Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 124
Filtrar
1.
Hepatology ; 78(1): 26-44, 2023 07 01.
Artigo em Inglês | MEDLINE | ID: mdl-36107019

RESUMO

BACKGROUND AND AIM: Drug-induced liver injury (DILI) is a common disorder that involves both direct liver cell toxicity and immune activation. The bile acid receptor, G-protein-coupled bile acid receptor 1 (GPBAR1; Takeda G-protein-coupled receptor 5 [TGR5]), and cysteinyl leukotriene receptor (CYSLTR) 1 are G-protein-coupled receptors activated by bile acids and leukotrienes, exerting opposite effects on cell-to-cell adhesion, inflammation, and immune cell activation. To investigate whether GPBAR1 and CYSLTR1 mutually interact in the development of DILI, we developed an orally active small molecule, CHIN117, that functions as a GPBAR1 agonist and CYSLTR1 antagonist. APPROACH AND RESULTS: RNA-sequencing analysis of liver explants showed that acetaminophen (APAP) intoxication positively modulates the leukotriene pathway, CYSLTR1, 5-lipoxygenase, and 5-lipoxygenase activating protein, whereas GPBAR1 gene expression was unchanged. In mice, acute liver injury induced by orally dosing APAP (500 mg/kg) was severely exacerbated by Gpbar1 gene ablation and attenuated by anti-Cysltr1 small interfering RNA pretreatment. Therapeutic dosing of wild-type mice with CHIN117 reversed the liver damage caused by APAP and modulated up to 1300 genes, including 38 chemokines and receptors, that were not shared by dosing mice with a selective GPBAR1 agonist or CYSLTR1 antagonist. Coexpression of the two receptors was detected in liver sinusoidal endothelial cells (LSECs), monocytes, and Kupffer cells, whereas combinatorial modulation of CYSLTR1 and GPBAR1 potently reversed LSEC/monocyte interactions. CHIN117 reversed liver damage and liver fibrosis in mice administered CCl 4 . CONCLUSIONS: By genetic and pharmacological approaches, we demonstrated that GPBAR1 and CYSLTR1 mutually interact in the development of DILI. A combinatorial approach designed to activate GPBAR1 while inhibiting CYSLTR1 reverses liver injury in models of DILI.


Assuntos
Doença Hepática Induzida por Substâncias e Drogas , Hepatopatias , Camundongos , Animais , Ácidos e Sais Biliares/metabolismo , Araquidonato 5-Lipoxigenase/metabolismo , Células Endoteliais/metabolismo , Acetaminofen/toxicidade , Receptores Acoplados a Proteínas G/metabolismo , Hepatopatias/metabolismo , Doença Hepática Induzida por Substâncias e Drogas/etiologia , Doença Hepática Induzida por Substâncias e Drogas/metabolismo , Leucotrienos/metabolismo , Proteínas de Ligação ao GTP/metabolismo
2.
Pharmacol Res ; 208: 107403, 2024 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-39265668

RESUMO

Inflammatory bowel diseases (IBD), including Crohn's disease and ulcerative colitis, are chronic disorders characterized by dysregulated immune response and persistent inflammation. Recent studies suggest that bile acid receptors, particularly GPBAR1, and the transcription factor RORγt play critical roles in modulating intestinal inflammation. This study evaluates the therapeutic potential of PBT002, a dual GPBAR1 agonist and RORγt inverse agonist, in IBD models. The effects of PBT002 were assessed through in vitro and in vivo experiments. Macrophages and T lymphocytes obtained from the buffy coat were exposed to PBT002 to evaluate its immunomodulatory activity. The beneficial effects in vivo were evaluated in mouse models of colitis induced by TNBS, DSS or DSS + IL-23 using also a Gpbar1 knock-out male mice. PBT002 exhibited an EC50 of 1.2 µM for GPBAR1 and an IC50 of 2.8 µM for RORγt. In in vitro, PBT002 modulated macrophage polarization towards an anti-inflammatory M2 phenotype and reduced Th17 cell markers while increasing Treg markers. In the TNBS-induced colitis model, PBT002 reduced weight loss, CDAI, and colon damage, while it modulated cytokine gene expression towards an anti-inflammatory profile. In GPBAR1-/-, the anti-inflammatory effects of PBT002 were attenuated, indicating partial GPBAR1 dependence. RNA sequencing revealed significant modulation of inflammatory pathways by PBT002. In DSS+IL-23 induced colitis, PBT002 mitigated disease exacerbation, reducing pro-inflammatory cytokine levels and immune cell infiltration. In conclusion, PBT002, a GPBAR1 agonist and RORγt inverse agonist, modulates both the innate and adaptive immune responses to reduce inflammation and disease severity in models of IBD.


