB) alone versus further axillary lymph node dissection (ALND). However, the long-term outcome of these two surgical approaches in pN0 breast cancer patients in real-world setting remains uncertain. METHODS: We included patients diagnosed with pathologically staged T1-2N0M0 breast cancer between 2000 and 2015 in surveillance, epidemiology, and end results 18-registry database. Patients were considered to have undergone SLNB alone if they had ≤ 5 examined lymph nodes (ELNs), and ALND if they had ≥ 10 ELNs. The outcomes included overall survival (OS) and breast cancer-specific survival. Propensity score analyses by weighting and matching and multivariable Cox regression analysis were performed to minimize treatment selection bias. RESULTS: We included 309,430 patients (253,501 SLNB and 55,929 ALND). In the weighted cohort, ALND was associated with significantly lower OS (hazard ratio [HR] 1.13; 95% confidence interval [CI] 1.10-1.16) and BCSS (HR 1.16; 95% CI 1.10-1.22) compared with SLNB alone. Both the propensity score-matching model and multivariable Cox model demonstrated a survival benefit for SLNB when compared with ALND. Subgroup analyses for key variables did not change these findings. CONCLUSION: We found statistically significant differences in OS and BCSS between SLNB and ALND, though the magnitude of these differences was small. Our findings further support that SLNB alone should be the standard of care for patients who do not have metastatic lymph nodes identified during breast cancer surgery.
Assuntos
Neoplasias da Mama , Linfonodo Sentinela , Humanos , Feminino , Biópsia de Linfonodo Sentinela/métodos , Neoplasias da Mama/patologia , Axila/patologia , Metástase Linfática/patologia , Excisão de Linfonodo/métodos , Linfonodos/cirurgia , Linfonodos/patologia , Linfonodo Sentinela/cirurgia , Linfonodo Sentinela/patologiaRESUMO
BACKGROUND: Pyrotinib (an irreversible pan-ErbB inhibitor) plus capecitabine has survival benefits and acceptable tolerability in patients with HER2-positive metastatic breast cancer. We further assessed addition of pyrotinib to trastuzumab and docetaxel in the neoadjuvant setting. METHODS: In this multicenter, double-blind, phase 3 study (PHEDRA), treatment-naive women with HER2-positive early or locally advanced breast cancer were randomly assigned (1:1) to receive four neoadjuvant cycles of oral pyrotinib or placebo (400 mg) once daily, plus intravenous trastuzumab (8 mg/kg loading dose, followed by 6 mg/kg) and docetaxel (100 mg/m2) every 3 weeks. The primary endpoint was the total pathological complete response (tpCR; ypT0/is and ypN0) rate per independent central review. RESULTS: Between Jul 23, 2018, and Jan 8, 2021, 355 patients were randomly assigned, 178 to the pyrotinib group and 177 to the placebo group. The majority of patients completed four cycles of neoadjuvant treatment as planned (92.7% and 97.7% in the pyrotinib and placebo groups, respectively). The tpCR rate was 41.0% (95% CI 34.0 to 48.4) in the pyrotinib group compared with 22.0% (95% CI 16.6 to 28.7) in the placebo group (difference, 19.0% [95% CI 9.5 to 28.4]; one-sided P < 0.0001). The objective response rate per investigator was 91.6% (95% CI 86.6 to 94.8) in the pyrotinib group and 81.9% (95% CI 75.6 to 86.9) in the placebo group after the neoadjuvant treatment, resulting in an increase of 9.7% (95% CI 2.7 to 16.6). The most common grade 3 or worse adverse events were diarrhea (79 [44.4%] in the pyrotinib group and nine [5.1%] in the placebo group), neutropenia (33 [18.5%] and 36 [20.3%]), and decreased white blood cell count (29 [16.3%] and 24 [13.6%]). No deaths were reported during neoadjuvant treatment. CONCLUSIONS: The primary endpoint of the study was met. Neoadjuvant pyrotinib, trastuzumab, and docetaxel significantly improved the tpCR rate compared with placebo, trastuzumab, and docetaxel, with manageable toxicity, providing a new option for HER2-positive early or locally advanced breast cancer. TRIAL REGISTRATION: ClinicalTrials.gov, NCT03588091.
