Intercalant-induced V t2g orbital occupation in vanadium oxide cathode toward fast-charging aqueous zinc-ion batteries.

Intercalation-type layered oxides have been widely explored as cathode materials for aqueous zinc-ion batteries (ZIBs). Although high-rate capability has been achieved based on the pillar effect of various intercalants for widening interlayer space, an in-depth understanding of atomic orbital variations induced by intercalants is still unknown. Herein, we design an NH4+-intercalated vanadium oxide (NH4+-V2O5) for high-rate ZIBs, together with deeply investigating the role of the intercalant in terms of atomic orbital. Besides extended layer spacing, our X-ray spectroscopies reveal that the insertion of NH4+ could promote electron transition to 3dxy state of V t2g orbital in V2O5, which significantly accelerates the electron transfer and Zn-ion migration, further verified by DFT calculations. As results, the NH4+-V2O5 electrode delivers a high capacity of 430.0 mA h g-1 at 0.1 A g-1, especially excellent rate capability (101.0 mA h g-1 at 200 C), enabling fast charging within 18 s. Moreover, the reversible V t2g orbital and lattice space variation during cycling are found via ex-situ soft X-ray absorption spectrum and in-situ synchrotron radiation X-ray diffraction, respectively. This work provides an insight at orbital level in advanced cathode materials.

Analyzing the Active Site and Predicting the Overall Activity of Alloy Catalysts.

As one of the potential catalysts, disordered solid solution alloys can offer a wealth of catalytic sites. However, accurately evaluating their activity localization structure and overall activity from each individual site remains a formidable challenge. Herein, an approach based on density functional theory and machine learning was used to obtain a large number of sites of the Pt-Ru alloy as the model multisite catalyst for the hydrogen evolution reaction. Subsequently, a series of statistical approaches were employed to unveil the relationship between the geometric structure and overall activity. Based on the radial frequency distribution of metal elements and the distribution of ΔGH, we have identified the surface and subsurface sites occupied by Pt and Ru, respectively, as the most active sites. Particularly, the concept of equivalent site ratio predicts that the overall activity is highest when the Ru content is 20-30%. Furthermore, a series of Pt-Ru alloys were synthesized to validate the proposed theory. This provides crucial insights into understanding the origin of catalytic activity in alloys and thus will better guide the rational development of targeted multisite catalysts.

Universal Intercalation/Alloying Hybrid Mechanism with -ICOHP Criterion in MAX Toward Steadily Ascending Lithium-Ion Batteries.

Profiting from the unique atomic laminated structure, metallic conductivity, and superior mechanical properties, transition metal carbides and nitrides named MAX phases have shown great potential as anodes in lithium-ion batteries. However, the complexity of MAX configurations poses a challenge. To accelerate such application, a minus integrated crystal orbital Hamilton populations descriptor is innovatively proposed to rapidly evaluate the lithium storage potential of various MAX, along with density functional theory computations. It confirms that surface A-element atoms bound to lithium ions have odds of escaping from MAX. Interestingly, the activated A-element atoms enhance the reversible uptake of lithium ions by MAX anodes through an efficient alloying reaction. As an experimental verification, the charge compensation and SnxLiy phase evolution of designed Zr2SnC MAX with optimized structure is visualized via in situ synchrotron radiation XRD and XAFS technique, which further clarifies the theoretically expected intercalation/alloying hybrid storage mechanism. Notably, Zr2SnC electrodes achieve remarkably 219.8% negative capacity attenuation over 3200 cycles at 1 A g-1. In principle, this work provides a reference for the design and development of advanced MAX electrodes, which is essential to explore diversified applications of the MAX family in specific energy fields.

X-ray Insights into Formation of -O Functional Groups on MXenes: Two-Step Dehydrogenation of Adsorbed Water.

Engineered MXene surfaces with more -O functional groups are feasible for realizing higher energy density due to their higher theoretical capacitance. However, there have been only a few explorations of this regulation mechanism. Investigating the formation source and mechanism is conducive to expanding the adjustment method from the top-down perspective. Herein, for the first time, the formation dynamics of -O functional groups on Mo2CTx are discovered as a two-step dehydrogenation of adsorbed water through in situ near-ambient-pressure X-ray photoelectron spectroscopy, further confirmed by ab initio molecular dynamics simulations. From this, the controllable substitution of -F functional groups with -O functional groups is achieved on Mo2CTx during electrochemical cycling in an aqueous electrolyte. The obtained Mo2CTx with rich -O groups exhibits a high capacitance of 163.2 F g -1 at 50 mV s -1, together with excellent stability. These results offer new insights toward engineering surface functional groups of MXenes for many specific applications.