Assuntos
Colite , Doenças Inflamatórias Intestinais , Macrófagos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Membro 3 do Grupo F da Subfamília 1 de Receptores Nucleares , Receptores Acoplados a Proteínas G , Animais , Membro 3 do Grupo F da Subfamília 1 de Receptores Nucleares/agonistas , Membro 3 do Grupo F da Subfamília 1 de Receptores Nucleares/genética , Masculino , Doenças Inflamatórias Intestinais/tratamento farmacológico , Doenças Inflamatórias Intestinais/imunologia , Receptores Acoplados a Proteínas G/agonistas , Receptores Acoplados a Proteínas G/genética , Camundongos , Colite/tratamento farmacológico , Colite/induzido quimicamente , Colite/imunologia , Macrófagos/efeitos dos fármacos , Macrófagos/imunologia , Macrófagos/metabolismo , Anti-Inflamatórios/farmacologia , Anti-Inflamatórios/uso terapêutico , Humanos , Agonismo Inverso de Drogas , Células Th17/efeitos dos fármacos , Células Th17/imunologia , Sulfato de Dextrana , Modelos Animais de Doenças
3.
FASEB J ; 36(1): e22060, 2022 01.
Artigo em Inglês | MEDLINE | ID: mdl-34862975

RESUMO

Farnesoid-x-receptor (FXR) agonists, currently trialed in patients with non-alcoholic steatosis (NAFLD), worsen the pro-atherogenic lipid profile and might require a comedication with statin. Here we report that mice feed a high fat/high cholesterol diet (HFD) are protected from developing a pro-atherogenic lipid profile because their ability to dispose cholesterol through bile acids. This protective mechanism is mediated by suppression of FXR signaling in the liver by muricholic acids (MCAs) generated in mice from chenodeoxycholic acid (CDCA). In contrast to CDCA, MCAs are FXR antagonists and promote a CYP7A1-dependent increase of bile acids synthesis. In mice feed a HFD, the treatment with obeticholic acid, a clinical stage FXR agonist, failed to improve the liver histopathology while reduced Cyp7a1 and Cyp8b1 genes expression and bile acids synthesis and excretion. In contrast, treating mice with atorvastatin mitigated liver and vascular injury caused by the HFD while increased the bile acids synthesis and excretion. Atorvastatin increased the percentage of 7α-dehydroxylase expressing bacteria in the intestine promoting the formation of deoxycholic acid and litocholic acid, two GPBAR1 agonists, along with the expression of GPBAR1-regulated genes in the white adipose tissue and colon. In conclusion, present results highlight the central role of bile acids in regulating lipid and cholesterol metabolism in response to atorvastatin and provide explanations for limited efficacy of FXR agonists in the treatment of NAFLD.


Assuntos
Atorvastatina/farmacologia , Fígado Gorduroso/tratamento farmacológico , Fígado/metabolismo , Receptores Citoplasmáticos e Nucleares/metabolismo , Receptores Acoplados a Proteínas G/metabolismo , Transdução de Sinais/efeitos dos fármacos , Doenças Vasculares/tratamento farmacológico , Animais , Bactérias/metabolismo , Ácidos e Sais Biliares/metabolismo , Colesterol 7-alfa-Hidroxilase/metabolismo , Colesterol na Dieta/efeitos adversos , Colesterol na Dieta/farmacologia , Fígado Gorduroso/induzido quimicamente , Fígado Gorduroso/metabolismo , Fígado Gorduroso/microbiologia , Microbioma Gastrointestinal/efeitos dos fármacos , Masculino , Camundongos , Esteroide 12-alfa-Hidroxilase/metabolismo , Doenças Vasculares/induzido quimicamente , Doenças Vasculares/metabolismo , Doenças Vasculares/microbiologia
4.
Mar Drugs ; 21(5)2023 May 08.
Artigo em Inglês | MEDLINE | ID: mdl-37233485

RESUMO

The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the sponge Theonella spp. represents an arsenal of novel compounds ranging from peptides, alkaloids, terpenes, macrolides, and sterols. In this review, we summarize the recent reports on sterols isolated from this amazing sponge, describing their structural features and peculiar biological activities. We also discuss the total syntheses of solomonsterols A and B and the medicinal chemistry modifications on theonellasterol and conicasterol, focusing on the effect of chemical transformations on the biological activity of this class of metabolites. The promising compounds identified from Theonella spp. possess pronounced biological activity on nuclear receptors or cytotoxicity and result in promising candidates for extended preclinical evaluations. The identification of naturally occurring and semisynthetic marine bioactive sterols reaffirms the utility of examining natural product libraries for the discovery of new therapeutical approach to human diseases.


Assuntos
Fitosteróis , Theonella , Animais , Humanos , Esteróis/farmacologia , Esteróis/química , Receptores Citoplasmáticos e Nucleares
5.
Molecules ; 28(6)2023 Mar 21.
Artigo em Inglês | MEDLINE | ID: mdl-36985811

RESUMO

Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand this class of compounds and to understand the building blocks necessary to maintain the antagonistic activity, we describe herein the synthesis, the pharmacological evaluation, and the in vitro pharmacokinetic properties of a novel series of 1,2,4-oxadiazole derivatives decorated on the nitrogen of the piperidine ring with different N-alkyl and N-aryl side chains. In vitro pharmacological evaluation showed compounds 5 and 11 as the first examples of nonsteroidal dual FXR/Pregnane X receptor (PXR) modulators. In HepG2 cells, these compounds modulated PXR- and FXR-regulated genes, resulting in interesting leads in the treatment of inflammatory disorders. Moreover, molecular docking studies supported the experimental results, disclosing the ligand binding mode and allowing rationalization of the activities of compounds 5 and 11.