Assuntos
Neoplasias da Mama , Humanos , Feminino , Trastuzumab , Neoplasias da Mama/patologia , Docetaxel/uso terapêutico , Terapia Neoadjuvante/efeitos adversos , Receptor ErbB-2/genética , Anticorpos Monoclonais Humanizados/efeitos adversos , Protocolos de Quimioterapia Combinada Antineoplásica/efeitos adversos , Resultado do TratamentoRESUMO
BACKGROUND: Despite significant survival improvement in human epidermal growth factor receptor 2 (HER2) blockade for HER2-positive breast cancer, resistance to anti-HER2 remains inevitable. Subsequent anti-HER2 with continuing trastuzumab beyond progression is acceptable with limited efficacy when other anti-HER2 treatment is unavailable. This single-arm, phase II study (SYSUCC-005) aimed to explore the efficacy of switching mode for HER2-positive refractory metastatic breast cancer. METHODS: Patients with HER2-positive metastatic breast cancer rapidly progressing during pre-trastuzumab from six hospitals in China were designed to switch to lapatinib 1,250 mg orally once per day continuously plus capecitabine (1,000 mg/m2 orally twice per day on days 1-14) or vinorelbine (25 mg/m2 intravenously once per day on days 1 and 8) of each 21-day cycle. The primary endpoint was progression-free survival (PFS). RESULTS: Between January 5, 2015 and May 31, 2020, 159 patients were eligible in this study. The median follow-up was 33.1 months, a median PFS of 8.5 months was achieved. Brain metastases (hazard ratio [HR] = 1.582, 95% confidence interval [CI] 1.019- 2.453, P = 0.041) and ≥ 2 metastatic sites (HR = 1.679, 95% CI 1.151-2.450, P = 0.007) were independent prognostic factors for PFS. The most common grade ≥ 3 adverse events were diarrhea (3.8%) and hand-foot syndrome (9.4%). CONCLUSION: The switching mode showed predominant efficacy, which might be a prior therapeutic option over continuing mode in subsequent anti-HER2 therapy for patients with HER2-positive refractory metastatic breast cancer. TRIAL REGISTRATION: This trial was registered on ClinicalTrials.gov ( NCT02362958 ) on 13/02/2015.
Assuntos
Neoplasias da Mama , Receptor ErbB-2 , Protocolos de Quimioterapia Combinada Antineoplásica , Neoplasias da Mama/tratamento farmacológico , Neoplasias da Mama/patologia , Feminino , Humanos , Receptor ErbB-2/metabolismo , Trastuzumab/uso terapêutico , Resultado do TratamentoRESUMO
Sponge gourd (Luffa cylindrica) and watermelon (Citrullus lanatus) are important cash crops in China. In September 2015, interveinal yellow spots and chlorosis, suspected to be caused by the tomato chlorosis virus (ToCV; genus Crinivirus), were observed on sponge gourd and watermelon plants in six greenhouses in the cities of Shouguang, Dezhou, and Taian (2 greenhouses in each city) of Shandong Province. The incidences of the disease in sponge gourd and watermelon greenhouses were 10% to 20%. To identify causative pathogens, 20 sponge gourd and 15 watermelon samples were collected from cucurbit plant facilities in Shandong Province, China. Total RNA was extracted from the samples using RNA simple Total RNA kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. Reverse transcription-polymerase chain reaction (RT-PCR) of ToCV was performed using To-CP-forward (ATGGAGAACAGTGCTGTTGC)/To-CP-reverse (TTAGCAACCAGTTATCGATGC) primer pair (Hirota et al. 2010). DNA fragments of approximately 780 bp were detected in all sponge gourd and watermelon samples. The fragments were inserted into pMD18-T vector (Takara, Shiga, Japan), which was subsequently transformed into Escherichia coli DH5α. Sponge gourd (n=1; ToCV-sponge gourd) and watermelon (n=1; ToCV-watermelon)-positive samples were selected for Sanger sequencing. BLASTN comparison of the sequencing results confirmed the presence of ToCV. The sequencing results were processed using DNAMAN version 6.0 (Lynnon Biosoft, USA) and submitted to the GenBank database (https://www.ncbi.nlm.nih.gov/). The phylogenetic tree based on ToCV coat protein (CP) was constructed using amplified ToCV-sponge gourd, ToCV-watermelon, and ToCV representative sequences in GenBank database. According