Operando Exploring and Modulating Phase Evolution Chemistry from MAX to MXenes in Molten Salt Synthesis.

Lewis acidic molten salt method is a promising synthesis strategy for achieving MXenes with controllable surface termination from numerous MAX materials. Understanding the phase evolution chemistry during etching and post-processing is highly desirable but remains a key challenge due to the lack of suitable in-situ characterizations and the complexity of the reaction process. Herein, we introduce an operando synchrotron radiation X-ray diffraction (SRXRD) technique to unveil the phase evolution process of Nb2GaC MAX under a molten-salt ambient, proposing a controllable synthesis to achieve optimal etching through precise temperature and time adjustment. Subsequently, the phase structure of Nb2CTx MXenes is successfully tailored from hexagonal to amorphous by time-dependent persulfate oxidation. The resulting amorphous Nb2CTx with a well-patterned morphology and numerous chloride terminations exhibits highly improved specific capacity, rate capability, and long cycling for Li+ storage with a Cl-containing surface protective film. Addressing the time-related phase evolution during the entire molten salt strategy provides new insights into achieving higher efficiency and controllability in preparing MXenes and shows great potential in high-performance energy storage systems based on MXenes.

PET/NIR Fluorescence Bimodal Imaging for Targeted Tumor Detection.

Cancer is one of the greatest threats to human health due to late diagnosis and incomplete resection. The bimodal probe combines positron emission tomography (PET) imaging for noninvasive whole-body scanning with intraoperative near-infrared fluorescence (NIRF) surgical guidance for preoperative tumor detection, tumor resection during surgery, and postoperative monitoring. We developed a new PET/NIRF bimodal imaging agent, [68Ga]Ga-DOTA-NPC, covalently coupled to DCDSTCY and DOTA via ethylenediamine and radiolabeled with gallium-68, and investigated it in vitro and in vivo. The probe was found to be preferential for colon cancer cells due to the organic anion-transporting polypeptide1B3 (OATP1B3). PET/NIRF imaging allowed us to confirm [68Ga]Ga-DOTA-NPC as a promising probe for tumor detection, as it provides good biosafety and high-contrast tumor accumulation. Orthotopic and subcutaneous colon tumors were successfully resected under real-time NIRF guidance. [68Ga]Ga-DOTA-NPC provides highly sensitive and unlimited tissue-penetrating PET/NIRF imaging, helping to visualize and differentiate tumors from adjacent tissue.

Confining High-Valence Iridium Single Sites onto Nickel Oxyhydroxide for Robust Oxygen Evolution.

Enhancing activity and stability of iridium- (Ir-) based oxygen evolution reaction (OER) catalysts is of great significance in practice. Here, we report a vacancy-rich nickel hydroxide stabilized Ir single-atom catalyst (Ir1-Ni(OH)2), which achieves long-term OER stability over 260 h and much higher mass activity than commercial IrO2 in alkaline media. In situ X-ray absorption spectroscopy analysis certifies the obvious structure reconstruction of catalyst in OER. As a result, an active structure in which high-valence and peripheral oxygen ligands-rich Ir sites are confined onto the nickel oxyhydroxide surface is formed. In addition, the precise introduction of atomized Ir not only surmounts the large-range dissolution and agglomeration of Ir but also suppresses the dissolution of substrate in OER. Theoretical calculations further account for the activation of Ir single atoms and the promotion of oxygen generation by high-valence Ir, and they reveal that the deprotonation process of adsorbed OH is rate-determining.

Airborne host-plant manipulation by whiteflies via an inducible blend of plant volatiles.