Assuntos
Receptores de Esteroides , Receptor de Pregnano X , Receptores de Esteroides/metabolismo , Receptores Citoplasmáticos e Nucleares , Simulação de Acoplamento Molecular , Biblioteca Gênica
6.
FASEB J ; 35(1): e21271, 2021 01.
Artigo em Inglês | MEDLINE | ID: mdl-33368684

RESUMO

Autophagy is a highly conserved catabolic process activated by fasting and caloric restriction. FXR, a receptor for primary bile acids, reverses the activity of cAMP-response element binding protein (CREB) on autophagy-related genes (Atg)s and terminates autophagy in the fed state. GPBAR1, a receptor for secondary bile acids, exerts its genomic effects via cAMP-CREB pathway. By genetic and pharmacological approaches, we have obtained evidence that GPBAR1 functions as a positive modulator of autophagy in liver and white adipose tissue (WAT) in fasting. Mechanistically, we found that Gpbar1-/- mice lack the expression of Cyp2c70 a gene essential for generation of muricholic acids which are FXR antagonists, and have an FXR-biased bile acid pool. Because FXR represses autophagy, Gpbar1-/- mice show a defective regulation of autophagy in fasting. BAR501, a selective GPBAR1 agonist, induces autophagy in fed mice. Defective regulation of autophagy in Gpbar1-/- could be reversed by FXR antagonism, while repression of autophagy by feeding was partially abrogated by FXR gene ablation, and FXR activation repressed Atgs in the fast state. BAR501 reversed the negative regulatory effects of feeding and FXR agonism on autophagy and promoted the recruitment of CREB to a CRE on the LC3 promoter. In mice exposed to chronic high caloric intake, GPBAR1 agonism ameliorated insulin sensitivity and induced Atgs expression in the liver and WAT. In summary, GPBAR1 is required for positive regulation of autophagy in fasting and its ligands reverse the repressive effects exerted on liver and WAT autophagy flow by FXR in fed.


Assuntos
Tecido Adiposo Branco/metabolismo , Autofagia/efeitos dos fármacos , Ácidos Cólicos/farmacologia , Fígado/metabolismo , Receptores Citoplasmáticos e Nucleares , Receptores Acoplados a Proteínas G , Animais , Autofagia/genética , Camundongos , Camundongos Knockout , Receptores Citoplasmáticos e Nucleares/antagonistas & inibidores , Receptores Citoplasmáticos e Nucleares/genética , Receptores Citoplasmáticos e Nucleares/metabolismo , Receptores Acoplados a Proteínas G/antagonistas & inibidores , Receptores Acoplados a Proteínas G/genética , Receptores Acoplados a Proteínas G/metabolismo
7.
J Chem Inf Model ; 62(1): 196-209, 2022 01 10.
Artigo em Inglês | MEDLINE | ID: mdl-34914393

RESUMO

The angiotensin-converting enzyme II (ACE2) is a key molecular player in the regulation of vessel contraction, inflammation, and reduction of oxidative stress. In addition, ACE2 has assumed a prominent role in the fight against the COVID-19 pandemic-causing virus SARS-CoV-2, as it is the very first receptor in the host of the viral spike protein. The binding of the spike protein to ACE2 triggers a cascade of events that eventually leads the virus to enter the host cell and initiate its life cycle. At the same time, SARS-CoV-2 infection downregulates ACE2 expression especially in the lung, altering the biochemical signals regulated by the enzyme and contributing to the poor clinical prognosis characterizing the late stage of the COVID-19 disease. Despite its important biological role, a very limited number of ACE2 activators are known. Here, using a combined in silico and experimental approach, we show that ursodeoxycholic acid (UDCA) derivatives work as ACE2 activators. In detail, we have identified two potent ACE2 ligands, BAR107 and BAR708, through a docking virtual screening campaign and elucidated their mechanism of action from essential dynamics of the enzyme observed during microsecond molecular dynamics calculations. The in silico results were confirmed by in vitro pharmacological assays with the newly identified compounds showing ACE2 activity comparable to that of DIZE, the most potent ACE2 activator known so far. Our work provides structural insight into ACE2/ligand-binding interaction useful for the design of compounds with therapeutic potential against SARS-CoV-2 infection, inflammation, and other ACE2-related diseases.


Assuntos
COVID-19 , Glicoproteína da Espícula de Coronavírus , Enzima de Conversão de Angiotensina 2 , Antivirais , Ácidos e Sais Biliares , Humanos , Pandemias , Ligação Proteica , SARS-CoV-2 , Glicoproteína da Espícula de Coronavírus/metabolismo
8.
J Immunol ; 204(9): 2535-2551, 2020 05 01.
Artigo em Inglês | MEDLINE | ID: mdl-32213564