to the results, the ToCV sponge gourd and watermelon sequences belonged to an independent branch with the Chinese ToCV isolate (KC812619). Sequence analysis based on nucleotide sequences of ToCV CP demonstrated that ToCV-sponge gourd and ToCV-watermelon isolates shared the highest nucleotide sequence identity of 99.7% with the Chinese isolate (KC812619). To assess the transmissibility of ToCV, virus-free whiteflies (Bemisia tabaci) (n = 30) were placed for one day on ToCV-infected sponge gourd and watermelon plants for virus acquisition. Thereafter, whiteflies were transferred onto the virus-free sponge gourd (cv. 'Changlv', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) and watermelon (cv. 'ZaoJia 8424', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) seedlings for one day. Three weeks later, all plants from tested group showed same symptoms as those observed in the greenhouses, whereas plants in the control group were symptom-free. RT-PCR analysis confirmed the ToCV infection in sponge gourd and watermelon plants, whereas control plants were found uninfected. ToCV infection in sponge gourds and watermelons has not been reported previously. To the best of our knowledge, this is the first report of sponge gourd and watermelon being natural hosts of ToCV worldwide. We believe that spread of ToCV in cucurbits needs attention.
RESUMO
Background New biomarkers are needed to identify different clinical outcomes for HER2+ breast cancer (BC). Methods Differential genes of HER2+ BC were screened based on TCGA database. We used WGCNA to identify the genes related to the survival. Genetic Algorithm was used to structure risk prediction model. The prognostic model was validated in GSE data. Results We constructed a risk prediction model of 6 genes to identify prognosis of HER2+ BC, including CLEC9A, PLD4, PIM1, PTK2B, AKNAD1 and C15orf27. Kaplan-Meier curve showed that the model effectively distinguished the survival of HER2+ BC patients. The multivariate Cox regression suggested that the risk model was an independent predictor for HER2+ BC. Analysis related to immune showed that significant differences in immune infiltration between high- and low-risk groups classified by the prognostic model. Conclusions Our study identified a risk prediction model of 6 genes that could distinguish the prognosis of HER2+ BC.
Assuntos
Neoplasias da Mama , Biomarcadores Tumorais/genética , Feminino , Humanos , PrognósticoRESUMO
It is generally accepted that land use and land management practices impact climate change through sequestration of carbon in soils, but modulation of surface energy budget can also be important. Using Landsat data to characterize cropland albedos in Canada's three prairie soil zones, this study estimates the atmospheric carbon equivalent drawdown of albedo radiative forcing for three management practices: 1) moving from conventional tillage to no-till, 2) eliminating summer fallow in crop rotations, and 3) growing crops with higher albedos. In a 50-year time horizon, conversion from conventional tillage to no-till results in a total equivalent atmospheric CO2 (CO2-eq) drawdown of 1.0-1.5 kg m-2, and conversion from summer fallow to crops results in CO2-eq drawdown of 1.1-2.4 kg m-2. Conversion of summer fallow to crops results in different magnitudes of CO2-eq drawdown depending on specific crops. Lentils, peas, and canola have relatively higher albedo than that of spring wheat and flax; hence, a larger magnitude of CO2-eq drawdown results when they replace summer fallow in the rotation. For the management changes from 1990 to 2019 for the whole Canadian Prairies, albedo changes induced a CO2-eq drawdown of about 179.3 ± 20.9 Tg due to increased area of no-till, and 101.6 ± 9.5 Tg due to reduced area under fallow. The study shows that the magnitudes of CO2-eq drawdown due to albedo change are comparable to that due to soil carbon sequestration. Therefore, it is important to account for cropland albedo changes in assessing the potential of agricultural management practices to mitigate climate change.
