Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 14 de 14
Filtrar
Mais filtros

Base de dados
País como assunto
Tipo de documento
Intervalo de ano de publicação
1.
Plant Dis ; 2023 Jun 17.
Artigo em Inglês | MEDLINE | ID: mdl-37330629

RESUMO

Grapevine asteroid mosaic-associated virus (GAMaV), a member of the genus Marafivirus of the family Tymoviridae, was first described to infect grapevines in California (Abou Ghanem-Sabanadzovic et al. 2003). Since then, GAMaV has been reported from Greece, Japan, Canada, Uruguay, France, Hungary, Italy, Spain, Switzerland and Russia, and also in some free-living grapevines in North America (Kyriakopoulou, 1991; Morán et al., 2021; Reynard et al., 2022; Shvets et al., 2022; Thompson et al., 2021). GAMaV may be associated with grapevine asteroid mosaic disease (Martelli 2014). In August 2022, a grapevine cv. Cabernet Sauvignon exhibiting chlorotic mottling was collected in Ningxia, China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNAs were then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting in 39,297,567 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (GenBank accession no PN40024) were removed using hisat2 2.1.0 software. The 15,003,158 unmapped reads were de novo assembled into 70,512 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters and analyzed through BLASTn and BLASTx analysis. Five viruses and two viroids were identified: GAMaV (5 contigs), grapevine Pinot gris virus (3 contigs), grapevine berry inner necrosis virus (3 contigs) , grapevine rupestris stem pitting-associated virus (4 contigs), grapevine red globe virus (2 contigs), grapevine yellow speckle 1 viroid (4 contigs) and hop stunt viroid (3 contigs). The five contigs of GAMaV were 352 nt~2, 224 nt in length, which were assembled from 3, 308 reads and shared 85.56%~91.81% nt identity with the genome of the GAMaV isolate GV30 (KX354202) with 93.3% coverage. To further confirm the infection of GAMaV, we designed two pairs of primers, GAMaV-mel1a/1b (5'-CACCTCGCCCCCTACCTTGAC-3'/5'-AAGAGGACGCCTTTGCGGGAG-3') and GAMaV-cp1a/1b (5'-CTAGCGACGACCGCACTGATC-3'/5'-GTCGGTGTACGAGATTTGGTC-3'), which were used to amplify the 329-bp and 440-bp fragments in the helicase (Hel) domain and coat protein (CP) gene of GAMaV genome in RT-PCR, respectively. The amplified PCR products were cloned and sequenced and the two sequences (OQ676951 and OQ676958) showed 91.2% and 93.4% nt identity with the isolate GV30, respectively. Furthermore, 429 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using the above primer pairs. The results showed that 1.4% (6/429) of the samples tested positive, including one 'Autumn seedless' grapevine (Liaoning province), two 'Dawuhezi' (Liaoning), one 'Cabernet Gernischt' (Liaoning) and two 'Cabernet Sauvignon' (Tianjing and Shandong respectively). The partial sequences of the Hel domain (OQ676952-57) and CP gene (OQ676959-61) obtained from the positive samples by sequencing showed 89.1% to 84.5% and 93.6% to 93.9% nt identity with the isolate GV30, respectively. Because these GAMaV-positive grapevines did not show distinct symptoms, GAMaV pathogenicity remains challenging to confirm. This is the first report of GAMaV in grapevines in China, extending the information on its geographical distribution.