RESUMO

Drug-induced liver injury caused by acetaminophen (acetyl-para-aminophenol [APAP]) is the main cause of acute liver failure and liver transplantation in several Western countries. Whereas direct toxicity exerted by APAP metabolites is a key determinant for early hepatocytes injury, the recruitment of cells of innate immunity exerts a mechanistic role in disease progression, determining the clinical outcomes. GPBAR1 is a G protein-coupled receptor for secondary bile acids placed at the interface between liver sinusoidal cells and innate immunity. In this report, using genetic and pharmacological approaches, we demonstrate that whereas Gpbar1 gene deletion worsens the severity of liver injury, its pharmacological activation by 6ß-ethyl-3a,7b-dihydroxy-5b-cholan-24-ol rescues mice from liver injury caused by APAP. This protective effect was supported by a robust attenuation of liver recruitment of monocyte-derived macrophages and their repolarization toward an anti-inflammatory phenotype. Macrophage depletion by gadolinium chloride pretreatment abrogated disease development, whereas their reconstitution by spleen-derived macrophage transplantation restored the sensitivity to APAP in a GPBAR1-dependent manner. RNA sequencing analyses demonstrated that GPBAR1 agonism modulated the expression of multiple pathways, including the chemokine CCL2 and its receptor, CCR2. Treating wild-type mice with an anti-CCL2 mAb attenuated the severity of liver injury. We demonstrated that negative regulation of CCL2 production by GPBAR1 agonism was promoter dependent and involved FOXO1. In conclusion, we have shown that GPBAR1 is an upstream modulator of CCL2/CCR2 axis at the sinusoidal cell/macrophage interface, providing a novel target in the treatment of liver damage caused by APAP.


Assuntos
Capilares/metabolismo , Doença Hepática Induzida por Substâncias e Drogas/metabolismo , Quimiocina CCL2/metabolismo , Fígado/metabolismo , Macrófagos/metabolismo , Receptores CCR2/metabolismo , Receptores Acoplados a Proteínas G/metabolismo , Acetaminofen/farmacologia , Animais , Ácidos e Sais Biliares/metabolismo , Linhagem Celular , Linhagem Celular Tumoral , Proteína Forkhead Box O1/metabolismo , Células Hep G2 , Humanos , Fígado/efeitos dos fármacos , Camundongos , Regiões Promotoras Genéticas/fisiologia , Células RAW 264.7 , Transdução de Sinais/fisiologia , Baço/efeitos dos fármacos , Baço/metabolismo , Células THP-1
9.
Int J Mol Sci ; 23(3)2022 Jan 20.
Artigo em Inglês | MEDLINE | ID: mdl-35163018

RESUMO

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.


Assuntos
DNA/química , Desoxiadenosinas/química , Quadruplex G , Oligonucleotídeos/química , Telômero , Catálise , Humanos , Estereoisomerismo
10.
Bioorg Chem ; 111: 104897, 2021 06.
Artigo em Inglês | MEDLINE | ID: mdl-33901797

RESUMO

Nonnutritive sweeteners (NNSs) are widely employed as dietary substitutes for classical sugars thanks to their safety profile and low toxicity. In this study, a re-evaluation of the biological effects of steviol (1), the main metabolite from Stevia rebaudiana glycosides, was performed using the Inverse Virtual Screening (IVS) target fishing computational approach. Starting from well-known pharmacological properties of Stevia rebaudiana glycosides, this computational tool was employed for predicting the putative interacting targets of 1 and, afterwards, of its five synthetic ester derivatives 2-6, accounting a large panel of proteins involved in cancer and inflammation events. Applying this methodology, the farnesoid X receptor (FXR) was identified as the putative target partner of 1-6. The predicted ligand-protein interactions were corroborated by transactivation assays, specifically disclosing the agonistic activity of 1 and the antagonistic activities of 2-6 on FXR. The reported results highlight the feasibility of IVS as a fast and potent tool for predicting the interacting targets of query compounds, addressing the re-evaluation of their bioactivity. In light of the obtained results, the presumably safe profile of known compounds, such as the case of steviol (1), is critically discussed.


Assuntos
Produtos Biológicos/farmacologia , Diterpenos do Tipo Caurano/farmacologia , Glicosídeos/farmacologia , Receptores Citoplasmáticos e Nucleares/agonistas , Stevia/química , Produtos Biológicos/química , Produtos Biológicos/isolamento & purificação , Diterpenos do Tipo Caurano/química , Diterpenos do Tipo Caurano/isolamento & purificação , Relação Dose-Resposta a Droga , Avaliação Pré-Clínica de Medicamentos , Glicosídeos/química , Glicosídeos/isolamento & purificação , Células Hep G2 , Humanos , Conformação Molecular , Relação Estrutura-Atividade , Células Tumorais Cultivadas
11.
Chembiochem ; 21(1-2): 129-140, 2020 01 15.
Artigo em Inglês | MEDLINE | ID: mdl-31095840

RESUMO

CD22 (Siglec-2) is a B-cell surface inhibitory protein capable of selectively recognising sialylated glycans, thus dampening autoimmune responses against self-antigens. Here we have characterised the dynamic recognition of complex-type N-glycans by human CD22 by means of orthogonal approaches including NMR spectroscopy, computational methods and biophysical assays. We provide new molecular insights into the binding mode of sialoglycans in complex with h-CD22, highlighting the role of the sialic acid galactose moieties in the recognition process, elucidating the conformational behaviour of complex-type N-glycans bound to Siglec-2 and dissecting the formation of CD22 homo-oligomers on the B-cell surface. Our results could enable the development of additional therapeutics capable of modulating the activity of h-CD22 in autoimmune diseases and malignancies derived from B-cells.