Assuntos
Carbono , Pradaria , Agricultura , Canadá , Carbono/análise , Mudança Climática , SoloRESUMO
BACKGROUND: Despite therapeutic advances in HER2-positive metastatic breast cancer, resistance to trastuzumab inevitably develops. In the PHOEBE study, we aimed to assess the efficacy and safety of pyrotinib (an irreversible pan-HER inhibitor) plus capecitabine after previous trastuzumab. METHODS: This is an open-label, randomised, controlled, phase 3 trial done at 29 hospitals in China. Patients with pathologically confirmed HER2-positive metastatic breast cancer, aged 18-70 years, who had an Eastern Cooperative Oncology Group performance status of 0 or 1, and had been previously treated with trastuzumab and taxanes were randomly assigned (1:1) to receive oral pyrotinib 400 mg or lapatinib 1250 mg once daily plus oral capecitabine 1000 mg/m2 twice daily on days 1-14 of each 21-day cycle. Randomisation was done via a centralised interactive web-response system with a block size of four or six and stratified by hormone receptor status and previous lines of chemotherapy for metastatic disease. The primary endpoint was progression-free survival according to masked independent central review. Efficacy and safety were assessed in all patients who received at least one dose of the study drugs. Results presented here are from a prespecified interim analysis. This study is registered with ClinicalTrials.gov, NCT03080805. FINDINGS: Between July 31, 2017, and Oct 30, 2018, 267 patients were enrolled and randomly assigned. 134 patients received pyrotinib plus capecitabine and 132 received lapatinib plus capecitabine. At data cutoff of the interim analysis on March 31, 2019, median progression-free survival was significantly longer with pyrotinib plus capecitabine (12·5 months [95% CI 9·7-not reached]) than with lapatinib plus capecitabine (6·8 months [5·4-8·1]; hazard ratio 0·39 [95% CI 0·27-0·56]; one-sided p<0·0001). The most common grade 3 or worse adverse events were diarrhoea (41 [31%] in the pyrotinib group vs 11 [8%] in the lapatinib group) and hand-foot syndrome (22 [16%] vs 20 [15%]). Serious adverse events were reported for 14 (10%) patients in the pyrotinib group and 11 (8%) patients in the lapatinib group. No treatment-related deaths were reported in the pyrotinib group and one sudden death in the lapatinib group was considered treatment related. INTERPRETATION: Pyrotinib plus capecitabine significantly improved progression-free survival compared with that for lapatinib plus capecitabine, with manageable toxicity, and can be considered an alternative treatment option for patients with HER2-positive metastatic breast cancer after trastuzumab and chemotherapy. FUNDING: Jiangsu Hengrui Medicine and National Key R&D Program of China. TRANSLATIONS: For the Chinese translation of the abstract see Supplementary Materials section.
Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Neoplasias da Mama/tratamento farmacológico , Receptor ErbB-2/metabolismo , Acrilamidas/administração & dosagem , Adulto , Aminoquinolinas/administração & dosagem , Neoplasias da Mama/metabolismo , Neoplasias da Mama/secundário , Capecitabina/administração & dosagem , Feminino , Seguimentos , Humanos , Lapatinib/administração & dosagem , Pessoa de Meia-Idade , Prognóstico , Taxa de SobrevidaRESUMO
Although receptor status including estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2) of the primary breast tumors was related to the prognosis of breast cancer patients, little information is yet available on whether patient management and survival are impacted by receptor conversion in breast cancer metastases. Using data from the nation-wide multicenter clinical epidemiology study of advanced breast cancer in China (NCT03047889), we report the situation of retesting ER, PR and HER2 status for breast cancer metastases and evaluate the patient management and prognostic value of receptor conversion. In total, 3295 patients were analyzed and 1583 (48.0%) patients retesting receptor status for metastasis. Discordance in one or more receptors between the primary and the metastatic biopsy was found in 37.7% of women. Patients who remained hormone receptor (HR) positive in their metastases had similar progression-free survival of first-line and second-line treatment compared to patients with HR conversion (P > .05). In multivariate analysis, patients who showed ER conversion from negative to positive had longer disease-free survival (DFS) than patients who remained negative in their metastases (hazard ratio, 2.05; 95% confidence interval [CI], 1.45-2.90; P < .001). Patients with PR remained positive and had longer DFS than patients with PR conversion from negative to positive (hazard ratio, 0.56; 95% CI, 0.38-0.83; P = .004). Patients with PR conversion have shorter overall survival than patients with PR remained positive or negative (P = .016 and P = .041, respectively). Our findings showed that the receptors' conversions were common in metastatic breast cancer, and the conversion impacted the survival.