2.
Plant Dis ; 2022 Apr 08.
Artigo em Inglês | MEDLINE | ID: mdl-35394331

RESUMO

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

3.
Acta Virol ; 66(1): 85-89, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35380868

RESUMO

We have developed methods for detecting the genetic diversity of grapevine rupestris stem pitting-associated virus (GRSPaV) based on restriction fragment length polymorphism (RFLP) and single stranded conformational polymorphism (SSCP) in the 905 nt 3' sequence. The amplicons were cloned from six grapevine cultivars, and colony polymerase chain reaction (colony PCR) using recombination bacteria was subsequently analyzed by RFLP and SSCP. Four haplotypes of SSCP and six haplotypes of Sac I RFLPs were defined. The two methods had a 40% discrepancy rate in showing the degree of diversity. All clones were sequenced and were used to construct a phylogenetic tree with seven previously reported GRSPaV sequences. In the tree, all the newly acquired sequences were divided into three clusters, I, II, and III, which corresponded to haplotypes I, II, and III of SSCP, respectively. Haplotype IV of SSCP was grouped into cluster II. A recombination analysis showed that haplotype IV has undergone a recombination event. Together, these results indicate that the SSCP assay is useful for the rapid identification of genetic diversity of GRSPaV. This is the first report of an analysis of the large fragment of GRSPaV by colony PCR-SSCP. Keywords: grapevine; grapevine rupestris stem pitting-associated virus (GRSPaV); RFLP; SSCP; genetic diversity analysis.


Assuntos
Vitis , Flexiviridae , Filogenia , Doenças das Plantas , Reação em Cadeia da Polimerase , Polimorfismo de Fragmento de Restrição , Polimorfismo Conformacional de Fita Simples
4.
Plant Dis ; 2021 Apr 09.
Artigo em Inglês | MEDLINE | ID: mdl-33834855

RESUMO

More than 30 viral and subviral pathogens infect apple (Malus domestica, an important fruit crop in China) trees and rootstocks, posing a threat to its production. With advances in diagnostic technologies, new viruses including apple rubbery wood virus 1 (ARWV-1), apple rubbery wood virus 2 (ARWV-2), apple luteovirus 1 (ALV), and citrus virus A (CiVA) have been detected (Beatriz et al. 2018; Rott et al. 2018; Hu et al. 2021). ARWV-1 (family Phenuiviridae) is a negative-sense single-stranded RNA virus with three RNA segments (large [L], medium [M], and small [S]). It causes apple rubbery wood disease (Rott et al. 2018) and is found in apple rootstocks, causing leaf yellowing and mottle symptoms in Korea (Lim et al. 2018). To determine virus prevalence in apple trees in China, 200 apple leaf and shoot samples were collected from orchards in Hebei (n = 26), Liaoning (n = 40), Shandong (n = 100), Yunnan (n = 25), Shanxi (n = 4) and Inner Mongolia (5) in 2020. Total RNA was extracted from the shoot phloem or leaf tissues (Hu et al., 2015) and subjected to reverse transcription (RT)-PCR to detect apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), apple scar skin viroid (ASSVd), ARWV-2, ARWV-1, ALVand CiVA using primers specific to respective viruses (Supplementary Table 1). The prevalence of ACLSV, ASPV, ASGV, ApNMV, ASSVd, ARWV-2, ARWV-1, ALV and CiVA was found to be 75.5%, 85.5%, 86.0%, 43.0%, 4.0%, 48.5%, 10.5%, 0% and 0%, respectively (Supplementary Table 2). Among the 21 positive samples for ARWV-1, three, five and 13 samples were from Hebei, Liaoning and Shandong, respectively. Five ARWV-1-positive samples (cultivars Xinhongjiangjun, Xiangfu-1, Xiangfu-2 and Tianhong) showed leaf mosaic symptoms. To confirm the RT-PCR assay, the projected ARWV-1 amplicons from cvs. Xiangfu-1 and Tianhong were cloned into the pMD18-T vector (Takara, Dalian, China), and three clones of each sample were sequenced. BLASTn analyses demonstrated that the sequences (accession nos. MW507810-MW507811) shared 96.9%-98.9% identity withARWV-1 sequences (MH714536, MF062127, and MF062138) in GenBank. An lncRNA library was prepared for high-throughput sequencing (HTS) with the Illumina HiSeq platform using Xiangfu-1 RNA. A total of 71,613,294 reads were obtained. De novo assembly of the reads revealed 135 viral sequence contigs of ACLSV, ASGV, ASPV, ApNMV, ARWV-1, and ARWV-2. The sequences of contig-100_88981 (302 nt) and contig-100_25701 (834 nt) (accession nos. MW507821 and MW507820) matched those of segment S from ARWV-1, whereas the sequences of contig-100_6542 (1,660 nt) and contig-100_27 (7,364 nt) (accession nos. MW507819 and MW507818) matched those of segments M and L, respectively. To confirm the HTS results, fragments of segments L (744 bp), M (747 bp), and S (554 bp) from Xiangfu-1 and Tianhong were amplified (Supplementary Table 1) and sequenced. The sequences (accession nos. MW507812-MW507817) showed 94.8%-99.9% nucleotide identity with the corresponding segments of ARWV-1. Co-infection of ARWV-1 with ApNMV and/or ARWV-2 was confirmed in 17/21 ARWV-1-positive samples. The prevalence of ARWV-1/ApNMV, ARWV-1/ARWV-2, and ARWV-1/ApNMV/ARWV-2 infections was 61.9%, 71.4%, and 52.4%, respectively. To our knowledge, this is the first report of ARWV-1 infecting apple trees in China. Further research is needed to determine whether and how ARWV-1 affects apple yield and quality.