Assuntos
Simulação de Dinâmica Molecular , Polissacarídeos/química , Lectina 2 Semelhante a Ig de Ligação ao Ácido Siálico/química , Linfócitos B/química , Configuração de Carboidratos , Galactose/química , Humanos
12.
FASEB J ; 33(2): 2809-2822, 2019 02.
Artigo em Inglês | MEDLINE | ID: mdl-30303744

RESUMO

Nonalcoholic steatohepatitis (NASH) is associated with an increased risk of developing cardiovascular complications and mortality, suggesting that treatment of NASH might benefit from combined approaches that target the liver and the cardiovascular components of NASH. Using genetic and pharmacologic approaches, we show that G protein-coupled bile acid-activated receptor 1 (GPBAR1) agonism reverses liver and vascular damage in mouse models of NASH. NASH is associated with accelerated vascular inflammation representing an independent risk factor for development of cardiovascular diseases and cardiovascular-related mortality. GPBAR1, also known as TGR5, is a G protein-coupled receptor for secondary bile acids that reduces inflammation and promotes energy expenditure. Using genetic and pharmacologic approaches, we investigated whether GPBAR1 agonism by 6ß-ethyl-3α,7ß-dihydroxy-5ß-cholan-24-ol (BAR501) reverses liver and vascular damage induced by exposure to a diet enriched in fat and fructose (HFD-F). Treating HFD-F mice with BAR501 reversed liver injury and promoted the browning of white adipose tissue in a Gpbar1-dependent manner. Feeding HFD-F resulted in vascular damage, as shown by the increased aorta intima-media thickness and increased expression of inflammatory genes (IL-6,TNF-α, iNOS, and F4/80) and adhesion molecules (VCAM, intercellular adhesion molecule-1, and endothelial selectin) in the aorta, while reducing the expression of genes involved in NO and hydrogen sulfide generation, severely altering vasomotor activities of aortic rings in an ex vivo assay. BAR501 reversed this pattern in a Gpbar1-dependent manner, highlighting a potential role for GPBAR1 agonism in treating the liver and vascular component of NASH.-Carino, A., Marchianò, S., Biagioli, M., Bucci, M., Vellecco, V., Brancaleone, V., Fiorucci, C., Zampella, A., Monti, M. C., Distrutti, E., Fiorucci, S. Agonism for the bile acid receptor GPBAR1 reverses liver and vascular damage in a mouse model of steatohepatitis.


Assuntos
Colestanóis/farmacologia , Modelos Animais de Doenças , Inflamação/prevenção & controle , Hepatopatias/prevenção & controle , Hepatopatia Gordurosa não Alcoólica/fisiopatologia , Receptores Acoplados a Proteínas G/agonistas , Doenças Vasculares/prevenção & controle , Animais , Dieta Hiperlipídica/efeitos adversos , Inflamação/etiologia , Inflamação/metabolismo , Inflamação/patologia , Hepatopatias/etiologia , Hepatopatias/metabolismo , Hepatopatias/patologia , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Hepatopatia Gordurosa não Alcoólica/etiologia , Receptores Acoplados a Proteínas G/fisiologia , Doenças Vasculares/etiologia , Doenças Vasculares/metabolismo , Doenças Vasculares/patologia
13.
J Immunol ; 199(2): 718-733, 2017 07 15.
Artigo em Inglês | MEDLINE | ID: mdl-28607110

RESUMO

GPBAR1 (TGR5 or M-BAR) is a G protein-coupled receptor for secondary bile acids that is highly expressed in monocytes/macrophages. In this study, we aimed to determine the role of GPBAR1 in mediating leukocyte trafficking in chemically induced models of colitis and investigate the therapeutic potential of BAR501, a small molecule agonist for GPBAR1. These studies demonstrated that GPBAR1 gene ablation enhanced the recruitment of classically activated macrophages in the colonic lamina propria and worsened the severity of inflammation. In contrast, GPBAR1 activation by BAR501 reversed intestinal inflammation in the trinitrobenzenesulfonic acid and oxazolone models by reducing the trafficking of Ly6C+ monocytes from blood to intestinal mucosa. Exposure to BAR501 shifted intestinal macrophages from a classically activated (CD11b+, CCR7+, F4/80-) to an alternatively activated (CD11b+, CCR7-, F4/80+) phenotype, reduced the expression of inflammatory genes (TNF-α, IFN-γ, IL-1ß, IL-6, and CCL2 mRNAs), and attenuated the wasting syndrome and severity of colitis (≈70% reduction in the Colitis Disease Activity Index). The protective effect was lost in Gpbar1-/- mice. Exposure to BAR501 increased the colonic expression of IL-10 and TGF-ß mRNAs and the percentage of CD4+/Foxp3+ cells. The beneficial effects of BAR501 were lost in Il-10-/- mice. In a macrophage cell line, regulation of IL-10 by BAR501 was GPBAR1 dependent and was mediated by the recruitment of CREB to its responsive element in the IL-10 promoter. In conclusion, GPBAR1 is expressed in circulating monocytes and colonic macrophages, and its activation promotes a IL-10-dependent shift toward an alternatively activated phenotype. The targeting of GPBAR1 may offer therapeutic options in inflammatory bowel diseases.