Assuntos
Neoplasias da Mama/mortalidade , Receptor ErbB-2/metabolismo , Receptores de Estrogênio/metabolismo , Receptores de Progesterona/metabolismo , Neoplasias da Mama/metabolismo , Intervalo Livre de Doença , Estudos Epidemiológicos , Feminino , Humanos , Análise Multivariada , Metástase Neoplásica , Prognóstico , Estudos RetrospectivosRESUMO
LESSONS LEARNED: Fulvestrant 500 mg maintenance therapy showed a clinical benefit rate of 76% and median progression-free survival of 16.1 months in patients who achieved objective responses or disease control after first-line chemotherapy. Adverse events with fulvestrant maintenance therapy were consistent with the known safety profile of the drug. BACKGROUND: Evidence for maintenance hormonal therapy after chemotherapy for estrogen receptor (ER)-positive/human epidermal growth factor receptor 2 (HER2)-negative advanced breast cancer is scarce. This study aimed to evaluate the efficacy of fulvestrant 500 mg maintenance therapy in patients after first-line chemotherapy. METHODS: We enrolled postmenopausal women with ER-positive/HER2-negative advanced breast cancer who attained tumor responses or disease control with four to eight cycles of chemotherapy as first-line treatment. Fulvestrant 500 mg was injected on days 1, 15, and 29 and every 28 (±3) days thereafter. The primary endpoint was the clinical benefit rate (CBR); the secondary endpoints included the objective response rate (ORR), progression-free survival (PFS), and safety. RESULTS: We included 58 patients; the median follow-up duration was 32.6 months. The CBR since commencing fulvestrant maintenance therapy was 76% (95% confidence interval [CI], 63%-86%), and ORR was 14% (95% CI, 6%-25%); eight patients achieved partial response. The median PFS for fulvestrant maintenance therapy was 16.1 months (95% CI, 10.3-21.0 months). Thirty-nine patients (67%) reported at least one adverse event, of which most were grade 1/2, whereas three patients (5%) reported grade 3 adverse events. CONCLUSION: Fulvestrant 500 mg is a feasible and promising hormonal maintenance strategy in patients with ER-positive/HER2-negative advanced breast cancer who have no disease progression after first-line chemotherapy.