The whitefly Bemisia tabaci is one of the world's most important invasive crop pests, possibly because it manipulates plant defense signaling. Upon infestation by whiteflies, plants mobilize salicylic acid (SA)-dependent defenses, which mainly target pathogens. In contrast, jasmonic acid (JA)-dependent defenses are gradually suppressed in whitefly-infested plants. The down-regulation of JA defenses make plants more susceptible to insects, including whiteflies. Here, we report that this host-plant manipulation extends to neighboring plants via airborne signals. Plants respond to insect attack with the release of a blend of inducible volatiles. Perception of these volatiles by neighboring plants usually primes them to prepare for an imminent attack. Here, however, we show that whitefly-induced tomato plant volatiles prime SA-dependent defenses and suppress JA-dependent defenses, thus rendering neighboring tomato plants more susceptible to whiteflies. Experiments with volatiles from caterpillar-damaged and pathogen-infected plants, as well as with synthetic volatiles, confirm that whiteflies modify the quality of neighboring plants for their offspring via whitefly-inducible plant volatiles.

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Occurrence of Tomato leaf curl New Delhi virus in tomato (Lycopersicon esculentum) in China.

Tomato leaf curl New Delhi virus (ToLCNDV), a member of the genus Begomovirus in the family Geminiviridae is naturally transmitted by the whitefly Bemisia tabaci (order Hemiptera, family Aleyrodidae) in a circulative and persistent manner (Moriones et al. 2017). ToLCNDV has occurred in Bangladesh, India, Indonesia, Iran, Italy, Malaysia, Pakistan, Sri Lanka, Spain, Thailand and Tunisia (Moriones et al. 2017). To date, The primary cultivated host of ToLCNDV has been identified as tomato (Lycopersicon esculentum), but the virus is also known to infect 43 other plant species from a range of families including Cucurbitaceae, Euphorbiaceae, Solanaceae, Malvaceae and Fabaceae (Zaidi et al. 2017). In August 2021, virus-like symptoms including leaf deformation and curing were observed on tomato (Lycopersicon esculentum) in a greenhouse of about 0.5 hectares in Zhejiang Province, China. To identify viral agents potentially associated with this disease, an Oxford Nanopore cDNA library from a symptomatic sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan). Libraries were constructed using Oxford Nanopore PCR-cDNA Sequencing Kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK), as recommended. Approximately 8.7 million reads were obtained from the Oxford MinION platform. After removing the adapters and low-quality reads, the clean reads were subjected to BLASTn analysis against the nt database. Approximately 797 and 168 reads produced high nt identities to the genome of ToLCNDV DNA-A (GeneBank Accession No. U15015.2) and ToLCNDV DNA-B (GeneBank Accession No. U15017.2) respectively. We designed 6 primer pairs (Table S1) to obtain the sequence of ToLCNDV Zhejiang (ToLCNDV-ZJ) isolate DNA-A and DNA-B. Briefly, total DNA from ToLCNDV-infected tomato was extracted using standard cetyl trimethylammonium bromide method. Segments of ToLCNDV DNA-A and DNA-B were amplified using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced. The obtained sequences were assembled into complete sequences of ToLCNDV-ZJ DNA-A (2,739 nt, GeneBank Accession No. OP356207) and DNA-B (2,693 nt, GeneBank Accession No. OP356208). Pairwise sequence comparison revealed that the ToLCNDV -ZJ shared the highest nt sequence identities of 98.7% and 98.4% with the genome segments of New Delhi isolate (genome A: HM159454) and India:Delhi:Cucumis:2012 isolate (genome B: KC545813) respectively. Furthermore, we performed PCR detection on 10 collected samples using the primer pair P1F and P1R. All eight symptomatic plants showing upward leaf curling and leaf distortion tested positive for ToLCNDV infection, whereas two asymptomatic plants were ToLCNDV free. To our knowledge, this is the first report of ToLCNDV infecting tomato in China, and with the widespread presence of B. tabaci in green houses, ToLCNDV may be a potential threat to the cultivation of tomato in China. In addition, ToLCNDV is an exceptional Old World bipartite begomovirus. In China, monopartite DNA satellite-associated begomoviruses with mostly narrow geographical ranges predominate, and are widespread (Li et al., 2022). The occurrence of ToLCNDV in China, which indicates that the success of this virus would become an emerging threat to vegetable and fiber crops.

Nightshade Curly Top Virus: A Possible New Virus of the Genus Topocuvirus Infecting Solanum nigrum in China.