Assuntos
Colite/imunologia , Regulação da Expressão Gênica/imunologia , Mucosa Intestinal/imunologia , Macrófagos/imunologia , Receptores Acoplados a Proteínas G/metabolismo , Animais , Antígenos Ly/genética , Antígenos Ly/imunologia , Linhagem Celular , Movimento Celular , Quimiocina CCL2/genética , Quimiocina CCL2/imunologia , Colestanóis/administração & dosagem , Colestanóis/farmacologia , Colite/induzido quimicamente , Colite/metabolismo , Inflamação/imunologia , Interleucina-10/deficiência , Interleucina-10/genética , Interleucina-10/imunologia , Interleucina-1beta/genética , Interleucina-1beta/imunologia , Interleucina-6/genética , Interleucina-6/imunologia , Ativação de Macrófagos , Macrófagos/efeitos dos fármacos , Camundongos , Mucosa/imunologia , Oxazolona/administração & dosagem , Fenótipo , Regiões Promotoras Genéticas , Receptores Acoplados a Proteínas G/agonistas , Receptores Acoplados a Proteínas G/deficiência , Receptores Acoplados a Proteínas G/genética , Linfócitos T Reguladores/efeitos dos fármacos , Linfócitos T Reguladores/imunologia , Ácido Trinitrobenzenossulfônico/administração & dosagem , Fator de Necrose Tumoral alfa/genética , Fator de Necrose Tumoral alfa/imunologia
14.
Handb Exp Pharmacol ; 256: 137-165, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31201554

RESUMO

In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic syndrome, inflammatory states, nonalcoholic steatohepatitis (NASH), and diabetes.Consequently, the development of dual FXR/GPBAR1 agonists, as well as selective targeting of one of these receptors, is considered a hopeful possibility in the treatment of these disorders. Because endogenous bile acids and steroidal ligands, which cover the same chemical space of bile acids, often target both receptor families, speculation on nonsteroidal ligands represents a promising and innovative strategy to selectively target GPBAR1 or FXR.In this review, we summarize the most recent acquisition on natural, semisynthetic, and synthetic steroidal and nonsteroidal ligands, able to interact with FXR and GPBAR1.


Assuntos
Ácidos e Sais Biliares/química , Receptores Citoplasmáticos e Nucleares/agonistas , Receptores Citoplasmáticos e Nucleares/antagonistas & inibidores , Receptores Acoplados a Proteínas G/agonistas , Receptores Acoplados a Proteínas G/antagonistas & inibidores , Ácidos e Sais Biliares/farmacologia , Humanos , Ligantes
15.
Molecules ; 24(6)2019 Mar 16.
Artigo em Inglês | MEDLINE | ID: mdl-30884797

RESUMO

As a cellular bile acid sensor, farnesoid X receptor (FXR) and the membrane G-coupled receptor (GPBAR1) participate in maintaining bile acid, lipid, and glucose homeostasis. To date, several selective and dual agonists have been developed as promising pharmacological approach to metabolic disorders, with most of them possessing an acidic conjugable function that might compromise their pharmacokinetic distribution. Here, guided by docking calculations, nonacidic 6-ethyl cholane derivatives have been prepared. In vitro pharmacological characterization resulted in the identification of bile acid receptor modulators with improved pharmacokinetic properties.


Assuntos
Colanos/química , Doenças Metabólicas/tratamento farmacológico , Receptores Citoplasmáticos e Nucleares/agonistas , Receptores Acoplados a Proteínas G/agonistas , Ácidos e Sais Biliares/metabolismo , Colanos/síntese química , Colanos/farmacocinética , Glucose/metabolismo , Células HEK293 , Células Hep G2 , Humanos , Metabolismo dos Lipídeos/efeitos dos fármacos , Doenças Metabólicas/metabolismo , Doenças Metabólicas/patologia , Simulação de Acoplamento Molecular , Estrutura Molecular , Conformação Proteica/efeitos dos fármacos , Receptores Citoplasmáticos e Nucleares/metabolismo , Receptores Acoplados a Proteínas G/metabolismo , Relação Estrutura-Atividade
16.
Pharmacol Res ; 131: 17-31, 2018 05.
Artigo em Inglês | MEDLINE | ID: mdl-29530598

RESUMO

Liver fibrosis, a major health concern worldwide, results from abnormal collagen deposition by activated hepatic stellate cells (HSCs) in an injured liver. The farnesoid-x-receptor (FXR) is a bile acid sensor that counteracts HSCs transdifferentiation. While targeting FXR holds promise, 6-ethyl-CDCA known as obeticholic acid, the first in class of FXR ligands, causes side effects, partially because the lack of selectivity toward GPBAR1, a putative itching receptor. Here, we describe the 3-deoxy-6-ethyl derivative of CDCA, BAR704, as a highly selective steroidal FXR agonist. METHODS: Liver Fibrosis was induced in mice by carbon tetrachloride (CCl4). MAIN RESULTS: In transactivation assay BAR704 activated FXR with and EC50 of 967 nM while exerted no agonistic activity on other receptors including GPBAR1. In naïve mice, BAR704 modulated the expression of FXR target genes in the liver of wild type mice but not in FXR-/- mice. In cirrhotic mice, administration of BAR704, 15 mg/kg for 9 weeks, spared the liver biosynthetic activity (bilirubin and albumin plasma levels), reduced liver fibrosis score (Sirius red staining), expression of pro-fibrogenetic (Colα1α, TGFß and αSMA) and inflammatory genes (IL-1ß, TNFα) and portal pressure. From mechanistic stand point, we have found that exposure of LX2 cells, a human HSCs line, to BAR704 increased the transcription of the short heterodimer partner (SHP) and induced the binding of this nuclear receptor to SMAD3, thus abrogating the binding of phosho-SMAD3 to the TGFß promoter. CONCLUSIONS AND APPLICATIONS: BAR704 is a selective FXR agonist that reduces liver fibrosis by interfering with the TGFß-SMAD3 pathway in HSCs. Selective FXR agonists may represent an attractive strategy for the treatment of liver fibrosis.