5.
Plant Dis ; 2021 Jul 06.
Artigo em Inglês | MEDLINE | ID: mdl-34227832

RESUMO

Grapevine Kizil Sapak virus (GKSV) is a novel member of the family Betaflexiviridae classified into the proposed genus Fivivirus within the subfamily Trivirinae. It was first discovered in USA from a grapevine originating from Turkmenistan (Al Rwahnih et al. 2019) and later in France from a grapevine accession from Iran (Marais et al. 2020). In October 2019, an asymptomatic grapevine cv. 'Crimson Seedless' (native to USA) was collected from Xinjiang province in China and analyzed by high-throughput sequencing (HTS). Ribosome-depleted RNA preparations were used for library synthesis followed by HTS on an Illumina HiSeq X-ten platform. A total of 29,141,024 cleaned reads were obtained, and 7,878 contigs were generated using CLC Genomics Workbench 9.5 (QIAGEN). One long contig (7,328 bp) showed 88.2% nucleotide (nt) identity with the sequence of GKSV-127 (MN172165) via Blastx, with an average coverage of 284-X. Bioinformatic analysis of the remaining contigs showed the presence of Grapevine leafroll-associated virus 4, Grapevine rupestris vein feathering virus, Grapevine fabavirus, grapevine yellow speckle viroid-1 (GYSVd-1), GYSVd-2 and Hop stunt viroid in the sample. The presence of GKSV was checked by RT-PCR using the primer GKSV-F/R (Al Rwahnih et al. 2019); the 1,240 bp PCR product was cloned using a pTOPO-T vector (Aidlab, China) and sequenced. In pairwise comparison, the obtained nt sequences shared 92.6 to 95.2% identity to the corresponding HTS sequence, confirming the presence of GKSV in the sample. The complete GKSV genome sequence was obtained as two pieces of overlapping DNA sequence using primers GKSV-20A/20B (5'-TAGTCTGGATTTCCCTACCT/5'-CTCCCTAAACTGATTTGATG) and GKSV-25A/25B (5'-GCCACTGGTGAATGAAAAGA/5'-CTAAATGAATGGGCAGGTAT) designed based on the HTS-generated sequence. The 5' and 3' termini were determined by rapid amplification of cDNA ends using SMARTer RACE 5'/3' Kit (Takara, Dalian, China). The complete genome of GKSV isolate CS (MW582898) comprised 7,604 nt (without the polyA tail) and shared 77.8 to 89.2% identities with the other nine reported GKSV isolates, among which it shared the highest nt identity (89.2%) with GKSV-127. In phylogenetic analysis based on complete or nearly complete genome sequences of representative members of Betaflexiviridae, GKSV-CS clustered with the nine known GKSV isolates, forming a subclade with GKSV-127 (Supplementary Fig. 1). To determine the incidence and distribution of GKSV in China, 476 grapevine samples of 75 cultivars were collected from 20 provinces and tested by RT-PCR using primers GKSV-F/R (Al Rwahnih et al. 2019) and Vini-F1/R1 (Marais et al. 2020). The results showed that 0.42% (2 of 476) of the samples tested positive with both primers, including samples GKSV-CS and a 'Black Monukka' grape (native to India) also sampled from Xinjiang. Both PCR products of 'Black Monukka' were cloned and sequenced (MZ311588 to MZ311602) and they showed 85.1 to 88.9% nt identities to the GKSV-CS sequence. This is the first report of GKSV infecting grapevine in China. Although the pathogenicity of GKSV is yet to be determined, it has been found in several countries such as USA (Al Rwahnih et al. 2019), France (Marais et al. 2020) and China (this study). Both positive samples in this study were collected from Nanjiang region in Xinjiang province, indicating the sporadic occurrence of GKSV in this area.