Virus-like symptoms, including leaf deformation and curling, were observed on nightshade (Solanum nigrum) in Zhejiang Province, China. To identify possible pathogenic viruses or viroids, a symptomatic sample was subjected to deep sequencing of small interfering RNAs. Assembly of the resulting sequences led to identification of a novel geminivirus, provisionally designated nightshade curly top virus (NCTV). The complete genomic DNA sequence is 2,867 nucleotides and encodes seven open reading frames. NCTV shares 77.1% overall nucleotide sequence identity, 86.3% coat protein amino acid identity, and 78.9% replication-associated protein amino acid sequence identity with Tomato pseudo-curly top virus, a member of the genus Topocuvirus. PCR screening of nightshade field isolates indicated that NCTV is widely distributed in Zhejiang. Agrobacterium-mediated inoculation revealed that NCTV is highly infectious to Nicotiana benthamiana, S. nigrum, S. lycopersicum, and S. tuberosum. Based on pairwise comparisons and phylogenetic analyses, NCTV is proposed as a provisional member of the genus Topocuvirus.

lncRNA IGHCγ1 Acts as a ceRNA to Regulate Macrophage Inflammation via the miR-6891-3p/TLR4 Axis in Osteoarthritis.

Accumulating data have implicated that long noncoding RNA (lncRNA) plays an important role in osteoarthritis (OA), which may function as a competitive endogenous RNA (ceRNA) of microRNAs (miRNAs). lncRNA IGHCγ1 has been demonstrated to regulate inflammation and autoimmunity. Nonetheless, the altering effect of IGHCγ1 in OA remains unclear. This study is aimed at investigating the mechanism and function of lncRNA IGHCγ1 in OA. CCK-8, EdU, and transwell assays were used to estimate macrophage proliferation and migration. Fluorescence in situ hybridization (FISH) was performed to estimate the local expression of lncRNA IGHCγ1 in macrophages. Luciferase reporter assay was adopted to validate the ceRNA role of IGHCγ1 as miRNA sponge. lncRNA IGHCγ1 was primarily localized in macrophage cytoplasm and upregulated in OA. miR-6891-3p inhibited macrophage proliferation, migration, and inflammatory response by targeting TLR4, while lncRNA IGHCγ1 promoted TLR4 expression by functioning as a ceRNA for miR-6891-3p through the NF-κB signal in macrophages. This study strongly supports that lncRNA IGHCγ1 regulates inflammatory response via regulating the miR-6891-3p/TLR4/NF-κB axis in macrophages.

Occurrence of Chenopodium quinoa mitovirus 1 in Chenopodium quinoa in China.