Assuntos
Colanos/uso terapêutico , Cirrose Hepática/tratamento farmacológico , Receptores Citoplasmáticos e Nucleares/agonistas , Transdução de Sinais/efeitos dos fármacos , Proteína Smad3/metabolismo , Fator de Crescimento Transformador beta/metabolismo , Animais , Ácido Quenodesoxicólico/análogos & derivados , Ácido Quenodesoxicólico/uso terapêutico , Regulação da Expressão Gênica/efeitos dos fármacos , Células Estreladas do Fígado/efeitos dos fármacos , Células Estreladas do Fígado/metabolismo , Células Estreladas do Fígado/patologia , Fígado/efeitos dos fármacos , Fígado/metabolismo , Fígado/patologia , Cirrose Hepática/genética , Cirrose Hepática/metabolismo , Cirrose Hepática/patologia , Masculino , Camundongos Endogâmicos C57BL , Camundongos Knockout , Receptores Citoplasmáticos e Nucleares/genética , Receptores Citoplasmáticos e Nucleares/metabolismo
17.
Am J Physiol Heart Circ Physiol ; 312(1): H21-H32, 2017 Jan 01.
Artigo em Inglês | MEDLINE | ID: mdl-27765751

RESUMO

Bile acids are end products of cholesterol metabolism generated in the liver and released in the intestine. Primary and secondary bile acids are the result of the symbiotic relation between the host and intestinal microbiota. In addition to their role in nutrient absorption, bile acids are increasingly recognized as regulatory signals that exert their function beyond the intestine by activating a network of membrane and nuclear receptors. The best characterized of these bile acid-activated receptors, GPBAR1 (also known as TGR5) and the farnesosid-X-receptor (FXR), have also been detected in the vascular system and their activation mediates the vasodilatory effects of bile acids in the systemic and splanchnic circulation. GPBAR1, is a G protein-coupled receptor, that is preferentially activated by lithocholic acid (LCA) a secondary bile acid. GPBAR1 is expressed in endothelial cells and liver sinusoidal cells (LSECs) and responds to LCA by regulating the expression of both endothelial nitric oxide synthase (eNOS) and cystathionine-γ-lyase (CSE), an enzyme involved in generation of hydrogen sulfide (H2S). Activation of CSE by GPBAR1 ligands in LSECs is due to genomic and nongenomic effects, involves protein phosphorylation, and leads to release of H2S. Despite that species-specific effects have been described, vasodilation caused by GPBAR1 ligands in the liver microcirculation and aortic rings is abrogated by inhibition of CSE but not by eNOS inhibitor. Vasodilation caused by GPBAR1 (and FXR) ligands also involves large conductance calcium-activated potassium channels likely acting downstream to H2S. The identification of GPBAR1 as a vasodilatory receptor is of relevance in the treatment of complex disorders including metabolic syndrome-associated diseases, liver steatohepatitis, and portal hypertension.


Assuntos
Gasotransmissores/metabolismo , Sulfeto de Hidrogênio/metabolismo , Receptores Citoplasmáticos e Nucleares/metabolismo , Receptores Acoplados a Proteínas G/metabolismo , Vasodilatação/fisiologia , Aorta , Cistationina gama-Liase/metabolismo , Células Endoteliais/metabolismo , Humanos , Canais de Potássio Ativados por Cálcio de Condutância Alta/metabolismo , Ácido Litocólico/metabolismo , Fígado/metabolismo , Circulação Hepática , Óxido Nítrico Sintase Tipo III/metabolismo , Sistema Porta
18.
J Nat Prod ; 80(4): 909-915, 2017 04 28.
Artigo em Inglês | MEDLINE | ID: mdl-28256837

RESUMO

The plant Gymnema sylvestre has been used widely in traditional medicine as a remedy for several diseases, and its leaf extract is known to contain a group of bioactive triterpene saponins belonging to the gymnemic acid class. Gymnemic acid I (1) is one of the main components among this group of secondary metabolites and is endowed with an interesting bioactivity profile. Since there is a lack of information about its specific biological targets, the full interactome of 1 was investigated through a quantitative chemical proteomic approach, based on stable-isotope dimethyl labeling. The ribosome complex was found to be the main partner of compound 1, and a full validation of the proteomics results was achieved by orthogonal approaches. Further biochemical and biological investigations revealed an inhibitory effect of 1 on the ribosome machinery.