6.
Plant Dis ; 2020 Aug 25.
Artigo em Inglês | MEDLINE | ID: mdl-32840430

RESUMO

Apple (Malus) is one of the most widely grown fruit trees worldwide, and viral diseases can severely inhibit its growth and development. Apple rubbery wood virus 2 (ARWV-2, family Phenuiviridae) is a negative-sense single-stranded RNA virus whose genome comprises three RNA segments (large: L, medium: M, and small: S) (Rott et al. 2018). This virus is associated with apple rubbery wood disease (Rott et al. 2018) and has previously been found in pear (Pyrus spp.) in China (Wang et al. 2019). In autumn 2019, six trees (one each of cvs. Honglu, Hongzhengzhu, Jinxiuhaitang, Liquanduanfu, Huahong-1, and Huahong-2) showing mosaic disease-like symptoms in the leaves and two trees (one each of cvs. Qingming-1 and Qingming-2) showing rusty skin symptoms (i.e., a large number of irregular rust spots on the peel's surface) in the fruits were found in Xingcheng, Liaoning province, China. Shoots of the diseased plants were collected, and total RNA was extracted from the phloem of the samples as described by Hu et al. (2015). Reverse transcription (RT)-PCR was used to detect various viruses including apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), and ARWV-2 as well as apple scar skin viroid (ASSVd) using their respective primers (Supplementary Table 1). ACLSV, ASPV and ASGV were detected in all samples. ApNMV was detected in the six trees with leaf mosaic symptoms and ASSVd was detected in the two trees with apple rusty skin symptoms. Moreover, five trees (cvs. Honglu, Hongzhengzhu, Jinxiuhaitang, Qingming-1, and Qingming-2) tested positive for ARWV-2 in the RT-PCR assay. The PCR products of ARWV-2 from Honglu and Qingming-2 were cloned into the pMD18-T vector (Takara, Dalian, China), and one clone of each of the samples was sequenced. BLASTn analyses showed that they shared 98.2%-99.2% nt identity with ARWV-2 sequences (MT901298-MT901299) deposited in the GenBank database. A small RNAs (sRNAs) library was prepared for high-throughput sequencing (HTS) with the Solexa-Illumina platform using phloem tissue collected from a Qingming-2 tree in which apples with rusty skin symptoms were observed. A total of 3,7746,671 reads were obtained from the library. De novo assembly of the reads yielded 1,378 viral sequence contigs. Of those, 20 contigs with lengths ranging from 82 to 387 nt were mapped to the reference genome of ARWV-2 (accession nos. MT733339-MT733344, MT901300-MT901313). In addition, contigs of ACLSV, ASPV, ASGV, ApNMV and ASSVd were detected. To further confirm the HTS results, partial length fragments of segments L (717 bp), M (645 bp), and S (657 bp) of the ARWV-2 genome were amplified from Qingming-2 using primers (Supplementary Table 1) and sequenced. The resulting sequences, which have been deposited in GenBank under the accession numbers MT364372-MT364374, showed 97.2%, 97.8%, and 98.0% nt identity, respectively, with the corresponding segments of ARWV-2 isolate R7 (accession nos. MF062144-MF062146). To understand the infection status of apple trees in China with regard to ARWV-2, 116 apple shoot samples were randomly collected from commercial orchards in Liaoning, Shanxi, and Shandong provinces and subjected to RT-PCR to detect ARWV-2, ACLSV, ASGV, ASPV, ASSVd and ApNMV. In total, 49 (42.2%) of the 116 samples tested positive for ARWV-2, suggesting that this virus is wide spread in apple trees in China (Supplementary Table 2). The mixed-infection rates of ARWV-2/ApNMV and ARWV-2/ASSVd were 18.1% (21/116) and 3.4% (4/116), respectively. Among the 46 ARWV-2-positive samples, seven had mosaic disease-like symptoms in the leaves and three had rusty skin symptoms in the fruits. To our knowledge, this is the first report of ARWV-2 infection in apples showing rusty skin symptoms, as well as the first report of ARWV-2 infection in domestic apples in China. Further research is needed to understand the distribution of ARWV-2 in apple orchards throughout China, to confirm the relationship of ARWV-2 with different symptoms and to evaluate how ARWV-2 affects the performance and quality of apple.