Chenopodium quinoa mitovirus 1 (CqMV1), a member of Mitovirus in the family Mitoviridae, is the first identified plant mitovirus (Nerva et al., 2019), which has been reported to be capable of infecting different cultivars of Chenopodium quinoa including Cherry vanilla quinoa, GQU-7356 campesino Quinoa, and Wild (Nerva et al., 2019). Cultivation of C. quinoa has increased notably in China, with good agricultural and industrial results due to its nutritional value (Vega-Gálvez et al., 2010). In September 2019, leaf mottling and plant stunting were observed on C. quinoa (cv. Longli 1) plants (Fig. S1) in a field of about 0.9 acre in Qingyuan County, Zhejiang Province, China. About 33.3% (401/1200) of C. quinoa showed leaf mottling and plant stunting symptoms. To identify viral agents potentially associated with this disease, a sRNA library from a symptomatic leaf sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and the library was constructed using the Truseq Small RNA Library preparation kit (Illumina, CA, USA). Approximately 14 million raw reads were obtained from the Illumina MiSeq platform. The clean reads were obtained and assembled using the VirusDetect pipeline v1.6 (Zheng et al., 2017) for virus identification. A total of 22 assembled contigs, with sizes ranging from 42 to 306 nt, could be aligned to the genome of CqMV1 isolate Che1 (accession no. MF375475) with nucleotide identities of 96.3% to 99.1% and a cumulative alignment coverage of the CqMV1 genome of 84.0%. Except for CqMV1, no other viruses or viroids were found in the sample. Based on the assembled contigs and the reference CqMV1 genome, we designed two primer pairs (P1F: 5'- TCCGAATCTCATTTTCGGAGTGGGTAGA -3' and P1R: 5'- CAGACTTTAGATCAAATGAATACACATGT -3'; P2F: 5'- TCCAGTATACCTGTGGATAGTACTTTCA -3'and P2R: 5'- CGATCTCTGCTACCAAATACTCGTGAGCC -3') to obtain the genome sequence of CqMV1 isolate Zhejiang (CqMV1-ZJ). Total RNA from the CqMV1-infected C. quinoa plant was subject to reverse transcription (RT) using AMV reverse transcriptase (TaKaRa, Tokyo, Japan) with random primers N6 (TaKaRa, Tokyo, Japan). The cDNA was then used as the template to amplify two regions in the genome, which together covered the entire genome of CqMV1-ZJ, using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). The PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced (YouKang Co., Ltd, China). The obtained sequences were assembled into a 2,730-nt contig, representing the complete genome of CqMV1-ZJ (GenBank accession no. MT089917). Pairwise sequence comparison using the Sequence Demarcation Tool v.1.2 (Muhire et al., 2014) revealed that CqMV1-ZJ shared a sequence identity of 96.9% with the sole CqMV1 sequence available in GenBank (MF375475), thus confirming the identity of the virus as CqMV1. Furthermore, we performed RT- PCR detection on 10 collected samples using the primer pair P1F and P1R. All seven symptomatic plants tested positive for CqMV1 infection, whereas three asymptomatic plants were CqMV1-free (Fig. S1), suggesting a possible association between the virus and the symptoms observed. However, in the study by Nerva et al, two CqMV1 infected accessions (cv. Regalona and IPSP1) were found asymptomatic (Nerva et al., 2019), we therefore speculated that the symptom caused by CqMV1 varies between different C. quinoa varieties or its growth environment. To the best of our knowledge, this is the first report of CqMV1 infecting C. quinoa in China. Its ability to be transmitted through seeds (Nerva et al., 2019) and the possible pathogenicity in C. quinoa raises a serious concern for the local C. quinoa industry. The findings reported here will assist further investigations on the epidemiology and biological characteristics of CqMV1 in Zhejiang, China.

A meta-analysis of ABCG2 gene polymorphism and non-small cell lung cancer outcomes.

We aimed to analyze the correlation between ABCG2 gene polymorphisms of 34 GG/(GA + AA) loci, 421 CC/(AC + AA) loci, and non-small cell lung cancer (NSCLC) therapeutic effects via meta-analysis. With key words, the databases PubMed and EMBASE were searched for clinical studies on ABCG2 polymorphism and NSCLC. RR and 95% CIs were used to compute combined effects, followed by heterogeneity testing. Publication bias was examined using the funnel plot method. Review Manager 5.3 software was used for the meta-analysis. Ten studies were included. No evidence of heterogeneity exists in these studies. The results indicate that two polymorphic loci of ABCG2 gene (34 G>A, and 421 C>A) had no relationship with the curative effect of chemotherapy for NSCLC, except ABCG2 34G>A, which had a significant relationship with the skin toxicity complication. There was no significant relationship between these polymorphisms and complications (skin toxicity, diarrhea, interstitial pneumonia, liver dysfunction, and neutropenia). Begg's test and Egger's test indicated that there was no obvious publication bias. The meta-analysis indicated that there was no significant correlation between ABCG2 gene polymorphism and NSCLC outcomes.

Porous CoC2O4/Graphene Oxide Nanocomposite for Advanced Potassium-Ion Storage.

Potassium-ion batteries (PIBs), as one of the alternatives to lithium-ion batteries (LIBs), have attracted considerable attention on account of the affluence and low-cost of potassium. Moreover, CoC2O4 and graphene oxide (GO) have been used very well in lithium-ion batteries. Hence, the hybrid CoC2O4/GO was investigated as a new anode material for PIBs. The hybrid CoC2O4/GO was synthesized by a facile and cheap method combined with supersonic dispersion. Electrochemical measurements reveal that the hybrid CoC2O4/GO delivered an excellent cycling stability of 166 mAh g-1 at 50 mA g-1 and a superior rate capability even at 1 A g-1. These results demonstrate although the cycle ability was insufficient for practical applications, transition-metal oxalates composites can still bring new hope to the development of PIBs.

Prognostic factors for transarterial chemoembolization combined with sustained oxaliplatin-based hepatic arterial infusion chemotherapy of colorectal cancer liver metastasis.