Assuntos
Gymnema sylvestre/química , Inibidores da Síntese de Proteínas/análise , Proteômica , Saponinas/farmacologia , Triterpenos/farmacologia , Animais , Sobrevivência Celular/efeitos dos fármacos , Células HeLa , Humanos , Hipoglicemiantes/química , Estrutura Molecular , Ressonância Magnética Nuclear Biomolecular , Componentes Aéreos da Planta/química , Folhas de Planta/química , Biossíntese de Proteínas/efeitos dos fármacos , Saponinas/análise , Saponinas/química , Triterpenos/análise , Triterpenos/química
19.
Am J Physiol Heart Circ Physiol ; 309(1): H114-26, 2015 Jul 01.
Artigo em Inglês | MEDLINE | ID: mdl-25934094

RESUMO

GPBAR1 is a bile acid-activated receptor (BAR) for secondary bile acids, lithocholic (LCA) and deoxycholic acid (DCA), expressed in the enterohepatic tissues and in the vasculature by endothelial and smooth muscle cells. Despite that bile acids cause vasodilation, it is unclear why these effects involve GPBAR1, and the vascular phenotype of GPBAR1 deficient mice remains poorly defined. Previous studies have suggested a role for nitric oxide (NO) in regulatory activity exerted by GPBAR1 in liver endothelial cells. Hydrogen sulfide (H2S) is a vasodilatory agent generated in endothelial cells by cystathionine-γ-lyase (CSE). Here we demonstrate that GPBAR1 null mice had increased levels of primary and secondary bile acids and impaired vasoconstriction to phenylephrine. In aortic ring preparations, vasodilation caused by chenodeoxycholic acid (CDCA), a weak GPBAR1 ligand and farnesoid-x-receptor agonist (FXR), was iberiotoxin-dependent and GPBAR1-independent. In contrast, vasodilation caused by LCA was GPBAR1 dependent and abrogated by propargyl-glycine, a CSE inhibitor, and by 5ß-cholanic acid, a GPBAR1 antagonist, but not by N(5)-(1-iminoethyl)-l-ornithine (l-NIO), an endothelial NO synthase inhibitor, or iberiotoxin, a large-conductance calcium-activated potassium (BKCa) channels antagonist. In venular and aortic endothelial (HUVEC and HAEC) cells GPBAR1 activation increases CSE expression/activity and H2S production. Two cAMP response element binding protein (CREB) sites (CREs) were identified in the CSE promoter. In addition, TLCA stimulates CSE phosphorylation on serine residues. In conclusion we demonstrate that GPBAR1 mediates the vasodilatory activity of LCA and regulates the expression/activity of CSE. Vasodilation caused by CDCA involves BKCa channels. The GPBAR1/CSE pathway might contribute to endothelial dysfunction and hyperdynamic circulation in liver cirrhosis.


Assuntos
Aorta/metabolismo , Ácidos e Sais Biliares/metabolismo , Cistationina gama-Liase/genética , Sulfeto de Hidrogênio/metabolismo , Receptores Acoplados a Proteínas G/genética , Vasodilatação/genética , Animais , Aorta/efeitos dos fármacos , Ácidos e Sais Biliares/farmacologia , Ácido Quenodesoxicólico/farmacologia , Ácidos Cólicos/farmacologia , Cistationina gama-Liase/metabolismo , Células Endoteliais , Regulação da Expressão Gênica , Células Endoteliais da Veia Umbilical Humana , Humanos , Ácido Litocólico/farmacologia , Camundongos Knockout , Ornitina/análogos & derivados , Ornitina/farmacologia , Peptídeos/farmacologia , Receptores Acoplados a Proteínas G/antagonistas & inibidores , Receptores Acoplados a Proteínas G/metabolismo , Vasodilatação/efeitos dos fármacos
20.
Mar Drugs ; 12(6): 3091-115, 2014 May 27.
Artigo em Inglês | MEDLINE | ID: mdl-24871460

RESUMO

In recent years many sterols with unusual structures and promising biological profiles have been identified from marine sources. Here we report the isolation of a series of 24-alkylated-hydroxysteroids from the soft coral Sinularia kavarattiensis, acting as pregnane X receptor (PXR) modulators. Starting from this scaffold a number of derivatives were prepared and evaluated for their ability to activate the PXR by assessing transactivation and quantifying gene expression. Our study reveals that ergost-5-en-3ß-ol (4) induces PXR transactivation in HepG2 cells and stimulates the expression of the PXR target gene CYP3A4. To shed light on the molecular basis of the interaction between these ligands and PXR, we investigated, through docking simulations, the binding mechanism of the most potent compound of the series, 4, to the PXR. Our findings provide useful functional and structural information to guide further investigations and drug design.


Assuntos
Antozoários/química , Hidroxiesteroides/farmacologia , Receptores de Esteroides/efeitos dos fármacos , Animais , Citocromo P-450 CYP3A/genética , Regulação da Expressão Gênica/efeitos dos fármacos , Células Hep G2 , Humanos , Hidroxiesteroides/química , Hidroxiesteroides/isolamento & purificação , Ligantes , Simulação de Acoplamento Molecular , Receptor de Pregnano X , Receptores de Esteroides/metabolismo
SELEÇÃO DE REFERÊNCIAS
Detalhe da pesquisa