Assuntos
Neoplasias da Mama , Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Neoplasias da Mama/tratamento farmacológico , Estradiol/uso terapêutico , Feminino , Fulvestranto/farmacologia , Fulvestranto/uso terapêutico , Humanos , Receptor ErbB-2/uso terapêutico , Receptores de Estrogênio , Receptores de ProgesteronaRESUMO
PURPOSE: In the KATHERINE study (NCT01772472), patients with HER2-positive early breast cancer (EBC) and residual invasive disease after neoadjuvant chemotherapy plus HER2-targeted therapy who were treated with adjuvant trastuzumab emtansine (T-DM1) had a 50% reduction in the risk of an invasive disease-free survival (IDFS) event compared to patients treated with adjuvant trastuzumab. In metastatic disease, T-DM1 has resulted in higher rates of thrombocytopenia in Asian versus non-Asian patients. Here, we report safety and efficacy in Chinese patients from KATHERINE. METHODS: Patients with HER2-positive EBC and residual invasive disease after taxane- and trastuzumab-containing neoadjuvant chemotherapy followed by surgery were randomized 1:1 to 14 cycles of adjuvant T-DM1 or trastuzumab. The primary endpoint was time to an IDFS event. RESULTS: Among Chinese patients (T-DM1 n = 51, trastuzumab n = 50), T-DM1 treatment resulted in a 43% reduction in risk of an IDFS event compared to trastuzumab (HR = 0.57; 95% CI 0.25-1.31), with similar results for secondary endpoints. As in the global population, Chinese patients receiving T-DM1 versus trastuzumab had more grade ≥ 3 adverse events (AEs; 39.2% versus 4.1%) and AEs leading to treatment discontinuation (27.5% versus 0%). The most common grade ≥ 3 AE with T-DM1 was thrombocytopenia (21.6%), a frequency higher than the frequency in the global population (5.7%). Grade ≥ 3 hemorrhage was reported in 1 patient (T-DM1 arm). CONCLUSIONS: In the KATHERINE study, T-DM1 demonstrated increased efficacy compared to trastuzumab in Chinese patients. Consistent with previous data in Asian patients, T-DM1 was associated with more grade ≥ 3 AEs, and AEs leading to discontinuation, which was driven by an increase in thrombocytopenia.
Assuntos
Neoplasias da Mama , Maitansina , Ado-Trastuzumab Emtansina , Protocolos de Quimioterapia Combinada Antineoplásica/efeitos adversos , Neoplasias da Mama/tratamento farmacológico , China , Feminino , Humanos , Maitansina/efeitos adversos , Terapia Neoadjuvante , Receptor ErbB-2/genética , Trastuzumab/efeitos adversosRESUMO
BACKGROUND: The advanced hepatocellular carcinoma (HCC), such as the recurrent tumor after liver transplantation (LT), is an obstacle of HCC treatment. The aim of this study was to discover the underlying mechanism of HCC progression caused by non-coding RNAs (ncRNAs). METHODS: To this end, we investigated the selected patient cohort of matching primary and recurrent HCC after receiving LT. The recurrent tumors after LT were regarded as clinical models of the advanced HCC. Microarrays were used to profile lncRNA and mRNA expression in HCC recurrent and primary tissue samples. The mRNA profile characteristics were analyzed by bioinformatics. Two cell lines, HepG2 and QGY-7703, were used as HCC cell models. The protein-coding potential, length, and subcellular location of the interested lncRNAs were examined by bioinformatics, Northern blot, fluorescent in situ hybridization (FISH), and quantitative RT-PCR (qRT-PCR) assays. HCC cell proliferation was detected by CCK-8, doubling time and proliferation marker gene quantitation assays. DNA replication during the cell cycle was measured by EdU/PI staining and flow cytometry analyses. Promoter activity was measured using a luciferase reporter assay. Interactions between DNA, RNA, and protein were examined by immunoprecipitation and pull-down assays. The miRNA-target regulation was validated by a fluorescent reporter assay. RESULTS: Both lncRNA and mRNA profiles exhibited characteristic alterations in the recurrent tumor cells compared with the primary HCC. The mRNA profile in the HCC recurrent tissues, which served as model of advanced HCC, showed an aberrant cell cycle regulation. Two lncRNAs, the highly expressed lncRNA in recurrent HCC (HERH)-1 and HERH-4, were upregulated in the advanced HCC cells. HERH-1/4 enhanced proliferation and promoted DNA replication and G1-S transition during the cell cycle in HCC cells. HERH-1 interacted with the transcription factor CREB1. CREB1 enhanced cyclin A2 (CCNA2) transcription, depending on HERH-1-CREB1 interaction. HERH-4 acted as an miR-29b/c sponge to facilitate CCNA2 protein translation through a competing endogenous RNA (ceRNA) pathway. CONCLUSIONS: The oncogenic lncRNA HERH-1/4 promoted CCNA2 expression at the transcriptional and post-transcriptional levels and accelerated cell cycle progression in HCC cells. The HERH-1-CREB1-CCNA2 and HERH-4-miR-29b/c-CCNA2 axes served as molecular stimuli for HCC advance.