OBJECTIVE: To investigate the prognostic factors in chemorefractory colorectal cancer liver metastasis (CRCLM) patients treated by transarterial chemoembolization (TACE) and sustained hepatic arterial infusion chemotherapy (HAIC). METHODS: Between 2006 and 2015, 162 patients who underwent 763 TACE and HAIC in total were enrolled in this retrospective study, including 110 males and 52 females, with a median age of 60 (range, 26-83) years. Prognostic factors were assessed with Log-rank test, Cox univariate and multivariate analyses. RESULTS: The median survival time (MST) and median progression-free survival (PFS) of the 162 patients from first TACE/HAIC were 15.6 months and 5.5 months respectively. Normal serum carbohydrate antigen 19-9 (CA19-9, <37 U/mL) (P<0.001) and carbohydrate antigen 72-4 (CA72-4, <6.7 U/mL) (P=0.026), combination with other local treatment (liver radiotherapy or liver radiofrequency ablation) (P=0.034) and response to TACE/HAIC (P<0.001) were significant factors related to survival after TACE/HAIC in univariate analysis. A multivariate analysis revealed that normal serum CA19-9 (P<0.001), response to TACE/HAIC (P<0.001) and combination with other local treatment (P=0.001) were independent factors among them. CONCLUSIONS: Our findings indicate that serum CA19-9 <37 U/mL and response to TACE/HAIC are significant prognostic indicators for this combined treatment, and treated with other local treatment could reach a considerable survival benefit for CRCLM. This could be useful for making decisions regarding the treatment of CRCLM.

Development of a multi-marker model combining HE4, CA125, progesterone, and estradiol for distinguishing benign from malignant pelvic masses in postmenopausal women.

The purpose of this study was to evaluate HE4, CA125, progesterone (Prog), and estradiol (E2) for differentiating pelvic masses in postmenopausal women and aimed to build a multi-marker model which may improve the diagnostic value. HE4, CA125, Prog, and E2 were detected in 57 benign pelvic masses (BPM) and 92 epithelial ovarian cancer (EOC) patients. A total of 66.66 % of the BPM and EOC serum samples were used for building the differentiation model, and the remaining 33.33 % of the BPM and EOC serum samples were used for validation of the differentiation model. After comparing by Z score statistics, HE4 + CA125 + E2 model was chosen as the best multi-marker model. In the training group, the area under curve of the HE4 + CA125 + E2 model was 0.97 (0.93, 1.00), sensitivities of the model for distinguishing BPM from EOC, from early EOC, and from advanced EOC were 90.16, 86.21, and 95.65 %; specificities were 92.11, 92.11, and 92.11 %. In the validation group, sensitivities of HE4 + CA125 + E2 model for distinguishing BPM from EOC, from early EOC, and from advanced EOC were 96.77, 100.00, and 87.50 %, specificities were 84.21, 100.00, and 84.21 %. The multi-marker model showed significant improvement when compared to CA125 or HE4, and it might be an effective pelvic mass differentiation method.

The predictive value of selected serum microRNAs for acute GVHD by TaqMan MicroRNA arrays.

Currently, the diagnosis of acute graft-versus-host disease (aGVHD) is mainly based on clinical symptoms and biopsy results. This study was designed to further explore new no noninvasive biomarkers for aGVHD prediction/diagnosis. We profiled miRNAs in serum pools from patients with aGVHD (grades II-IV) (n = 9) and non-aGVHD controls (n = 9) by real-time qPCR-based TaqMan MicroRNA arrays. Then, predictive models were established using related miRNAs (n = 38) and verified by a double-blind trial (n = 54). We found that miR-411 was significantly down regulated when aGVHD developed and recovered when aGVHD was controlled, which demonstrated that miR-411 has potential as an indicator for aGVHD monitoring. We developed and validated a predictive model and a diagnostic model for aGVHD. The predictive model included two miRNAs (miR-26b and miR-374a), which could predict an increased risk for aGVHD 1 or 2 weeks in advance, with an AUC, Positive Predictive Value (PPV), and Negative Predictive Value (NPV) of 0.722, 76.19 %, and 69.70 %, respectively. The diagnostic model included three miRNAs (miR-28-5p, miR-489, and miR-671-3p) with an AUC, PPV, and NPV of 0.841, 85.71 % and 83.33 %, respectively. Our results show that circulating miRNAs (miR-26b and miR-374a, miR-28-5p, miR-489 and miR-671-3p) may serve as biomarkers for the prediction and diagnosis of grades II-IV aGVHD.