7.
Arch Virol ; 162(2): 577-579, 2017 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-27743254

RESUMO

The complete RNA1 and RNA2 sequences of a new grapevine fanleaf virus isolate (GFLV-SDHN) from northeastern China were determined. The two RNAs are 7,367 and 3,788 nucleotides (nt) in length, respectively, excluding the poly(A) tails. Compared to other GFLV isolates, GFLV-SDHN has a 22- to 24-nt insertion in the RNA1 5' untranslated region, and there was 19.1-20.1 % and 11.7 %-13.0 % sequence divergence in RNA1, and 15.5 %-20.5 % and 8.5-13.5 % in RNA2, at the nt and amino acid level, respectively. Phylogenetic analysis revealed that the origins of GFLV-SDHN are distinct from those of other GFLV isolates. One recombination event was identified in the 2AHP region of RNA2 in GFLV-SDHN.


Assuntos
Genoma Viral , Nepovirus/genética , Filogenia , RNA Viral/genética , Vitis/virologia , Sequência de Aminoácidos , Sequência de Bases , China , Nepovirus/classificação , Nepovirus/isolamento & purificação , Doenças das Plantas/virologia , Folhas de Planta/virologia , RNA Viral/química , Recombinação Genética
8.
Arch Virol ; 162(8): 2397-2402, 2017 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-28444538

RESUMO

Two primer pairs were used to detect apple stem pitting virus (ASPV) using a reverse transcription (RT)-PCR test. 82 out of the 141 randomly collected samples, from ten orchards in five provinces and regions of China, tested positive. In the positive samples forty-five (55%) were infected by ASPV and two other viruses. The full coat protein (CP) and the triple gene block (TGB) gene 1, 2 and 3 of partial ASPV isolates were subsequently cloned. The nucleotide and amino acid identities of 39 CP sequence variants from 31 Chinese apple samples were compared with that of previously reported ASPV isolates and were 67.4-96.0% and 68.4-97.7%, respectively. All ASPV sequence variants from Chinese apples separated into two clades with CP- and TGB-based phylogenetic trees, whilst the grouping of TGB2 and TGB3 trees was the same. Three recombinants (FS06-2, X5-2, and XLF-C-2) for CP and six (TH2-5, X8-2, FS05-2, X6-2 and XLF-A-1) recombinants for TGB were identified from the Chinese apple isolates. Two recombinants were found in the TGB sequence of isolate XLF-A-1. The results presented here may assist in the development of a more comprehensive screening tool for apple viruses.