Target hepatic artery regional chemotherapy and bevacizumab perfusion in liver metastatic colorectal cancer after failure of first-line or second-line systemic chemotherapy.

Colorectal cancer liver metastasis (CRLM) is a refractory disease after failure of first-line or second-line chemotherapy. Bevacizumab is recommended as first-line therapy for advanced colorectal cancer, but is unproven in CRLM through the hepatic artery. We report favorable outcomes with targeted vessel regional chemotherapy (TVRC) for liver metastatic gastric cancer. TVRC with FOLFOX and bevacizumab perfusion through the hepatic artery was attempted for CRLM for efficacy and safety evaluation. In a single-institution retrospective observational study, 246 patients with CRLM after at least first-line or second-line failure of systemic chemotherapy received TVRC with FOLFOX (i.e. oxaliplatin, leucovorin, and 5-fluorouracil). Of 246 patients, 63 were enrolled into two groups: group 1 (n=30) received bevacizumab and TVRC following tumor progression during previous TVRC treatments; group 2 (n=33) received TVRC plus bevacizumab for CRLM on initiating TVRC. There were no significant differences in the median survival time (14.7 vs. 13.2 months, P=0.367), although the median time to progression was significant (3.3 vs. 5.5 months, P=0.026) between groups. No severe adverse events related to TVRC plus bevacizumab perfusion occurred. Target vessel regional chemotherapy with FOLFOX plus bevacizumab perfusion through the hepatic artery was effective and safe in CRLM. The optimal combination of TVRC and bevacizumab needs further confirmation in future phase II-III clinical trials.

A novel mixed integer programming for multi-biomarker panel identification by distinguishing malignant from benign colorectal tumors.

Multi-biomarker panels can capture the nonlinear synergy among biomarkers and they are important to aid in the early diagnosis and ultimately battle complex diseases. However, identification of these multi-biomarker panels from case and control data is challenging. For example, the exhaustive search method is computationally infeasible when the data dimension is high. Here, we propose a novel method, MILP_k, to identify serum-based multi-biomarker panel to distinguish colorectal cancers (CRC) from benign colorectal tumors. Specifically, the multi-biomarker panel detection problem is modeled by a mixed integer programming to maximize the classification accuracy. Then we measured the serum profiling data for 101 CRC patients and 95 benign patients. The 61 biomarkers were analyzed individually and further their combinations by our method. We discovered 4 biomarkers as the optimal small multi-biomarker panel, including known CRC biomarkers CEA and IL-10 as well as novel biomarkers IMA and NSE. This multi-biomarker panel obtains leave-one-out cross-validation (LOOCV) accuracy to 0.7857 by nearest centroid classifier. An independent test of this panel by support vector machine (SVM) with threefold cross validation gets an AUC 0.8438. This greatly improves the predictive accuracy by 20% over the single best biomarker. Further extension of this 4-biomarker panel to a larger 13-biomarker panel improves the LOOCV to 0.8673 with independent AUC 0.8437. Comparison with the exhaustive search method shows that our method dramatically reduces the searching time by 1000-fold. Experiments on the early cancer stage samples reveal two panel of biomarkers and show promising accuracy. The proposed method allows us to select the subset of biomarkers with best accuracy to distinguish case and control samples given the number of selected biomarkers. Both receiver operating characteristic curve and precision-recall curve show our method's consistent performance gain in accuracy. Our method also shows its advantage in capturing synergy among selected biomarkers. The multi-biomarker panel far outperforms the simple combination of best single features. Close investigation of the multi-biomarker panel illustrates that our method possesses the ability to remove redundancy and reveals complementary biomarker combinations. In addition, our method is efficient and can select multi-biomarker panel with more than 5 biomarkers, for which the exhaustive methods fail. In conclusion, we propose a promising model to improve the clinical data interpretability and to serve as a useful tool for other complex disease studies. Our small multi-biomarker panel, CEA, IL-10, IMA, and NSE, may provide insights on the disease status of colorectal diseases. The implementation of our method in MATLAB is available via the website: http://doc.aporc.org/wiki/MILP_k.