Assuntos
Flexiviridae/genética , Flexiviridae/isolamento & purificação , Variação Genética , Malus/virologia , Doenças das Plantas/virologia , Caules de Planta/virologia , China , Primers do DNA , Doenças das Plantas/prevenção & controle , Reação em Cadeia da Polimerase
9.
Arch Virol ; 161(7): 2025-7, 2016 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-27068163

RESUMO

A new variant of grapevine berry inner necrosis virus (GINV) was identified by sequencing of small RNA extracted from 'Beta' and Thompson seedless grapevines showing leaf mottle and ring spot symptoms. However, GINV was not found in symptomless samples used as a control. The complete genome sequences of two GINV isolates (KU234316-17) were determined, and these showed 75.76-89.74% sequence identity to the genome of a previously reported Japanese GINV isolate. The new variants appear to be evolutionarily distinct from the original GINV isolate. This is the first report of GINV outside of Japan.


Assuntos
Flexiviridae/isolamento & purificação , Doenças das Plantas/virologia , Vitis/virologia , Flexiviridae/classificação , Flexiviridae/genética , Genoma Viral , Japão , Filogenia , Folhas de Planta/virologia
10.
Arch Virol ; 160(10): 2641-5, 2015 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-26215445

RESUMO

The complete nucleotide sequences of two isolates of grapevine rupestris stem pitting-associated virus (LSL and JF) collected from grapevine of Xingcheng in Liaoning Province, China, were determined. The genomes of both LSL and JF were found to contain five open reading frames (ORFs). Sequence alignments showed that the genomic sequences of JF were 76.1 %-83.5 % identical to the other ten GRSPaV isolates that have been reported previously and that the nucleotide sequence identity of isolate LSL to other isolates was no more than 78 %. Phylogenetic analysis based on the complete genome sequence indicated that JF belongs to group III and that LSL belongs to a new group (group IV). The average genetic distances of the new genetic lineage from groups I, II and III were 0.34, 0.32 and 0.33, respectively.


Assuntos
Flexiviridae/genética , Flexiviridae/isolamento & purificação , Genoma Viral , Doenças das Plantas/virologia , Vitis/virologia , Sequência de Bases , China , Flexiviridae/classificação , Dados de Sequência Molecular , Fases de Leitura Aberta , Filogenia
11.
Plants (Basel) ; 11(15)2022 Jul 23.
Artigo em Inglês | MEDLINE | ID: mdl-35893611

RESUMO

Shoot tip culture is a very effective approach for studying plant viruses. In this study, we evaluated the numbers, diversity, and titer of grapevine viruses in in vitro grapevine plants after long shoot tip culture. Six virus-infected grapevine cultivars (Cabernet Franc, Cabernet Gernischt, Cabernet Sauvignon, Wink, Victoria, and Merlot) collected from six regions of China were used as the research materials. Approximately 1.5 cm long shoot tips were used for meristem culture. The average survival rate of the six grapevine cultivars was 45.7%. Merlot collected from Beijing showed the highest survival rate (80.0%). Regeneration was not achieved in Cabernet Gernischt collected from Liaoning province and Cabernet Sauvignon from Tianjin due to bacterial and fungal contamination. Virus detection conducted in the surviving regenerated plants showed that the virus infection status, including the viral numbers and the species present in plants grown in vitro, was the same as that in corresponding in vivo plants. Moreover, the analysis of sequence diversity and the mutation frequency in grapevine viruses in vitro indicated that the structure of grapevine viruses was stable in long shoot tip culture after four sub-culture passages. Further, the relative viral titer of in vitro grapevine plants was much higher than that of in vivo plants. These results aid in the investigation of viruses in woody plants.

12.
Plants (Basel) ; 10(7)2021 Jul 20.
Artigo em Inglês | MEDLINE | ID: mdl-34371690

RESUMO

A putative new marafivirus was identified in a 'Jumeigui' grapevine exhibitting obvious vein-clearing symptoms by high-throughput sequencing, which tentatively named grapevine-associated marafivirus (GaMV). The nearly complete genomic sequence of GaMV was amplified by reverse transcription PCR, and the terminal sequences were determined using the rapid amplification of cDNA ends method. The nearly complete genome of GaMV is 6346 bp long, excluding the poly(A) tail, and shows 51.2-62.3% nucleotide identity with other members of the genera Marafivirus, Maculavirus and Tymovirus in the family Tymoviridae. Additionally, it includes five functional domains homologous to those found in members of these genera. A phylogenetic analysis showed that GaMV clustered with other species-related marafiviruses. These data support GaMV being a representative member of a novel species in the genus Marafivirus. Furthermore, GaMV was graft-transmissible and 26 of 516 (5.04%) grapevine samples from five provinces in China tested positive by reverse transcription PCR. The coat protein of GaMV isolates shared 91.7-100% and 96.7-100% identities at the nt and aa levels, respectively. The coat protein-based phylogenetic trees revealed three well-defined clusters.

13.
Front Microbiol ; 12: 694601, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34163461

RESUMO

A novel negative-sense, single-stranded (ss) RNA virus was identified in a "Shennong Jinhuanghou" (SJ) grapevine showing severe chlorotic mottling symptoms by integrating high-throughput sequencing (HTS) and conventional Sanger sequencing of reverse transcription polymerase chain reaction (RT-PCR) products. The virus was provisionally named as "grapevine emaravirus A" (GEVA). GEVA had a genome comprising five genomic RNA segments, each containing a single open reading frame on the viral complementary strand and two untranslated regions with complementary 13- nt stretches at the 5' and 3' terminal ends. RNA1 (7,090 nt), RNA2 (2,097 nt), RNA3 (1,615 nt), and RNA4 (1,640 nt) encoded putative proteins P1-P4 that, based on their conserved motifs, were identified as the RNA-dependent RNA polymerase, glycoprotein, nucleocapsid protein, and movement protein, respectively. However, the functional role of protein P5 encoded by RNA5 (1,308 nt) could not be determined. Phylogenetic trees constructed based on amino acids of P1 to P4, allocated GEVA in clade I, together with other species-related emaraviruses. These data support the proposal that GEVA is a representative member of a novel species in the genus Emaravirus of the family Fimoviridae. Moreover, when GEVA was graft-transmitted to SJ and "Beta" grapevines, all grafted plants showed the same symptoms, similar to those observed in the source of the inoculum. This is the first report to our knowledge of an emaravirus infecting grapevine and its possible association with chlorotic mottling symptoms.

14.
Plants (Basel) ; 9(10)2020 10 11.
Artigo em Inglês | MEDLINE | ID: mdl-33050558

RESUMO

Grapevine berry inner necrosis virus (GINV) belongs to the genus Trichovirus in the family Betaflexiviridae. The GINV isolate LN_BETA_RS was obtained from a "Beta" grapevine (Vitis riparia × Vitis labrusca) exhibiting chlorotic mottling and ring spot in Xingcheng, Liaoning Province, China. To verify the correlation between GINV and grapevine chlorotic mottling and ring spot disease, we constructed an infectious cDNA clone of GINV isolate LN_BETA_RS using the seamless assembly approach. Applied treatments of agroinfiltration infectious cDNA confirmed systemic GINV infection of the Nicotianaoccidentalis 37B by reverse transcription polymerase chain reaction (RT-PCR) and transmission electron microscopy, exhibiting chlorotic mottling symptoms on leaves. Infectious cDNA was also transmitted to new healthy N. occidentalis plants through rub-inoculation. Moreover, the cDNA clone was agroinfiltrated into "Beta" and "Thompson Seedless" grapevine plantlets, and the inoculated grapevines exhibited leaf chlorotic mottling and ringspot during the two years of observation. GINV-inoculated "Beta" grapevines had serious leaf chlorotic mottling and ringspot symptoms on the whole plant, while relatively few symptoms were observed on the leaves of agroinoculated "Thompson Seedless" grapevines in early spring and only weak ring spot gradually appeared later in the top young leaves. Our experiments fulfilled Koch's postulates and revealed the causative role of GINV in grapevine chlorotic mottling and ring spot disease.

SELEÇÃO DE REFERÊNCIAS
Detalhe da pesquisa